Henipavirus Pathogenesis in Human Respiratory Epithelial Cells Olivier Escaffre1, Viktoriya
Transcript of Henipavirus Pathogenesis in Human Respiratory Epithelial Cells Olivier Escaffre1, Viktoriya
Henipavirus Pathogenesis in Human Respiratory Epithelial Cells 1
2
Olivier Escaffre1, Viktoriya Borisevich1, J. Russ Carmical3, Deborah Prusak3, Joseph Prescott4, 3
Heinz Feldmann4, Barry Rockx1,2# 4
Departments of Pathology 1, Microbiology & Immunology 2, and Biochemistry & Molecular 5
Biology 3 University of Texas Medical Branch, Galveston, TX, USA 6
Laboratory of Virology 4, Division of Intramural Research, NIAID, NIH 7
Rocky Mountain Laboratories, Hamilton, MT, USA 8
9
Running title: Henipavirus infection of respiratory epithelium 10
Abstract: 250 words 11
Text: 6064 words 12
13
Corresponding author: [email protected] 14
15
Copyright © 2013, American Society for Microbiology. All Rights Reserved.J. Virol. doi:10.1128/JVI.02576-12 JVI Accepts, published online ahead of print on 9 January 2013
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
ABSTRACT 16
Hendra virus (HeV) and Nipah virus (NiV) are deadly zoonotic viruses for which no vaccines or 17
therapeutics are licensed for human use. Henipavirus infection causes severe respiratory illness 18
and encephalitis. Although the exact route of transmission in human is unknown, 19
epidemiological studies and in vivo studies suggest the respiratory tract is important for virus 20
replication. However, the target cells in the respiratory tract are unknown as well as the 21
mechanisms by which henipaviruses can cause disease. 22
Here we characterize henipavirus pathogenesis using primary cells derived from the human 23
respiratory tract. The growth kinetics of NiV-Malaysia, NiV-Bangladesh and HeV was 24
determined in Bronchial/Tracheal Epithelial Cells (NHBE) and Small Airway Epithelial Cells 25
(SAEC). In addition, host responses to infection were assessed by gene expression analysis and 26
immunoassays. 27
Viruses replicated efficiently in both cell types and induced large syncytia. The host response to 28
henipavirus infection in NHBE and SAEC highlighted a difference in the inflammatory response 29
between HeV and NiV strains as well as intrinsic differences in the ability to mount an 30
inflammatory response between NHBE and SAEC. These responses were highest during HeV 31
infection in SAEC as characterized by the levels of key cytokines (IL-6, IL-8, IL-1α, MCP-1, CSFs) 32
responsible for immune cell recruitment. Finally, we identified virus strain-dependant variability 33
in type I interferon antagonism in NHBE/SAEC where NiV-Malaysia counteracted this pathway 34
more efficiently than NiV-Bangladesh or HeV. These results provide crucial new information in 35
the understanding of henipavirus pathogenesis in the human respiratory tract at an early stage 36
of infection. 37
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
INTRODUCTION 38
Nipah (NiV) and Hendra virus (HeV) are emerging zoonotic pathogens of the family 39
Paramyxoviridae and are classified in the genus Henipavirus (14). NiV and HeV both cause 40
severe and often fatal respiratory disease and/or encephalitis in animals and humans. HeV was 41
first isolated during an outbreak of respiratory and neurologic disease in horses and humans in 42
Australia in 1994 (41, 42, 56, 68). To date, a total of 5 outbreaks of HeV involving human cases 43
have been reported in Australia and 7 human cases with a case fatality rate of 57% have been 44
identified (54). The first human cases of NiV infection were identified during an outbreak of 45
severe febrile encephalitis in Malaysia and Singapore in 1998-1999 (8, 16). Several other 46
outbreaks have occurred thereafter in Bangladesh and India almost yearly since 2001 (19, 22, 47
54), with the last outbreak reported in Bangladesh in 2012 (2). NiV strains from Malaysia (M) 48
and Bangladesh (B) are genetically distinct based on phylogenic analyses using amino acid 49
sequences (30, 54). To date NiV is responsible for over 500 human cases with mortality rates 50
ranging from 40% (in Malaysia) (7) to 100% (in Bangladesh/India) (2, 34, 54). The natural host of 51
henipaviruses are fruit bat (Pteropus species) (9, 18, 73) and transmission of these viruses from 52
bats to humans may be direct or via an intermediate host like horses or pigs for HeV and NiV 53
transmission, respectively (1, 9, 41, 44, 47, 48, 58, 59). Interestingly, respiratory symptoms such 54
as cough and difficulty breathing were reported in about 70% of NiV-B and less than 30% of 55
NiV-M-infected patients (31). In addition, in recent outbreaks, a high incidence of person-to-56
person transmission has been reported in Bangladesh/India (17, 19, 23) as opposed to the 57
outbreaks of NiV in Malaysia and HeV in Australia, suggesting differences in host-virus 58
interactions between genetically distinct henipaviruses. 59
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
The main target cells during late stage of henipavirus infection in humans are endothelial cells 60
of blood vessels resulting in vasculitis, vasculitis-induced thrombosis and vascular micro 61
infarction in the central nervous system (CNS) but also in other organs such as lung, spleen and 62
kidney (11, 70, 71). The infection also reaches the CNS parenchymal cells, which altogether play 63
an important role in the pathogenicity of henipaviruses (11, 21). 64
Although the exact route of infection in humans is unknown, previous studies in several 65
laboratory animal models reported an efficient infection through intranasal challenge (6, 32, 52, 66
53, 67), suggesting the respiratory tract is one of the first targets of virus replication. In 67
addition, both NiV and HeV have been isolated from oropharyngeal/respiratory secretions in 68
humans and in animals (10, 40, 64) which emphasize the importance of the respiratory tract in 69
virus replication and potential transmission. In hamsters, NiV infection of the respiratory tract is 70
initiated in the trachea and progresses down the respiratory tract, infecting the bronchial 71
epithelium, and finally causing severe hemorrhagic pneumonia, including the characteristic 72
syncytium formation in the pulmonary endothelium. In contrast, HeV infection is initiated 73
primarily in the small airways of the lungs and not in the trachea or bronchi (53). In humans, 74
henipavirus infection is characterized by influenza like illness, which can progress to pneumonia 75
(7, 16, 46, 59, 60) or acute respiratory distress syndrome (ARDS) as characterized in some cases 76
of NiV-B infection (22). Interestingly, while limited data is available on the histopathology of the 77
lungs of henipavirus cases, changes in the respiratory tract of NiV-M infected patients include 78
hemorrhage, necrosis and inflammation in the epithelium of the small airways but not in the 79
bronchi (71), similar to observations in hamsters (53), and non-human primates (52). Finally, 80
lesions and inflammation were reported in the small airways of HeV infected patients (59, 60, 81
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
70) and no information is available about the histopathological changes in the respiratory tract 82
of NiV-B-infected patients. The specific sites of henipavirus infection in the human respiratory 83
tract are still unknown as well as the mechanism by which these viruses can cause disease. 84
We hypothesize that the human immune response to henipavirus infection at an early step of 85
infection can determine the clinical outcome, explain how the virus can disseminate throughout 86
the host and affect person-to-person transmission. To gain further insight into the early steps of 87
infection, here we report the first characterization of NiV and HeV infection of the human 88
respiratory tract using primary human epithelial cells derived from the bronchi 89
(Bronchial/Tracheal Epithelial Cells, NHBE) and the small airways (Small Airway Epithelial Cells, 90
SAEC). Our results showed that replication kinetics of genetically distinct NiV and HeV strains 91
are efficient in both cell types and result in a differential innate immune response depending on 92
the virus strain and the cell origin. Finally, we demonstrate a virus strain dependent variability 93
in type I IFN signaling that seems independent of the origin of cells from the human respiratory 94
tract. 95
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
MATERIAL AND METHODS 96
97
Viruses and Cells. NiV-Malaysia (NiV-M), NiV-Bangladesh (NiV-B) and HeV were kindly 98
provided by the Special Pathogens Branch (Centers for Disease Control and Prevention, GA, 99
USA). The viruses were propagated on Vero cells (CCL-81; ATCC) in Dulbecco’s modified Eagle’s 100
medium with 400mM L-Glutamine, 4500mg/L of Glucose and Sodium pyruvate (Thermo-101
Scientific, Logan, USA) and supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 102
0.1 mg streptomycin (Sigma-Aldrich, St Louis, USA) at 37°c, 5% CO2. Cells were seeded in 96-103
well plates for virus titration. 104
105
Normal Human Bronchial/Tracheal Epithelial Cells (NHBE) derived from the bronchiale 106
tube and Normal Small Airway Epithelial Cells (SAEC) derived from the distal airspace were 107
obtained with the Clonetics Bronchial/Tracheal Epithelial Cell system and the Clonetics Normal 108
Human Small Airway Epithelial cell system (Clonetics, San Diego, USA), respectively. Monolayers 109
of non-differentiated NHBE and SAEC cells were cultured in 150cm2 flask for 8 days (37°c, 5% 110
CO2) with a Bronchial Epithelial Cell Basal Medium supplied with growth factors BEGM BulletKit 111
and with a Small Airway Epithelial Cell Basal Medium supplied with growth factors SAGM 112
BulletKit, respectively. All NHBE and SAEC cell infections were performed at a multiplicity of 113
infection (MOI) of 5 for 1h to ensure synchronous infection. Cells were then rinsed three times 114
with 1x PBS and appropriate medium was added. NHBE and SAEC cells were seeded in 6-well 115
plates at 1x106 cells/well (each condition performed in triplicate) the day prior to infection for 116
the experiments of virus replication, gene expression and of cytokine/chemokine 117
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
quantification. NHBE and SAEC cells were seeded in 12-well plates at 3.5x105 cells/well (each 118
condition performed in triplicate) the day prior to infection for the quantification of Stat1 and 119
pStat1 by western blot. 120
Viruses were titrated on Vero cells in 96-well plates using ten-fold virus dilutions in 121
triplicate. Virus titer was expressed as median Tissue Culture Infective Dose (TCID50/ml) using 122
Reed & Muench method (50). All work with live viruses was performed in the Galveston 123
National Laboratory Level 4 (BSL-4) at the University of Texas Medical Branch, TX, USA. 124
Gene Expression Analysis. Total cellular RNA from NHBE and SAEC was extracted at 24h 125
post infection (pi) in triplicate using TRIzol Reagent (Invitrogen, Carlsbad, USA), following the 126
manufacturer’s recommendations. RNA was quantified using a NanoDrop ND-1000 (NanoDrop 127
Technologies, Wilmington, USA) and RNA integrity assessed by visualization of 18S and 28S RNA 128
bands using an Agilent BioAnalyzer 2100 (Agilent Technologies, Santa Clara, USA). Total RNA 129
extracted from the samples was processed using the RNA labeling protocol described by 130
Ambion (MessageAmp aRNA Kit Instruction Manual) and hybridized to Affymetrix Gene Chips 131
(HGU133 Plus 2.0 arrays, total genome). Data quality was assessed by applying the quality 132
matrix generated by the Affymetrix GeneChip Command Console (AGCC) software. The 133
resulting data were analyzed with Partek Genomics Suite (Partek, St Louis, USA). Principal 134
component analysis as a quality assurance measure was performed. The raw data were 135
normalized through robust multichip averaging upon import to Partek Genomics Suite. An 136
analysis of variance was carried out and a false discovery rate (FDR) applied to reduce the 137
occurrence of false positives. The data set was filtered for a p-value of 0.05 and a cut-off>2.00, 138
resulting in the final list of differentially expressed genes. Ingenuity Pathway Analysis (IPA) 139
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
software and iReport (Ingenuity systems, Redwood City, USA) were then used to analyze and 140
interpret data. The analysis of the most significant biological functional groups and canonical 141
pathways affected per condition were performed using an uncorrected p-value calculation 142
method (right-tailed Fisher Exact Method, p-value <0.05 or –log(p-value) >1.3). A ratio (r) 143
accounting for the number of overlapping genes from a particular pathway was also introduced 144
to help in the analyses of filtered data. 145
Real Time SYBR Green QPCR Assay Design. Real-time QPCR assays were designed from the 146
coding sequence (CDS) of the gene of interest (NCBI) and exon-exon junctions mapped via BLAT 147
(25). Whenever possible, at least one of the two PCR primers was designed to transcend an 148
exon-intron junction in order to reduce the impact of potential genomic DNA amplification in 149
the surveyed RNA samples. Primers were designed with Primer Express™ 2.0 (Applied 150
Biosystems, Foster City, USA) using default settings (Primer Tm = 58oC-60oC, GC content = 30-151
80%, Amplicon Length = 90-150 nucleotides). Primers were synthesized (IDT, San Jose, USA) 152
and reconstituted to a final concentration of 100μM (master stock) prior to dilution to a 153
working stock of 6μM. Primer sequences used for quantifying the gene expression levels are as 154
follows: Stat1 forward (for): GAAAGTATTACTCCAGGCCAAAGG, Stat1 reverse (rev): 155
TGTAAACATGTCACTCTTCTGTGTTCA, CCL5 for: TCTACACCAGTGGCAAGTGCTC, CCL5 rev: 156
CCCGAACCCATTTCTTCTCTG, CXCL10 for: CTTTCTGACTCTAAGTGGCATTCAAG, CXCL10 rev: 157
TGGATTAACAGGTTGATTACTAATGCTG, CXCL11 for: CCTTGGCTGTGATATTGTGTGC, CXCL11 rev: 158
GAGGCTTTCTCAATATCTGCCAC, IFIT1 for: CTGGGTATGCGATCTCTGCC, IFIT1 rev: 159
TTAAGCGGACAGCCTGCC, IFNB1 for: GCAGTTCCAGAAGGAGGACG, IFNB1 rev: 160
TCCAGCCAGTGCTAGATGAATC, IL-8 for: CAGCCTTCCTGATTTCTGCAG, IL-8 rev: 161
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
AGGTTTGGAGTATGTCTTTATGCACTG, ISG15 for: ATCTTTGCCAGTACAGGAGCTTG, ISG15 rev: 162
GACACCTGGAATTCGTTGCC, MX-1 for: GGAGGAGATCTTTCAGCACCTG, MX-1 rev: 163
GCCGTACGTCTGGAGCATG, ephrin-B2 for: TCCAGAACTAGAAGCTGGTACAAATG, ephrin-B2 rev: 164
GAATGTCCGGCGCTGTTG, ephrin-B3 for: GTCTGAAATGCCCATGGAAAGA and ephrin-B3 rev: 165
GAGGTTGCATTGCTGGTGG. Reverse transcription was performed on 1μg of total RNA 166
(previously assayed via Affymetrix GeneChip) with random primers, utilizing TaqMan reverse 167
transcription reagents (Applied Biosystems, Foster City, USA) as recommended by the 168
manufacturer. Although the mass of input RNA should not be utilized for normalization 169
purposes, amounts of input RNA to be assayed should be equivalent. The reverse transcription 170
reaction was used as template for the subsequent PCR, consisting of FastStart Universal SYBR 171
Green PCR Master Mix (ROX) (Roche, Indianapolis, USA), 1μl template cDNA and assay primers 172
(300nM final concentration) in a total reaction volume of 25 μl. Thermal cycling was carried out 173
with an ABI prism 7500 sequence detection system (Life Technologies, Carlsbad, USA) under 174
factory defaults (50oC, 2 min; 95oC, 10 min; and 40 cycles at 95oC, 15 S; 60oC, 1 min). Threshold 175
cycle numbers (Ct) were defined as fluorescence values, generated by SYBR green binding to 176
double-stranded PCR products, exceeding baseline. Relative transcript levels were quantified as 177
a comparison of measured Ct values for each reaction to a designated control via the ΔΔCt 178
method (29). In order to normalize for template input, 18S rRNA (endogenous control) 179
transcript levels were measured for each sample and utilized in these calculations. A student T-180
test was applied to 18S rRNA CT values to rule out any change in expression of the endogenous 181
control due to treatment. Fold change values were calculated as a log2 ratio of the ΔΔCt 182
averages of the biological replicates. 183
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
Milliplex Analysis. Cytokine/chemokine concentrations in the supernatant of 184
henipavirus- infected NHBE and SAEC cells were determined using a Milliplex Human Cytokine 185
PREMIXED 28 Plex Immunoassay Kit (Millipore, Billerica, USA). Prior analysis, samples were 186
inactivated on dry ice by gamma-radiation (5 Mrad). The assay was performed according to the 187
manufacturer’s instructions. The Human Cytokine Standards were prepared using the NHBE and 188
SAEC medium. The concentration of 28 cytokines (Epidermal Growth Factor (EGF), Granulocyte-189
Colony Stimulating Factor (G-CSF), Granulocyte Macrophage-Colony Stimulating Factor (GM-190
CSF), interferon (IFN)-α2, IFNγ, Interleukin (IL)-1α, IL-1ß, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, 191
IL-12(p40), IL-12(p70), IL-13, IL-15, IL-17A, chemokine ligand 3-like 1 (CCL3L1 or MIP-1α), 192
chemokine ligand 4 (CCL4 or MIP-1ß), chemokine ligand 10 (IP-10 or CXCL10), chemokine ligand 193
11 (CCL11 or Eotaxin), chemokine ligand 13 (CCL13 or MCP-1), Tumor Necrosis Factor (TNF-α), 194
Lymphotoxin alpha (TNFß) and Vascular Endothelial Growth Factor A (VEGF)) were quantified. 195
Western Blot Experiments. To characterize the levels of IFN antagonism in henipavirus-196
infected NHBE and SAEC cells, 1000IU/ml IFNß was added for 1h to stimulate cells at 12, 18 and 197
24h post infection. The cell lysates were then harvested and the expression of signal transducer 198
and activator of transcription 1 (Stat1) and phosphorylated (p)-Stat1 were quantified by 199
western blot. Samples were inactivated by lysing in 2X SDS lysing Buffer (0.5 M Tris-HCl at pH 200
6.8; 20% glycerol; 10% (w/v) SDS; 0.1% (w/v) bromophenol blue and 2-Mercaptoethanol at 201
5.0% final concentration) and heating for 5 min at 100°c. Proteins were runned on SDS-PAGE, 202
transferred to polyvinylidene difluoride membranes (Bio-Rad, Hercules, USA) and blocked in a 203
Superblock buffer (Thermo-Scientific, Logan, USA) before immunodetection. A rabbit polyclonal 204
IgG was used for Stat1 p84/p91 detection (Santa Cruz Biotechnology, Santa Cruz, USA) and for 205
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
p-Stat1(Y701) p84/p91 detection (Cell Signaling Technology, Danvers, USA). A sheep polyclonal 206
antibody to rabbit IgG conjugated to HRP was used as secondary antibody for Stat1 and p-Stat1 207
detection. Beta-actin was used as loading control and was detected using a mouse monoclonal 208
antibody directly conjugated to HRP (abcam, Cambridge, USA). Stat1 and p-Stat1 expression 209
were quantified with Quantity One Software during henipavirus infection at 12, 18 and 24 hpi 210
(experiment performed in triplicate). The Stat1 and p-Stat1 intensities were corrected by 211
dividing by the actin intensity. The ratio pStat1/Stat1 was then generated using the p-Stat1 and 212
Stat1 corrected intensities. 213
Statistical analyses. Comparison of virus replication levels, gene expression fold changes 214
by QPCR assay, concentrations of cytokine/chemokine and of ratios pStat1/Stat1 were 215
subjected to a repeated measure one-way ANOVA test in which the virus strain used (or control 216
versus virus) was the independent variable. When the ANOVAs revealed a significant main 217
effect, a post-hoc test such as Bonferroni’s multiple comparison test was used to determine 218
whether treatment means were significantly different from one another. Comparison of NiV-M 219
or NiV-B or HeV replication levels in cells untreated/treated by IFN was performed using the 220
Paired T test. All data are presented in figures as means ± SD (* p< 0.05, ** p< 0.01, *** p< 221
0.001, **** p< 0.0001). 222
223
224
225
226
227
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
RESULTS 228
229
Primary human epithelial cells derived from the bronchi and the small airway are highly 230
susceptible to henipavirus infection. Epithelial cells derived from the bronchi (NHBE) and the 231
small airways (SAEC) of the human respiratory tract were investigated as potential initial sites of 232
henipavirus replication. Both cell types expressed the henipavirus receptors ephrin-B2 and –B3, 233
suggesting they are permissive for infection. Gene expression of ephrin-B2 in SAEC was 2-fold 234
higher compared to NHBE. In contrast, ephrin-B3 gene expression in NHBE was 5-fold higher 235
than in SAEC. Upon infection, both NHBE and SAEC cells were highly permissive to NiV-M, NiV-B 236
and HeV replication. Using a MOI of 5 to synchronize infection, the first cytopathic effect (CPE), 237
characterized by syncytia formation, in NHBE and SAEC-infected cells was observed as early as 238
12 to 18h post infection (pi), independent of the virus strain. NiV-infected cells showed 239
extensive syncytia formation compared to HeV-infected cells at 24h pi (Figure 1A, 1B). NHBE 240
and SAEC cultures infected with any of the henipavirus strains showed complete CPE by 48h pi. 241
HeV and NiV replication was able to reach a high titer (greater than 106.5 TCID50/ml) in both 242
NHBE and SAEC cells at 32h pi. No significant differences between replication of the two NiV 243
strains and HeV were observed in NHBE cells at any time point up to 48h pi (figure 1C). In 244
contrast, in SAEC cells, HeV replicated significantly faster up to 18h pi (105.2TCID50/ml) 245
compared to NiV-M and NiV-B (103.9 and 103.8 TCID50/ml, respectively; p<0.05). 246
Study of gene expression in henipavirus-infected NHBE and SAEC cells. Characterization of the 247
global henipavirus-host interactions in SAEC and NHBE cells were performed by microarray 248
analysis at 24h pi, a time point at which virus titers were identical for all three viruses (Figure C 249
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
and D) and differential expression of host immune response-related genes, such as IL-6, MX-1 250
and CXCL10, was highest based on preliminary data performed by real-time QRT-PCR assays 251
(data not shown). A global analysis of the data by microarray showed that NiV-M induced a 252
larger number of differentially expressed genes (n) in NHBE and SAEC cells (n=2540 and 2223, 253
respectively) compared to NiV-B (n=1817 and 1836, respectively) or HeV (n=2075 and 1642, 254
respectively, Figure 2A). More than half of those differentially expressed genes in infected NHBE 255
or SAEC cells were common to all 3 virus strains (Figure 2B). 256
To gain more insight into the immune response against henipavirus infection in NHBE and SAEC 257
cells, the most significant functional annotations were determined by Ingenuity Pathway 258
Analysis using all differentially expressed genes per condition (i.e NiV-M or NiV-B or HeV in 259
NHBE or SAEC cells, figure 3A and B). In NHBE cells, the data showed that NiV-M was the only 260
virus that did not affect the expression of genes related to the antimicrobial response, the cell-261
mediated immune response and to the immune cell trafficking. Also, NiV-M infection in NHBE 262
cells affected very few genes from the inflammatory response compared to NiV-B or HeV 263
(figure 3A) but triggered twice more differentially expressed genes in the infectious disease 264
group compared to NiV-B infection. In SAEC cells, NiV-M and NiV-B infection triggered a similar 265
number of differentially expressed genes related to the inflammatory response, the infectious 266
disease, the cell-mediated immune response and to the immune cell trafficking but did not 267
modify the expression of genes related to the antimicrobial response (Figure 3B). Finally, HeV 268
infection triggered at least three times more differentially expressed genes related to the 269
inflammatory response than NiV-M or NiV-B infection. 270
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
The most significant immune response-related canonical pathways were then determined using 271
all differentially expressed genes. In NHBE cells, the IFN signaling pathway and the role of 272
Pattern Recognition Receptors (PRR) pathway, that included Toll-like receptors signaling and 273
RIG-I-like receptors signaling, were in the top ten list of the total canonical pathways affected 274
by HeV (Figure 3C) as with the IL-6 and IFN signaling pathway in SAEC cells (figure 3D). None of 275
these pathways in NHBE or SAEC cells were reported in such a high rank or could even be 276
considered (p>0.05) using NiV-M or NiV-B (figure 3C and D). Surprisingly, no immune response-277
related canonical pathways were observed in the top ten list of the total canonical pathways 278
affected by NiV infection in NHBE and SAEC cells with the exception of B cell receptor signaling 279
in NiV-B-infected NHBE cells. In addition, the p-values associated to IL-6 and 8 signaling during 280
NiV-B infection in NHBE cells were more significant than in HeV or NiV-M infection (Figure 3C). 281
The p-values associated to IL-6 and 8 signaling were significant in NiV-M infection but not 282
during NiV-B infection in SAEC cells (Figure 3D). Finally, an analysis of the differentially 283
expressed genes that were unique to NiV-M or NiV-B infection (Figure 2B) did not show any 284
immune response-related canonical pathway in both NHBE and SAEC cells (p>0.05). However, 285
using HeV, the role of PRR, the IFN signaling and the role of RIG-I-like receptors in antiviral 286
innate immunity pathway had significant p-values in NHBE cells so as the IFN signaling, the IL-6, 287
the GM-CSF, the role of PRR in recognition of viruses and the IL-17 pathway in SAEC cells. 288
Overall, the fold changes for the most upregulated immune response-related genes were 289
higher in SAEC compared to NHBE cells using the same virus and in HeV- than in NiV-infected 290
cells (Table 1). It included chemokines (CCL5, CXCL10 and CXCL11), interleukins (IL-8, IL-24A), 291
interferon-induced proteins (IFIT1, IFIT3, MX-1, IFI6, IFI27, IFI44L) and interferon beta 1 (IFNB1). 292
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
The relative quantification of a subset of these upregulated genes in infected NHBE and SAEC 293
cells (CCL5, CXCL10, CXCL11, IFIT1, IL-8, ISG15, MX-1, Stat1 and IFNB1) were confirmed by real-294
time QPCR assays (Figure 4) which confirmed the fold change observed with the microarray 295
data (Table 1). 296
Cytokine/chemokine production by henipavirus-infected NHBE and SAEC cells. The amount of 297
a subset of cytokines and chemokines produced by henipavirus-infected NHBE and SAEC cells 298
was determined to confirm the gene expression results (Figure 5). Among a panel of 28 human 299
cytokines/chemokines tested, only 6 cytokines including G-CSF, GM-CSF, IL-1α, IL-6, IL-8 and 300
VEGF plus 3 chemokines such as CXCL10, MCP-1 and Eotaxin were detected in the supernatant 301
of NHBE or SAEC cells at 24h pi. Surprisingly, genes for G-CSF and MCP-1 were not significantly 302
expressed in the microarray analysis while their protein expression levels in the supernatant of 303
infected NHBE or SAEC cells were elevated at least 2-fold compared to non-infected NHBE or 304
SAEC cells. This was also true for GM-CSF in NHBE cells and for IL-1α in SAEC cells. Finally, the 305
quantity of IL-6, IL-8, VEGF, CXCL10 and Eotaxin detected in the supernatant of infected cells 306
were concomitant with their respective gene expression fold change. 307
With exception of VEGF, all cytokines/chemokines were secreted at consistently higher 308
concentrations in the supernatants of SAEC cells than in the supernatants of NHBE cells when 309
the same virus was used. Surprisingly, no significant difference could be noticed between NiV-310
M and NiV-B infection in the supernatant of infected NHBE or SAEC cells as to the amount of 311
cytokines/chemokines, with the exception of G-CSF and GM-CSF in NHBE cells (p<0.05). IL-1α 312
and CXCL10 were significantly higher in the supernatant of HeV- compared to NiV-M- or NiV-B-313
infected SAEC cells (p<0.001). This difference was also noticed in the supernatant of NHBE cells 314
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
with CXCL10 (p<0.001). Conversely, the level of MCP-1 was the only selected chemokine that 315
was in lower concentration in the supernatant of HeV-infected SAEC cells than in the 316
supernatant of NiV-infected SAEC cells. 317
Type I interferon pretreatment of epithelial cells derived from the bronchi and the small 318
airway can limit henipavirus replication. Since NiV and HeV have been shown to counteract the 319
innate immune response and particularly the type I interferon (IFN) response, the effect of IFN 320
treatment on virus replication in NHBE and SAEC cells was assessed (figure 6A and B). Cells 321
were treated with 1000UI/ml IFNß for 24h prior infection. IFN treatment of NHBE cells resulted 322
in complete inhibition of NiV-M and NiV-B replication while low levels of HeV replication were 323
observed at 32h pi (103.7, 103.5 and 104.8 TCID50/ml for NiV-M, NiV-B and HeV, respectively, 324
P>0.05). The mean virus titer of HeV, NiV-M and NiV-B at 32h pi was decreased by 2-3 log 325
(p>0.05), in NHBE cells pretreated with IFN. IFN treatment of SAEC cells delayed both NiV-M 326
and HeV replication up to 32h while NiV-B replication was observed as early as 24h pi (103.4, 327
104.7 and 103.6 TCID50/ml for NiV-M, NiV-B and HeV, respectively; P<0.001). The mean virus titer 328
of NiV-M, NiV-B or HeV at 32h pi was decreased 1-2 log (p<0.05), in IFN treated SAEC cells. 329
Characterization of the interferon immune response in henipavirus-infected NHBE and SAEC 330
cells. Based on the microarray results, the interferon signaling was one of the most significant 331
canonical pathways affected by HeV but not with NiV infection in both NHBE and SAEC cells at 332
24hpi. The ability of HeV and NiV strains to antagonize the interferon signaling was thus 333
assessed in time by quantifying the amount of phosphorylated (p)-Stat1. The levels of ß-actin 334
and Stat1 during henipavirus infection in NHBE or SAEC cells did not significantly change 335
compared their respective levels in non-infected cells at 12, 18 and 24h pi (data not shown). 336
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
However, henipavirus infection of NHBE and SAEC cells resulted in a significant reduction in 337
pStat1 induction following a 1hr treatment with 1000UI/ml IFNß as compared to non-infected 338
controls (Figure 7A and B). No significant difference in pStat1 induction between the 3 virus 339
strains was observed at 12hpi. Interestingly, activation of pStat1 was completely blocked by NiV-340
M as early as 18hpi (ratio pStat1/Stat1 of 0) but not by NiV-B or HeV (p<0.001). The quantity of 341
pStat1 in NiV-B or HeV-infected cells (ratio pStat1/Stat1 of 1.0 and 1.1 in NHBE cells, 342
respectively; ratio pStat1/Stat1 of 0.8 and 0.9 in SAEC cells, respectively) was however at that 343
time reduced by about 2 compared to p-Stat1 in non-infected NHBE or SAEC cells (ratio 344
pStat1/Stat1 of 1.9 and 2.1, respectively; p<0.001). Finally, no pStat1 could be detected in any of 345
the henipavirus-infected cells at 24h pi (ratio p-Stat1/Stat1 of 0) while the ratio in non-infected 346
NHBE or SAEC cells was equal to 1.2 and 1.0, respectively (p<0.001). 347
348
349
350
351
352
353
354
355
356
357
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
DISCUSSION 358
Hendra and Nipah viruses are newly emerging zoonotic viruses that can cause severe 359
respiratory illness and encephalitis in humans. Despite intensive studies, little is known about 360
the early stages of henipavirus infection in the human respiratory tract. Here we report the 361
establishment and characterization of NiV and HeV infection in human respiratory 362
epitheliumusing undifferentiated primary epithelial cell monolayers derived from bronchi and 363
small airways to study the role of the host responses in pathogenesis. 364
The epithelial cells derived from the bronchi (NHBE) and the small airways (SAEC) of the human 365
respiratory tract were highly susceptible to NiV and HeV infection as characterized by high peak 366
titers and characteristic syncytia formation as early as 12h pi. Although HeV initially replicated 367
faster than NiV-M and NiV-B in the small airways, all virus strains reached a similar peak of 368
replication as early as 32h pi in both cell types, making them likely targets for virus infection 369
during natural infection. The efficient replication of HeV in bronchi derived epithelial cells was 370
surprising as we previously observed that HeV antigen could not be detected in the epithelium 371
of trachea and bronchi of infected hamsters, suggesting limited replication in these cells (53). 372
One explanation is that this observation is species specific. Another key difference is the fact 373
that we used undifferentiated epithelial cells in the current study. The conditions present in 374
tissue culture result in a de-differentiation and subsequent loss of beating cilia which may affect 375
virus entry and replication by an unidentified mechanism. Studies into the role of epithelial 376
differentiation in virus susceptibility and host responses are ongoing. Both NHBE and SAEC cell 377
types have previously been used as in vitro models to study a variety of respiratory viruses 378
including other members of the Paramyxoviridae family such as measles virus and respiratory 379
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
syncytial virus (38, 63). Overall, these data suggest that human epithelial cells derived from the 380
bronchi and the small airways are highly relevant to study henipavirus replication in the 381
respiratory epithelium.. 382
The global analysis of host gene expression revealed two major characteristics. First, henipavirus 383
infection of SAEC resulted in higher fold changes in host gene expression compared to NHBE 384
cells, suggesting that epithelial cells derived from different areas of the human respiratory tract 385
respond differentially to henipavirus infection. This result is in line with the observations that 386
NiV infection in humans cases, as well as in hamsters, resulted in inflammation of the small 387
airways but not the bronchi (53, 71). Secondly, infection of NHBE and SAEC with NiV-M, NiV-B 388
and HeV resulted in differences in induction of host immune response between these 389
genetically distinct henipavirus strains. Overall, host responses were higher in HeV infected 390
cells, compared to both NiV strains. Specifically, NiV-M infection in NHBE cells resulted in 391
differential expression of very few number of genes related to the inflammatory response, 392
compared to NiV-B or HeV. This is in agreement with the observation that no inflammation 393
occurred in the epithelium of bronchi in NiV-M-infected patients (71) and suggests that 394
inflammation may occur in the bronchi of NiV-B or HeV infected patients even though no 395
histopathological changes have been reported so far in this area. Our data clearly showed that 396
key inflammatory mediators, including IL-6, IL-8, CXCL10, MCP-1 and CCL5, were highly 397
upregulated in SAEC but not in NHBE cells infected with henipavirus. Interestingly, HeV induced 398
higher levels of these cytokines and chemokines compared to both NiV strains with the 399
exception of MCP-1. IL-6, which is released by epithelial cells and macrophages in the 400
respiratory tract, promotes pulmonary inflammation, and high levels in bronchoalveolar lavage 401
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
fluid or in serum are correlated with severity and mortality of Acute Respiratory Distress 402
Syndrome (ARDS) (20, 28) and with severe disease including respiratory insufficiency in 403
pandemic H1N1 influenza-infected patient (5, 43), respectively. In addition, inhibition of IL-6 404
reduces lung injury in mice with acute kidney injury by reducing the levels of IL-8 and neutrophil 405
influx in the lung (26). In line with the previous statement, IL-8 has also been shown to control 406
neutrophil-mediated inflammation during rhinovirus infection (65), to contribute in the 407
pathogenesis of ARDS (24, 36, 51, 66) and was recently reported at elevated levels in serum of 408
H5N1-infected patient especially in those who succumbed to the infection due to respiratory 409
insufficiency (13). Therefore, our data suggest that IL-6 and IL-8 play important roles in 410
inflammation of the small airways due to an increased neutrophil influx in the small airways, as 411
observed in NiV-M infected dogs (69) and in HeV infected swine (27), compared to the bronchi. 412
Chemokines such as CXCL10 and MCP-1 are macrophage chemo-attractants and, along with 413
CCL5, recruit circulating leukocytes to the inflamed tissue. Overexpression of CXCL-10 has 414
previously been reported in the lung of NiV-M and HeV infected hamsters and correlated with 415
the influx of inflammatory cells (35, 53). Its gene expression level in the lung of HeV infected 416
hamsters was also higher than in NiV infected hamsters (53), corroborating our observations in 417
infected NHBE and SAEC cells. Even though it has been described that MCP-1 can be released 418
from bronchial epithelium and contributes to the inflammatory pathology of bronchial asthma 419
(62), in the current study, MCP-1 was expressed in infected SAEC cells only. Similarly, CCL5 gene 420
expression was also mainly observed in infected SAEC cells, especially during HeV infection, 421
which suggest altogether an important role of macrophage and circulating leukocyte 422
recruitment in the small airways leading to a larger inflammatory response compared to the 423
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
bronchi. These results are in agreement with histopathological changes observed in the lung of 424
2 HeV-infected patients showing either an acute pulmonary syndrome with intra-alveolar 425
macrophages and other inflammatory cells in the small airways (70) or focal necrotizing 426
alveolitis with an influx of macrophages as well (60). This is also in line with the high levels of 427
the inflammatory cytokine IL-1α and granulocytes stimulating factor (G-CSF and GM-CSF) 428
secreted in the supernatant of infected SAEC cells and again mostly during HeV infection. 429
In addition to uncovering the role of several key regulators of inflammation, microarray data 430
also revealed differential gene expression in the signaling pathway of pattern recognition 431
receptor (PRR) activation in NiV-B and HeV infected cells but not with NiV-M. The RIG-I-like 432
receptor pathway was activated during HeV infection suggesting that type I interferon was 433
expressed in infected cells. This was confirmed by the increased IFN-β gene expression in all 434
infected cells, mainly in SAEC cells and especially during HeV-infection which was in line with 435
the activation of the IFNα/ß signaling pathway in HeV infected cells. Consequently, higher levels 436
of interferon-induced gene expression such as IFIT1, IFIT3, MX-1, ISG-15 and IFIT35 were 437
observed in HeV- than in NiV-infected cells. Surprisingly, the high expression of CXCL-10 in HeV 438
infected cells was independent of interferon gamma induction and could be the result of a 439
direct viral activation of steps in the interferon pathway (3, 39, 57). Interestingly, while NiV and 440
HeV infection resulted in complete inhibition of Stat1 activation at 24h pi, NiV-M was more 441
efficient at blocking Stat1 activation at earlier time points compared to NiV-B and HeV. This 442
result is in line with the differences of NiV-M replication levels in untreated cellular models and 443
pretreated by IFN type I, which were higher than HeV, suggesting a more important role of IFN 444
response blocking to satisfy NiV-M replication. Since growth kinetics for all three viruses were 445
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
similar, it is likely that the viral proteins P, V and W, that can each inhibit phosphorylation of 446
Stat1 (4, 12, 15, 45, 55, 61) differentially affect the IFN pathway dependent on the virus strain. 447
This differential induction of the IFN response may in turn affect virulence through an unknown 448
mechanism as suggested for a recently discovered henipavirus, Cedar virus (33) as well as for 449
influenza viruses. The non structural NS1 protein of influenza virus is the main viral IFN 450
antagonist and NS1 proteins of more virulent strains were recently reported as having a higher 451
interferon type I signaling inhibitory activity in vitro as well as contributing to a more persistent 452
infection in the upper and lower respiratory tract of ferrets (37). In outbreaks, the NiV-M strain 453
has been less virulent compared to the NiV-B strain despite an increased ability to block 454
interferon type I signaling in vitro. In various animal models, such as hamsters, ferrets and 455
African green monkeys, HeV has consistently been more virulent compared to NiV-M and NiV-B 456
despite being more sensitive to IFN (unpublished data). Interestingly, a NiV-M strain lacking 457
either the C or V protein did not cause any clinical signs in hamster which was possibly due to a 458
reduced replication ability as observed in vitro (74). These results suggest that viral proteins 459
with IFN antagonist functions can influence the virulence although the exact role of interferon 460
antagonism in the pathogenesis of henipaviruses remains unclear. 461
462
Finally, the high level of secreted VEGF, as observed in the supernatant of infected NHBE cells, 463
may play a role in airway remodeling, a phenomenon previously observed during rhinovirus-464
associated asthma exacerbations (49). The monolayer NHBE cells used in this study define a 465
simplified model but if relevant in vivo, the VEGF overexpression might affect the subjacent 466
endothelial cells and lead to vascular leakage and increased permeability (72). This is part of 467
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
ongoing studies using a more complex in vitro model including both epithelial and endothelial 468
cells. To our knowledge, there is no study reporting a role of VEGF during henipavirus infection 469
or a remodeling of the respiratory tract in infected animals and in human cases. Its function in 470
the respiratory tract, and particularly in the bronchi, in facilitating henipavirus dissemination 471
into the vascular system is still unknown and requires further investigations. 472
In conclusion, our data show that henipaviruses are able to efficiently replicate in epithelial 473
cells derived from the bronchi and the small airways of the human respiratory tract. Infection of 474
these cells results in a higher inflammatory response in SAEC compared to NHBE cells, 475
especially during HeV infection including key inflammatory mediators; IL-6, 8, IL-1α, MCP-1, G-476
CSF, GM-CSF and CXCL10. Finally, we demonstrate a virus strain dependent variability in type I 477
IFN signaling. This study demonstrates that primary human epithelial cells derived from the 478
bronchi and the small airways serves as an important site of HeV and NiV replication suggesting 479
that both viruses have the potential for human-to-human transmission through aerosols. We 480
believe that these models allow for more detailed studies of the pathogenesis of respiratory 481
disease caused by HeV and NiV infection in humans. These data provide several target genes 482
and pathways that potentially play roles in henipavirus pathogenesis which will be valuable as 483
candidates for future studies of the mechanism of henipavirus pathogenesis and as potential 484
targets for treatment. 485
486
ACKNOWLEDGEMENTS 487
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
The study was funded by the University of Texas Medical Branch startup funds and by the 488
Intramural Research Program, NIAID, NIH. We also thank the Philippe Foundation for financial 489
support to OE. We thank Alisha Prather for critical review of the manuscript. 490
REFERENCES 491
492
1. Ali, R., A. W. Mounts, U. D. Parashar, M. Sahani, M. S. Lye, M. M. Isa, K. Balathevan, M. T. Arif, 493 and T. G. Ksiazek. 2001. Nipah virus among military personnel involved in pig culling during an 494 outbreak of encephalitis in Malaysia, 1998-1999. Emerging infectious diseases 7:759-761. 495
2. Anonymous. 2012. Nipah virus, fatal-Bangladesh: (Faridpur). ProMED-mail 2012. February 4, 496 2012, archive no. 20110204.0402. 497
3. Asensio, V. C., J. Maier, R. Milner, K. Boztug, C. Kincaid, M. Moulard, C. Phillipson, K. Lindsley, 498 T. Krucker, H. S. Fox, and I. L. Campbell. 2001. Interferon-independent, human 499 immunodeficiency virus type 1 gp120-mediated induction of CXCL10/IP-10 gene expression by 500 astrocytes in vivo and in vitro. Journal of virology 75:7067-7077. 501
4. Basler, C. F. 2012. Nipah and Hendra Virus Interactions with the Innate Immune System. Current 502 topics in microbiology and immunology. 503
5. Bermejo-Martin, J. F., R. Ortiz de Lejarazu, T. Pumarola, J. Rello, R. Almansa, P. Ramirez, I. 504 Martin-Loeches, D. Varillas, M. C. Gallegos, C. Seron, D. Micheloud, J. M. Gomez, A. Tenorio-505 Abreu, M. J. Ramos, M. L. Molina, S. Huidobro, E. Sanchez, M. Gordon, V. Fernandez, A. Del 506 Castillo, M. A. Marcos, B. Villanueva, C. J. Lopez, M. Rodriguez-Dominguez, J. C. Galan, R. 507 Canton, A. Lietor, S. Rojo, J. M. Eiros, C. Hinojosa, I. Gonzalez, N. Torner, D. Banner, A. Leon, P. 508 Cuesta, T. Rowe, and D. J. Kelvin. 2009. Th1 and Th17 hypercytokinemia as early host response 509 signature in severe pandemic influenza. Crit Care 13:R201. 510
6. Bossart, K. N., B. Rockx, F. Feldmann, D. Brining, D. Scott, R. Lacasse, J. B. Geisbert, Y. R. Feng, 511 Y. P. Chan, A. C. Hickey, C. C. Broder, H. Feldmann, and T. W. Geisbert. 2012. A hendra virus g 512 glycoprotein subunit vaccine protects african green monkeys from nipah virus challenge. Science 513 translational medicine 4:146ra107. 514
7. Chong, H. T., S. R. Kunjapan, T. Thayaparan, J. Tong, V. Petharunam, M. R. Jusoh, and C. T. Tan. 515 2002. Nipah encephalitis outbreak in Malaysia, clinical features in patients from Seremban. The 516 Canadian journal of neurological sciences. Le journal canadien des sciences neurologiques 517 29:83-87. 518
8. Chua, K. B., W. J. Bellini, P. A. Rota, B. H. Harcourt, A. Tamin, S. K. Lam, T. G. Ksiazek, P. E. 519 Rollin, S. R. Zaki, W. Shieh, C. S. Goldsmith, D. J. Gubler, J. T. Roehrig, B. Eaton, A. R. Gould, J. 520 Olson, H. Field, P. Daniels, A. E. Ling, C. J. Peters, L. J. Anderson, and B. W. Mahy. 2000. Nipah 521 virus: a recently emergent deadly paramyxovirus. Science 288:1432-1435. 522
9. Chua, K. B., C. L. Koh, P. S. Hooi, K. F. Wee, J. H. Khong, B. H. Chua, Y. P. Chan, M. E. Lim, and S. 523 K. Lam. 2002. Isolation of Nipah virus from Malaysian Island flying-foxes. Microbes and infection 524 / Institut Pasteur 4:145-151. 525
10. Chua, K. B., S. K. Lam, K. J. Goh, P. S. Hooi, T. G. Ksiazek, A. Kamarulzaman, J. Olson, and C. T. 526 Tan. 2001. The presence of Nipah virus in respiratory secretions and urine of patients during an 527 outbreak of Nipah virus encephalitis in Malaysia. The Journal of infection 42:40-43. 528
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
11. Chua, K. B., S. K. Lam, C. T. Tan, P. S. Hooi, K. J. Goh, N. K. Chew, K. S. Tan, A. Kamarulzaman, 529 and K. T. Wong. 2000. High mortality in Nipah encephalitis is associated with presence of virus 530 in cerebrospinal fluid. Annals of neurology 48:802-805. 531
12. Ciancanelli, M. J., V. A. Volchkova, M. L. Shaw, V. E. Volchkov, and C. F. Basler. 2009. Nipah 532 virus sequesters inactive STAT1 in the nucleus via a P gene-encoded mechanism. Journal of 533 virology 83:7828-7841. 534
13. de Jong, M. D., C. P. Simmons, T. T. Thanh, V. M. Hien, G. J. Smith, T. N. Chau, D. M. Hoang, N. 535 V. Chau, T. H. Khanh, V. C. Dong, P. T. Qui, B. V. Cam, Q. Ha do, Y. Guan, J. S. Peiris, N. T. Chinh, 536 T. T. Hien, and J. Farrar. 2006. Fatal outcome of human influenza A (H5N1) is associated with 537 high viral load and hypercytokinemia. Nature medicine 12:1203-1207. 538
14. Eaton, B. T., C. C. Broder, and L. F. Wang. 2005. Hendra and Nipah viruses: pathogenesis and 539 therapeutics. Current molecular medicine 5:805-816. 540
15. Fontana, J. M., B. Bankamp, and P. A. Rota. 2008. Inhibition of interferon induction and 541 signaling by paramyxoviruses. Immunological reviews 225:46-67. 542
16. Goh, K. J., C. T. Tan, N. K. Chew, P. S. Tan, A. Kamarulzaman, S. A. Sarji, K. T. Wong, B. J. 543 Abdullah, K. B. Chua, and S. K. Lam. 2000. Clinical features of Nipah virus encephalitis among 544 pig farmers in Malaysia. The New England journal of medicine 342:1229-1235. 545
17. Gurley, E. S., J. M. Montgomery, M. J. Hossain, M. Bell, A. K. Azad, M. R. Islam, M. A. Molla, D. 546 S. Carroll, T. G. Ksiazek, P. A. Rota, L. Lowe, J. A. Comer, P. Rollin, M. Czub, A. Grolla, H. 547 Feldmann, S. P. Luby, J. L. Woodward, and R. F. Breiman. 2007. Person-to-person transmission 548 of Nipah virus in a Bangladeshi community. Emerging infectious diseases 13:1031-1037. 549
18. Halpin, K., P. L. Young, H. E. Field, and J. S. Mackenzie. 2000. Isolation of Hendra virus from 550 pteropid bats: a natural reservoir of Hendra virus. The Journal of general virology 81:1927-1932. 551
19. Harit, A. K., R. L. Ichhpujani, S. Gupta, K. S. Gill, S. Lal, N. K. Ganguly, and S. P. Agarwal. 2006. 552 Nipah/Hendra virus outbreak in Siliguri, West Bengal, India in 2001. The Indian journal of 553 medical research 123:553-560. 554
20. Headley, A. S., E. Tolley, and G. U. Meduri. 1997. Infections and the inflammatory response in 555 acute respiratory distress syndrome. Chest 111:1306-1321. 556
21. Hooper, P., S. Zaki, P. Daniels, and D. Middleton. 2001. Comparative pathology of the diseases 557 caused by Hendra and Nipah viruses. Microbes and infection / Institut Pasteur 3:315-322. 558
22. Hossain, M. J., E. S. Gurley, J. M. Montgomery, M. Bell, D. S. Carroll, V. P. Hsu, P. Formenty, A. 559 Croisier, E. Bertherat, M. A. Faiz, A. K. Azad, R. Islam, M. A. Molla, T. G. Ksiazek, P. A. Rota, J. 560 A. Comer, P. E. Rollin, S. P. Luby, and R. F. Breiman. 2008. Clinical presentation of nipah virus 561 infection in Bangladesh. Clinical infectious diseases : an official publication of the Infectious 562 Diseases Society of America 46:977-984. 563
23. Hsu, V. P., M. J. Hossain, U. D. Parashar, M. M. Ali, T. G. Ksiazek, I. Kuzmin, M. Niezgoda, C. 564 Rupprecht, J. Bresee, and R. F. Breiman. 2004. Nipah virus encephalitis reemergence, 565 Bangladesh. Emerging infectious diseases 10:2082-2087. 566
24. Jorens, P. G., J. Van Damme, W. De Backer, L. Bossaert, R. F. De Jongh, A. G. Herman, and M. 567 Rampart. 1992. Interleukin 8 (IL-8) in the bronchoalveolar lavage fluid from patients with the 568 adult respiratory distress syndrome (ARDS) and patients at risk for ARDS. Cytokine 4:592-597. 569
25. Kent, W. J. 2002. BLAT--the BLAST-like alignment tool. Genome research 12:656-664. 570 26. Klein, C. L., T. S. Hoke, W. F. Fang, C. J. Altmann, I. S. Douglas, and S. Faubel. 2008. Interleukin-571
6 mediates lung injury following ischemic acute kidney injury or bilateral nephrectomy. Kidney 572 international 74:901-909. 573
27. Li, M., C. Embury-Hyatt, and H. M. Weingartl. 2010. Experimental inoculation study indicates 574 swine as a potential host for Hendra virus. Veterinary research 41:33. 575
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
28. Lin, W. C., C. F. Lin, C. L. Chen, C. W. Chen, and Y. S. Lin. 2010. Prediction of outcome in patients 576 with acute respiratory distress syndrome by bronchoalveolar lavage inflammatory mediators. 577 Exp Biol Med (Maywood) 235:57-65. 578
29. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time 579 quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. 580
30. Lo, M. K., L. Lowe, K. B. Hummel, H. M. Sazzad, E. S. Gurley, M. J. Hossain, S. P. Luby, D. M. 581 Miller, J. A. Comer, P. E. Rollin, W. J. Bellini, and P. A. Rota. 2012. Characterization of Nipah 582 virus from outbreaks in Bangladesh, 2008-2010. Emerging infectious diseases 18:248-255. 583
31. Lo, M. K., and P. A. Rota. 2008. The emergence of Nipah virus, a highly pathogenic 584 paramyxovirus. Journal of clinical virology : the official publication of the Pan American Society 585 for Clinical Virology 43:396-400. 586
32. Maisner, A., J. Neufeld, and H. Weingartl. 2009. Organ- and endotheliotropism of Nipah virus 587 infections in vivo and in vitro. Thrombosis and haemostasis 102:1014-1023. 588
33. Marsh, G. A., C. de Jong, J. A. Barr, M. Tachedjian, C. Smith, D. Middleton, M. Yu, S. Todd, A. J. 589 Foord, V. Haring, J. Payne, R. Robinson, I. Broz, G. Crameri, H. E. Field, and L. F. Wang. 2012. 590 Cedar virus: a novel henipavirus isolated from Australian bats. PLoS pathogens 8:e1002836. 591
34. Marsh, G. A., and L. F. Wang. 2012. Hendra and Nipah viruses: why are they so deadly? Current 592 opinion in virology 2:242-247. 593
35. Mathieu, C., V. Guillaume, A. Sabine, K. C. Ong, K. T. Wong, C. Legras-Lachuer, and B. Horvat. 594 2012. Lethal Nipah virus infection induces rapid overexpression of CXCL10. PloS one 7:e32157. 595
36. McGuire, W. W., R. G. Spragg, A. B. Cohen, and C. G. Cochrane. 1982. Studies on the 596 pathogenesis of the adult respiratory distress syndrome. The Journal of clinical investigation 597 69:543-553. 598
37. Meunier, I., and V. von Messling. 2011. NS1-mediated delay of type I interferon induction 599 contributes to influenza A virulence in ferrets. The Journal of general virology 92:1635-1644. 600
38. Mochizuki, H., M. Todokoro, and H. Arakawa. 2009. RS virus-induced inflammation and the 601 intracellular glutathione redox state in cultured human airway epithelial cells. Inflammation 602 32:252-264. 603
39. Mossman, K. L., P. F. Macgregor, J. J. Rozmus, A. B. Goryachev, A. M. Edwards, and J. R. 604 Smiley. 2001. Herpes simplex virus triggers and then disarms a host antiviral response. Journal 605 of virology 75:750-758. 606
40. Mounts, A. W., H. Kaur, U. D. Parashar, T. G. Ksiazek, D. Cannon, J. T. Arokiasamy, L. J. 607 Anderson, and M. S. Lye. 2001. A cohort study of health care workers to assess nosocomial 608 transmissibility of Nipah virus, Malaysia, 1999. The Journal of infectious diseases 183:810-813. 609
41. Murray, K., P. Selleck, P. Hooper, A. Hyatt, A. Gould, L. Gleeson, H. Westbury, L. Hiley, L. 610 Selvey, B. Rodwell, and et al. 1995. A morbillivirus that caused fatal disease in horses and 611 humans. Science 268:94-97. 612
42. O'Sullivan, J. D., A. M. Allworth, D. L. Paterson, T. M. Snow, R. Boots, L. J. Gleeson, A. R. Gould, 613 A. D. Hyatt, and J. Bradfield. 1997. Fatal encephalitis due to novel paramyxovirus transmitted 614 from horses. Lancet 349:93-95. 615
43. Paquette, S. G., D. Banner, Z. Zhao, Y. Fang, S. S. Huang, A. J. Leomicronn, D. C. Ng, R. Almansa, 616 I. Martin-Loeches, P. Ramirez, L. Socias, A. Loza, J. Blanco, P. Sansonetti, J. Rello, D. Andaluz, B. 617 Shum, S. Rubino, R. O. de Lejarazu, D. Tran, G. Delogu, G. Fadda, S. Krajden, B. B. Rubin, J. F. 618 Bermejo-Martin, A. A. Kelvin, and D. J. Kelvin. 2012. Interleukin-6 is a potential biomarker for 619 severe pandemic H1N1 influenza A infection. PloS one 7:e38214. 620
44. Parashar, U. D., L. M. Sunn, F. Ong, A. W. Mounts, M. T. Arif, T. G. Ksiazek, M. A. Kamaluddin, 621 A. N. Mustafa, H. Kaur, L. M. Ding, G. Othman, H. M. Radzi, P. T. Kitsutani, P. C. Stockton, J. 622 Arokiasamy, H. E. Gary, Jr., and L. J. Anderson. 2000. Case-control study of risk factors for 623
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
human infection with a new zoonotic paramyxovirus, Nipah virus, during a 1998-1999 outbreak 624 of severe encephalitis in Malaysia. The Journal of infectious diseases 181:1755-1759. 625
45. Park, M. S., M. L. Shaw, J. Munoz-Jordan, J. F. Cros, T. Nakaya, N. Bouvier, P. Palese, A. Garcia-626 Sastre, and C. F. Basler. 2003. Newcastle disease virus (NDV)-based assay demonstrates 627 interferon-antagonist activity for the NDV V protein and the Nipah virus V, W, and C proteins. 628 Journal of virology 77:1501-1511. 629
46. Paton, N. I., Y. S. Leo, S. R. Zaki, A. P. Auchus, K. E. Lee, A. E. Ling, S. K. Chew, B. Ang, P. E. 630 Rollin, T. Umapathi, I. Sng, C. C. Lee, E. Lim, and T. G. Ksiazek. 1999. Outbreak of Nipah-virus 631 infection among abattoir workers in Singapore. Lancet 354:1253-1256. 632
47. Playford, E. G., B. McCall, G. Smith, V. Slinko, G. Allen, I. Smith, F. Moore, C. Taylor, Y. H. Kung, 633 and H. Field. 2010. Human Hendra virus encephalitis associated with equine outbreak, Australia, 634 2008. Emerging infectious diseases 16:219-223. 635
48. Premalatha, G. D., M. S. Lye, J. Ariokasamy, U. D. Parashar, R. Rahmat, B. Y. Lee, and T. G. 636 Ksiazek. 2000. Assessment of Nipah virus transmission among pork sellers in Seremban, 637 Malaysia. The Southeast Asian journal of tropical medicine and public health 31:307-309. 638
49. Psarras, S., E. Volonaki, C. L. Skevaki, M. Xatzipsalti, A. Bossios, H. Pratsinis, S. Tsigkos, D. 639 Gourgiotis, A. G. Constantopoulos, A. Papapetropoulos, P. Saxoni-Papageorgiou, and N. G. 640 Papadopoulos. 2006. Vascular endothelial growth factor-mediated induction of angiogenesis by 641 human rhinoviruses. The Journal of allergy and clinical immunology 117:291-297. 642
50. Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty percent endpoints. The 643 American Journal of Hygiene 27:493-497. 644
51. Rinaldo, J. E., and H. Borovetz. 1985. Deterioration of oxygenation and abnormal lung 645 microvascular permeability during resolution of leukopenia in patients with diffuse lung injury. 646 The American review of respiratory disease 131:579-583. 647
52. Rockx, B., K. N. Bossart, F. Feldmann, J. B. Geisbert, A. C. Hickey, D. Brining, J. Callison, D. 648 Safronetz, A. Marzi, L. Kercher, D. Long, C. C. Broder, H. Feldmann, and T. W. Geisbert. 2010. A 649 novel model of lethal Hendra virus infection in African green monkeys and the effectiveness of 650 ribavirin treatment. Journal of virology 84:9831-9839. 651
53. Rockx, B., D. Brining, J. Kramer, J. Callison, H. Ebihara, K. Mansfield, and H. Feldmann. 2011. 652 Clinical outcome of henipavirus infection in hamsters is determined by the route and dose of 653 infection. Journal of virology 85:7658-7671. 654
54. Rockx, B., R. Winegar, and A. N. Freiberg. 2012. Recent progress in henipavirus research: 655 Molecular biology, genetic diversity, animal models. Antiviral research. 656
55. Rodriguez, J. J., J. P. Parisien, and C. M. Horvath. 2002. Nipah virus V protein evades alpha and 657 gamma interferons by preventing STAT1 and STAT2 activation and nuclear accumulation. 658 Journal of virology 76:11476-11483. 659
56. Rogers, R. J., I. C. Douglas, F. C. Baldock, R. J. Glanville, K. T. Seppanen, L. J. Gleeson, P. N. 660 Selleck, and K. J. Dunn. 1996. Investigation of a second focus of equine morbillivirus infection in 661 coastal Queensland. Australian veterinary journal 74:243-244. 662
57. Ruvolo, V., L. Navarro, C. E. Sample, M. David, S. Sung, and S. Swaminathan. 2003. The Epstein-663 Barr virus SM protein induces STAT1 and interferon-stimulated gene expression. Journal of 664 virology 77:3690-3701. 665
58. Sahani, M., U. D. Parashar, R. Ali, P. Das, M. S. Lye, M. M. Isa, M. T. Arif, T. G. Ksiazek, and M. 666 Sivamoorthy. 2001. Nipah virus infection among abattoir workers in Malaysia, 1998-1999. 667 International journal of epidemiology 30:1017-1020. 668
59. Selvey, L., and J. Sheridan. 1995. Outbreak of Severe Respiratory Disease in Humans and Horses 669 Due to a Previously Unrecognized Paramyxovirus. Journal of travel medicine 2:275. 670
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
60. Selvey, L. A., R. M. Wells, J. G. McCormack, A. J. Ansford, K. Murray, R. J. Rogers, P. S. 671 Lavercombe, P. Selleck, and J. W. Sheridan. 1995. Infection of humans and horses by a newly 672 described morbillivirus. The Medical journal of Australia 162:642-645. 673
61. Shaw, M. L., A. Garcia-Sastre, P. Palese, and C. F. Basler. 2004. Nipah virus V and W proteins 674 have a common STAT1-binding domain yet inhibit STAT1 activation from the cytoplasmic and 675 nuclear compartments, respectively. Journal of virology 78:5633-5641. 676
62. Sousa, A. R., S. J. Lane, J. A. Nakhosteen, T. Yoshimura, T. H. Lee, and R. N. Poston. 1994. 677 Increased expression of the monocyte chemoattractant protein-1 in bronchial tissue from 678 asthmatic subjects. American journal of respiratory cell and molecular biology 10:142-147. 679
63. Takeuchi, K., N. Miyajima, N. Nagata, M. Takeda, and M. Tashiro. 2003. Wild-type measles 680 virus induces large syncytium formation in primary human small airway epithelial cells by a 681 SLAM(CD150)-independent mechanism. Virus research 94:11-16. 682
64. Tan, C. T., and K. S. Tan. 2001. Nosocomial transmissibility of Nipah virus. The Journal of 683 infectious diseases 184:1367. 684
65. Teran, L. M., S. L. Johnston, J. M. Schroder, M. K. Church, and S. T. Holgate. 1997. Role of nasal 685 interleukin-8 in neutrophil recruitment and activation in children with virus-induced asthma. 686 American journal of respiratory and critical care medicine 155:1362-1366. 687
66. Weiland, J. E., W. B. Davis, J. F. Holter, J. R. Mohammed, P. M. Dorinsky, and J. E. Gadek. 1986. 688 Lung neutrophils in the adult respiratory distress syndrome. Clinical and pathophysiologic 689 significance. The American review of respiratory disease 133:218-225. 690
67. Weingartl, H. M., Y. Berhane, and M. Czub. 2009. Animal models of henipavirus infection: a 691 review. Vet J 181:211-220. 692
68. Williamson, M. M., and F. J. Torres-Velez. 2010. Henipavirus: a review of laboratory animal 693 pathology. Veterinary pathology 47:871-880. 694
69. Wong, K. T., and K. C. Ong. 2011. Pathology of acute henipavirus infection in humans and 695 animals. Pathology research international 2011:567248. 696
70. Wong, K. T., T. Robertson, B. B. Ong, J. W. Chong, K. C. Yaiw, L. F. Wang, A. J. Ansford, and A. 697 Tannenberg. 2009. Human Hendra virus infection causes acute and relapsing encephalitis. 698 Neuropathology and applied neurobiology 35:296-305. 699
71. Wong, K. T., W. J. Shieh, S. Kumar, K. Norain, W. Abdullah, J. Guarner, C. S. Goldsmith, K. B. 700 Chua, S. K. Lam, C. T. Tan, K. J. Goh, H. T. Chong, R. Jusoh, P. E. Rollin, T. G. Ksiazek, and S. R. 701 Zaki. 2002. Nipah virus infection: pathology and pathogenesis of an emerging paramyxoviral 702 zoonosis. The American journal of pathology 161:2153-2167. 703
72. Yancopoulos, G. D., S. Davis, N. W. Gale, J. S. Rudge, S. J. Wiegand, and J. Holash. 2000. 704 Vascular-specific growth factors and blood vessel formation. Nature 407:242-248. 705
73. Yob, J. M., H. Field, A. M. Rashdi, C. Morrissy, B. van der Heide, P. Rota, A. bin Adzhar, J. 706 White, P. Daniels, A. Jamaluddin, and T. Ksiazek. 2001. Nipah virus infection in bats (order 707 Chiroptera) in peninsular Malaysia. Emerging infectious diseases 7:439-441. 708
74. Yoneda, M., V. Guillaume, H. Sato, K. Fujita, M. C. Georges-Courbot, F. Ikeda, M. Omi, Y. Muto-709 Terao, T. F. Wild, and C. Kai. 2010. The nonstructural proteins of Nipah virus play a key role in 710 pathogenicity in experimentally infected animals. PloS one 5:e12709. 711
712
713
714
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
Legends 715
716
Figure 1: Primary human epithelial cells from the respiratory tract are highly permissive to henipavirus 717
infection. Cultures of NHBE (A and C) and SAEC (B and D) cells were infected with NiV-M, NiV-B or HeV 718
as described in the Materials and Methods. Syncytia formation (A and B) observed at at 24h post 719
infection. Scale 10µm. The black arrows show syncytia in infected cells. Kinetics of henipavirus 720
replication in NHBE (C) and SAEC (D) cells. Results are expressed as the average of 3 repetitions, error 721
bars represent the standard deviation. The horizontal dotted line corresponds with the detection limit. * 722
p<0.05, ANOVA, Bonferroni’s multiple comparison test. 723
724
Figure 2: Global gene expression analysis of henipavirus infection in primary epithelial cells from the 725
respiratory tract. (A) Number of differentially expressed genes following NiV-M, NiV-B or HeV infection 726
in NHBE and SAEC cells compared to non-infected NHBE or SAEC cells at 24h post infection. Cut-off > 2, 727
p-value < 0.05 right-tailed Fisher Exact Method. (B) Venn diagrams showing unique and common 728
differentially expressed genes between NiV-M, NiV-B and HeV infected cells in NHBE (left panel) and 729
SAEC cells (right panel). 730
731
Figure 3: Gene expression analysis of henipavirus infection in primary epithelial cells from the 732
respiratory tract. Number of differentially expressed genes in the most significant biological functional 733
groups in NHBE (A) and SAEC (B) cells at 24h post infection (pi). The most significant biological canonical 734
pathways in NHBE (C) and SAEC (D) cells at 24h pi. The horizontal dotted line represents the false 735
discovery rate fixed at 5% (p-value>0.05), with the p-value scale on the left Y axis. The ratio (dotted line) 736
is the number of overlapping genes from a particular pathway (scale on the right Y axis). 737
738
Figure 4: Expression of the most upregulated genes of the immune response and interferon signaling 739
in henipavirus-infected NHBE and SAEC cells. Real time QPCR analysis of the expression of CCL5, 740
CXCL10, CXCL11, IFIT1, IL-8, ISG-15, MX-1, IFNB1 and Stat1 compared to non-infected NHBE or SAEC cells 741
at 24h post infection. Results are expressed as the average of 3 repetitions and bars represent standard 742
deviation. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ANOVA, Bonferonni’s multiple comparison 743
test. 744
745
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
Figure 5: Quantification of the principal cytokines/chemokines secreted in the supernatant of NHBE 746
and SAEC cells at 24h pi. Cytokines and chemokines are quantified in infected or non-infected cells as 747
described in Materials and Methods. Results are expressed as the average of 3 repetitions and bars 748
represent standard deviation. * p<0.05, **p<0.01, ***p<0.001, **** p<0.0001, ANOVA, Bonferroni’s 749
multiple comparison test. 750
751
Figure 6: Type I interferon pretreatment of epithelial cells from the bronchi and the small airways can 752
limit henipavirus replication. A and B, kinetic of virus replication in NHBE and SAEC cells untreated (full 753
lines) or pretreated with 1000UI/ml of IFNB1 for 24h prior infection (dotted lines). Results are expressed 754
as the average of 3 repetitions with the standard deviation. The horizontal dotted line corresponds to 755
the detection limit. *, # and ^ correspond to significant differences of virus replication levels between 756
untreated and IFN treated cells using the same strain, using both NiV strains and using HeV, respectively 757
(p<0.05, Paired T test). 758
759
Figure 7: Expression and activation of Stat1 during henipavirus infection in human primary epithelial 760
cells from the respiratory tract. Prior protein harvesting, all cells were treated with 1000IU/ml of IFNB1 761
for 1h (see Materials and Methods). Experiment was performed in triplicate. The Stat1 and 762
phosphorylated Stat1 were detected by western blot and the intensities were corrected using the beta 763
actin loading control. The ratio pStat1/Stat1 in non- and infected cells is plotted in A and B for NHBE 764
and SAEC cells, respectively. * p<0.05, **p<0.01, ***p<0.001, ANOVA, Bonferroni’s multiple comparison 765
test. 766
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
Name Gene ID for
Human
Description Fold change NiV-
M
Fold change NiV-
B
Fold change HeV Function
NHBE SAEC NHBE SAEC NHBE SAEC
CXCL11 6373 chemokine (C-X-C motif) ligand 11 27.9 147.6 24.5 114.6 70.4 309.9 Immune response
CTH 1491 cystathionase (cystathionine gamma-lyase) 17.0 3.8 16.1 2.6 15.7 3.8 Immune response
IL13RA2 3598 interleukin 13 receptor, alpha 2 13.7 6.8 18.8 12.2 12.7 10.2 Immune response
TSLP 85480 thymic stromal lymphopoietin 11.3 11.3 13.4 10.1 9.7 12.0 Immune response
ISG15 9636 ISG15 ubiquitin-like modifier 9.1 23.1 8.6 15.3 21.5 27.8 Immune response
ATF3 467 activating transcription factor 3 4.2 4.0 4.3 4.7 5.2 9.4 Immune response
CXCL2 2920 chemokine (C-X-C motif) ligand 2 4.1 - 6.2 - 10.2 4.6 Immune response
CXCL10 3627 chemokine (C-X-C motif) ligand 10 3.8 5.0 3.7 3.8 16.4 39.8 Immune response
BIRC3 330 baculoviral IAP repeat containing 3 3.6 6.8 4.9 11.2 6.0 12.7 Immune response
CCL5 6352 chemokine (C-C motif) ligand 5 2.5 14.1 2.1 7.5 2.2 17.1 Immune response
IL28A 282616 interleukin 28A (interferon, lambda 2) 2.4 - - - - 10.2 Immune response
IFI6 2537 interferon, alpha-inducible protein 6 2.2 5.0 3.9 7.4 20.7 20.3 Immune response
IFI44L 10964 interferon-induced protein 44-like 2.1 - 2.0 - 18.2 10.6 Immune response
IL8 3576 interleukin 8 - - 2.0 4.9 2.4 7.4 Immune response
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from
Table 1. The top upregulated genes in the immune response and interferon signaling of infected cells 1
OAS2 4939 2'-5'-oligoadenylate synthetase 2, 69/71kDa - 2.2 2.6 2.1 9.7 6.3 Immune response
IL24 11009 interleukin 24 - 4.4 - 10.3 - 3.7 Immune response
IFI27 3429 interferon, alpha-inducible protein 27 - 2.4 2.1 3.5 6.6 9.5 Immune response
ISG20 3669 interferon stimulated exonuclease gene 20kDa - 8.1 2.9 7.3 3.3 8.6 Immune response
CXCL3 2921 chemokine (C-X-C motif) ligand 3 - 2 - - 3.4 11.5 Immune response
IFIT1 3434 interferon-induced protein with tetratricopeptide
repeats 1
19.2 131.4 21.5 95.1 42.5 171.0 Interferon signaling
IFIT3 3437 interferon-induced protein with tetratricopeptide
repeats 3
4.6 17.4 5.1 12.5 11.2 21.7 Interferon signaling
STAT1 6772 signal transducer and activator of transcription 1 -2.5 - - - 4.7 2.0 Interferon signaling
OAS1 4938 2'-5'-oligoadenylate synthetase 1 - - 2.0 - 4.6 3.2 Interferon signaling
MX1 4599 myxovirus (influenza virus) resistance 1,
interferon-inducible protein p78 (mouse)
- - 2.2 - 10.4 7.7 Interferon signaling
IFNB1 3456 interferon, beta 1, fibroblast - 5.3 - 2.7 2.1 18.3 Interferon signaling
IFI35 3430 interferon-induced protein 35 - - - - 2.6 2.6 Interferon signaling
IFITM1 8519 interferon induced transmembrane protein 1 - - - 2.8 6.8 - Interferon signaling
on April 12, 2019 by guest
http://jvi.asm.org/
Dow
nloaded from