Hemophilia B Leyden: Substitution of Thymine for Guanine at ...

9
Hemophilia B Leyden: Substitution of Thymine for Guanine at Position - 21 Results in a Disruption of a Hepatocyte Nuclear Factor 4 Binding Site in the Factor IX Promoter By Marlene J. Reijnen, Kathelijne Peerlinck, Diedka Maasdam, Rogier M. Bertina, and Pieter H. Reitsma Hemophilia B Leyden is an X chromosome-linked bleeding disorder characterized by an altered developmental ex- pression of blood coagulation factor IX. This form of hemo- philia B has been found t o be associated with a variety of single point mutations in the factor IX promoter region. We now describe a novel point mutation, T+G at position - 21, in two related patients with the hemophilia B Ley- den phenotype. This mutation lies within the factor IX pro- moter region ( - 40 to - 9) that contains overlapping bind- ing sites for hepatocyte nuclear factor 4 (HNF-4) and androgen receptor. Transient transfection assays in HepG2 cells show that the - 21 mutation causes a signifi- cant reduction in factor IX promoter activity. Gel mobility shift assays and transient cotransfection experiments re- vealed that the HNF-4-binding site but not the androgen- responsive element is disrupted by the - 21 mutation. A comparison of the - 21 mutation with the previously de- scribed - 20 T+A mutation (associated with the hemo- philia B Leyden phenotype) and - 26 G+C mutation (as- EMOPHILIA B is an X-linked bleeding disorder. It H results from a deficiency of clotting factor IX (fIX), a vitamin K-dependent glycoprotein normally present in plasma and an essential component of the clotting cascade.’ The majority of mutations causing hemophilia B has been found in the coding sequence of the fIX gene, whereas all mutations identified in a subgroup of patients with hemo- philia B (hemophilia B Leyden) were detected in the fIX promoter sequence (at -20, -6, -5, +6, t-8, and + 13*). The characteristic aspect of hemophilia B Leyden is the altered developmental expression of flX.334 In the patients, plasma fIX levels are less than 1% of normal during child- hood, but after puberty, they gradually rise to a maximum of 70% of normal.* Apparently, in these patients, the fI X gene only becomes transcriptionally active after puberty; probably under the influence of te~tosterone.~ The positions of the mutations associated with hemo- philia B Leyden suggest that they disrupt binding sites for transcription factors that are crucial for constitutive fIX transcription. The observation that the mutations at -20 T+A and + 13 A+G interfere with the binding of HNF-45 and C/EBP,6 respectively, further supports this view. A recent publication reports that the fI X promoter con- tains a consensus androgen-responsive element (-36 to -22) that partially overlaps with the consensus HNF-4- binding site (-27 to - 1 5).7 Both the androgen-responsive element and the HNF-4-binding site were simultaneously disrupted by a -26 G-tC mutation in the fl X promoter. This mutation was detected in a patient who has suffered from severe hemophilia throughout In this report, we describe a novel point mutation, T+G at -2 1, in the fIX promoter of two related patients with the hemophilia B Leyden phenotype. The -2 1 mutation, which lies within overlapping binding sites for androgen receptor and HNF-4 in the fl X promoter, impairs transcription in transient transfection assays. We show that the HNF-4- sociated with severe hemophilia B throughout life) was made. It shows that the -21 mutation reduced HNF-4 binding and transactivation to a similar level as the - 20 mutation, whereas the - 26 mutation completely abol- ished HNF-4 binding and transactivation. Mobility shift ex- periments indicate that there was no significant difference in binding affinity of recombinant androgen receptor pro- tein for oligonucleotides containing wild-type and - 21 or - 20 mutated DNA. The binding affinity for the oligonucle- otide containing the -26 mutation was twofold lower. The results indicate that the disruption of the HNF-4-bind- ing site by the -21 T+G mutation is the cause of the bleeding disorder in these two patients. This study adds further support for the notion that the recovery from hemo- philia at puberty may not only be related to an intact andro- gen-responsive element but also to the degree of disrup- tion of the HNF-4-binding site. 0 1993 by The American Society of Hematology. binding site but not the androgen-responsive element is disrupted by the -2 1 mutation. PATIENTS, MATERIALS, AND METHODS The family studied is of Belgium origin (Fig IA). Pa- tient 111-5 had regular spontaneous hemarthroses at least once weekly, usually in his ankles and right elbow and occasionally in his knees till the age of 15 years. From that age onward, spontaneous hemarthroses no longer occurred, and the patient only needed transfusions after accidents or prophylactically before minor sur- gery. Patient 111-8 had very frequent, recurrent spontaneous he- marthroses as a child, especially in the right elbow. At least weekly transfusions were needed till the age of 14. Thereafter, the fre- quency of spontaneous hemarthroses diminished, and at the age of 18, the spontaneous bleeding tendency disappeared. Blood samples, collected in 0.1 volume of 0.1 1 mol/L sodium citrate, were obtained from the patients (111-5 and 111-8) and the family members (11-3,11-4, and 111-9). Plasma was obtained by cen- Patients. From the Hemostasis and Thrombosis Research Center, the De- partment of Hematology, University Hospital, Leiden, The Nether- lands; and the Centerfor Thrombosis and Vascular Research, Uni- versity of Leuven, Belgium. Submitted November 19, 1992; accepted February 19, 1993. Supported by the NWOfoundation for Medical and Health Re- search Medigon (No. 900-526-087) and by a grant from the Sticht- ing Hemophilia. Address reprint requests to M.J. Reijnen, PhD, Hemostasis and Thrombosis Research Center, Department of Hematology, Bldg 1: C2-R, University Hospital, PO Box 9600, 2300 RC Leiden, The Netherlands. The publication costs of this article were defayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact. 0 1993 by The American Society ofHematology. 0006-4971/93/8201-0035$3.00/0 Blood, VOI 82, NO 1 (July l), 1993: pp 151-158 151 For personal use only. on March 28, 2018. by guest www.bloodjournal.org From

Transcript of Hemophilia B Leyden: Substitution of Thymine for Guanine at ...

Page 1: Hemophilia B Leyden: Substitution of Thymine for Guanine at ...

Hemophilia B Leyden: Substitution of Thymine for Guanine at Position - 21 Results in a Disruption of a Hepatocyte Nuclear Factor 4 Binding Site in the

Factor IX Promoter By Marlene J. Reijnen, Kathelijne Peerlinck, Diedka Maasdam, Rogier M. Bertina, and Pieter H. Reitsma

Hemophilia B Leyden is an X chromosome-linked bleeding disorder characterized by an altered developmental ex- pression of blood coagulation factor IX. This form of hemo- philia B has been found to be associated with a variety of single point mutations in the factor IX promoter region. We now describe a novel point mutation, T+G at position - 21, in two related patients with the hemophilia B Ley- den phenotype. This mutation lies within the factor IX pro- moter region ( - 40 to - 9) that contains overlapping bind- ing sites for hepatocyte nuclear factor 4 (HNF-4) and androgen receptor. Transient transfection assays in HepG2 cells show that the - 21 mutation causes a signifi- cant reduction in factor IX promoter activity. Gel mobility shift assays and transient cotransfection experiments re- vealed that the HNF-4-binding site but not the androgen- responsive element is disrupted by the - 21 mutation. A comparison of the - 21 mutation with the previously de- scribed - 20 T+A mutation (associated with the hemo- philia B Leyden phenotype) and - 26 G+C mutation (as-

EMOPHILIA B is an X-linked bleeding disorder. It H results from a deficiency of clotting factor IX (fIX), a vitamin K-dependent glycoprotein normally present in plasma and an essential component of the clotting cascade.’ The majority of mutations causing hemophilia B has been found in the coding sequence of the fIX gene, whereas all mutations identified in a subgroup of patients with hemo- philia B (hemophilia B Leyden) were detected in the fIX promoter sequence (at -20, -6, -5, +6, t-8, and + 13*).

The characteristic aspect of hemophilia B Leyden is the altered developmental expression of flX.334 In the patients, plasma fIX levels are less than 1% of normal during child- hood, but after puberty, they gradually rise to a maximum of 70% of normal.* Apparently, in these patients, the fI X gene only becomes transcriptionally active after puberty; probably under the influence of te~tosterone.~

The positions of the mutations associated with hemo- philia B Leyden suggest that they disrupt binding sites for transcription factors that are crucial for constitutive fIX transcription. The observation that the mutations at -20 T+A and + 13 A+G interfere with the binding of HNF-45 and C/EBP,6 respectively, further supports this view.

A recent publication reports that the fI X promoter con- tains a consensus androgen-responsive element (-36 to -22 ) that partially overlaps with the consensus HNF-4- binding site (-27 to - 1 5).7 Both the androgen-responsive element and the HNF-4-binding site were simultaneously disrupted by a -26 G-tC mutation in the fl X promoter. This mutation was detected in a patient who has suffered from severe hemophilia throughout

In this report, we describe a novel point mutation, T+G at -2 1, in the fIX promoter of two related patients with the hemophilia B Leyden phenotype. The -2 1 mutation, which lies within overlapping binding sites for androgen receptor and HNF-4 in the fl X promoter, impairs transcription in transient transfection assays. We show that the HNF-4-

sociated with severe hemophilia B throughout life) was made. It shows that the -21 mutation reduced HNF-4 binding and transactivation to a similar level as the - 20 mutation, whereas the - 26 mutation completely abol- ished HNF-4 binding and transactivation. Mobility shift ex- periments indicate that there was no significant difference in binding affinity of recombinant androgen receptor pro- tein for oligonucleotides containing wild-type and - 21 or - 20 mutated DNA. The binding affinity for the oligonucle- otide containing the - 2 6 mutation was twofold lower. The results indicate that the disruption of the HNF-4-bind- ing site by the -21 T+G mutation is the cause of the bleeding disorder in these two patients. This study adds further support for the notion that the recovery from hemo- philia at puberty may not only be related to an intact andro- gen-responsive element but also to the degree of disrup- tion of the HNF-4-binding site. 0 1993 by The American Society of Hematology.

binding site but not the androgen-responsive element is disrupted by the -2 1 mutation.

PATIENTS, MATERIALS, AND METHODS

The family studied is of Belgium origin (Fig IA). Pa- tient 111-5 had regular spontaneous hemarthroses at least once weekly, usually in his ankles and right elbow and occasionally in his knees till the age of 15 years. From that age onward, spontaneous hemarthroses no longer occurred, and the patient only needed transfusions after accidents or prophylactically before minor sur- gery. Patient 111-8 had very frequent, recurrent spontaneous he- marthroses as a child, especially in the right elbow. At least weekly transfusions were needed till the age of 14. Thereafter, the fre- quency of spontaneous hemarthroses diminished, and at the age of 18, the spontaneous bleeding tendency disappeared.

Blood samples, collected in 0.1 volume of 0.1 1 mol/L sodium citrate, were obtained from the patients (111-5 and 111-8) and the family members (11-3,11-4, and 111-9). Plasma was obtained by cen-

Patients.

From the Hemostasis and Thrombosis Research Center, the De- partment of Hematology, University Hospital, Leiden, The Nether- lands; and the Center for Thrombosis and Vascular Research, Uni- versity of Leuven, Belgium.

Submitted November 19, 1992; accepted February 19, 1993. Supported by the NWOfoundation for Medical and Health Re-

search Medigon (No. 900-526-087) and by a grant from the Sticht- ing Hemophilia.

Address reprint requests to M.J. Reijnen, PhD, Hemostasis and Thrombosis Research Center, Department of Hematology, Bldg 1: C2-R, University Hospital, PO Box 9600, 2300 RC Leiden, The Netherlands.

The publication costs of this article were defayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact. 0 1993 by The American Society ofHematology. 0006-4971/93/8201-0035$3.00/0

Blood, VOI 82, NO 1 (July l), 1993: pp 151-158 151

For personal use only.on March 28, 2018. by guest www.bloodjournal.orgFrom

Page 2: Hemophilia B Leyden: Substitution of Thymine for Guanine at ...

REIJNEN ET AL 152

1 A

I I

111

IV

1 3 1

B Factor IX activity (%) 30

2s

20

1s

10

10

/

1 ' 1

* @ 8 i 9

8 10 12 14 16 18 20 22

Age (years)

11

111-5

111-8

- -

trifugation and tested for flX clotting activities and antigen levels. flX clotting activities were measured by one-stage assay' and adapted on an automate in coagulation testing (ACL-810. IL. Mi- lan, Italy). flX antigen levels wcre assayed by the ELlSA method' and measured automatically on a densitometric analysis microwell system (Organon Teknika. Roxtel. The Netherlands). DNA was prepared from the white cells. A DNA fragment (-230 bp) of the putative flX promoter region spanning nucleotides - 193 to +40 was amplified by the polymerase chain reaction (PCR"). The se- quenceand location ofthc oligonucleotide primers used in the PCR amplification are 5' ~ ' V ' ~ ~ ~ ~ C T ~ ~ ~ ~ ~ ~ ~ G ~ ~ ~ ~ ~ G - ' 7 ~ 3' and S'"ACGCGffGCATAACCTTTGC'" 3'. Amplified DNA obtained from two separate amplification reactions was purified by agarose gel electrophoresis and sequenced using the Sanger direct sequencingstrategy. Sequencedata were obtained by sequenceanal- ysis of both the sense and antisense strands of DNA. The analysis was limited to determining the nucleotide sequence of the flX pro- moter region between nucleotide - I92 and +40.

Transicwt transkction. The wild-type. the -20 T-A. and the -26 G+C mutated flX promoter-CAT constructs have been de- scribed previou~ly.~ The -2 l mutated flX promoter-CATplasmid. designated - 193 -2 IT+G)CAT00. I . was similarly constructed. I t contains the -21 T+G mutated human flX promoter region. spanning nucleotides - 192 to +38. cloned immediately upstream of the CAT gene. Relevant portions of the resulting reporter con- struct were verified by DNA sequencing. Transient transfection as-

C

1 2 3 1 2 3 1 2 3 1 2 3

G t

S'--CTCAGCTTGTACTTTGGTACAACTA..3'

-21 Fig 1. (A) Pedigree of the Belgian family with hemophilia B Ley-

den. Four generations of the family are shown. The two patients af- fected with hemophilia B Leyden are 111-5 and 111-8 ( d i d squares). Half-solid circles denote carriers. (6) The flX activity levels in each of the patients (111-5 and 111-8) in relation to age. Before puberty, no flX was measurable. (C) Sanger dideoxy sequence analysis of the puta- tive factor IX (flX) promoter region of the two patients, 111-5 (track 2) and 111-8 (track 3). and of one normal male (track 1). The arrows mark the mutation T--G at - 21 in the patients.

says were performed in HepG2 and HeLa cells seeded into 94-mm diameter Petri dishes. DNA (20 pg flX-CAT, 2 pg of HNF-4 expres- sion vector [pLEN4St1] and 2 pg of &galactosidase expression vec- tor [pCH I IO"]) were transfected into the cells asdescrihed earlier.' The CAT activity of each construct. which was normalized for 8-ga- lactosidase activity. was determined in three independent transfec- tion experiments. Shown is the average normalized CAT activity of three experiments.

G d tnohi/ity shi/i a.s.saj: The analysis of protein-DNA com- plexes by mobility shin assays'and the preparation ofcrude nuclear extracts from rat livers and H e 6 2 cells were as described previ- ously.'."." Labeled oligonucleotides containing the wild-type or -21 mutated flX promoter region (-40 to -9: Table I ) were incu- bated with nuclear extracts from rat liver. HepG2 cells. or in vitro translated HNF-4" either in the ahsence or presence ofcompetitor DNA. Bacterially expressed androgen receptor-protein A fusion protein (a gin from Dr P. De Vos") was used in mobility shin assays of androgen-responsive element containing oligonucleotides (oligo "w". m-2 I , m-20, m-26 and ARE: Table I ). These experiments were performed exactly as described by De Vos et ai."

For competition experiments. increasing amounts of double- stranded oligonucleotide competitors (Table I ) were added lo a constant amount of nuclear extract and "P-labeled probe DNA. Relative amounts of protein-DNA complexes were determined ei- ther by densitometric analysis (LKR Ultroscan XL dcnsitometer. Pharmacia, Uppsala. Sweden) of autoradiographs or by counting

For personal use only.on March 28, 2018. by guest www.bloodjournal.orgFrom

Page 3: Hemophilia B Leyden: Substitution of Thymine for Guanine at ...

HEMOPHILIA B LEYDEN AND HNF-4 BINDING 153

the amount of radioactivity (protein bound and free probe) from the dried gels on the Phosphor Imager (Molecular Dynamics, Sun- nyvale, CA) using the Image Quant analysis system. Shown is the average of three experiments.

RESULTS

The factor IX coagulant activity levels (fIX:C) in the two patients with hemophilia B Leyden (111-5 and 111-8) were measured up to the age of 19 and 22 years, respectively (Fig 1B). The patients had a clinical history compatible with se- vere hemophilia B in the prepuberty years (flX:C levels be- low l % of normal). One of the patients needed prophylactic treatment for frequent hemorrhages. After onset of puberty, the f€X:C levels gradually rose to 12% to 14% and are still rising. With the rise of fIX:C levels, the spontaneous bleed- ing tendency disappeared. In a recent blood sample of these two hemophiliacs, factor IX antigen was found to be - lo%, with factor IX antigen/activity ratios of 0.96 and 0.7 1, re- spectively (indicating the synthesis of fully active factor IX molecules).

A variety of single point mutations in the putative fIX promoter region has been associated with hemophilia B Leyden. Using the strategy of PCR amplification and the Sanger direct sequencing analysis, we determined the se- quence of the fIX promoter region of these two patients with hemophilia B Leyden (Fig IC, 111-5 and 111-8). A novel point mutation, T+G at position -2 1, of the fl X gene was detected. This mutation, in addition to a normal allele, was also present in maternal DNA (11-3 and 11-4) and DNA pre- pared from the sister (111-9) of patient 111-8, thus confirming their carrier status.

To determine whether the -2 1 T-tG mutation impairs transcription from the fIX promoter, we analyzed the tran- scriptional activity of the wild-type and -2 1 mutated pro- moters. The fI X promoter-CAT constructs containing wild-type and -2 1 T+G mutated fragments (extending from - 192 to +38) were tested for expression in transiently transfected HepG2 and HeLa cells. In agreement with pre- vious observations, the wild-type promoter of the human fix gene was capable of directing CAT transcription in HepG2 cells but not in HeLa cells (Fig 2). When the trans- fections in HepG2 were carried out with the -21 T+G mutated construct (- 192(-21T+G)CATOO.I), only a background level of CAT activity was found. Similar experi- ments as described for the -21 mutation were previously

Table 1. Oligonucleotides Used in Gel Mobility Shift Assays

Sequence Position

Human factor IX gene ”wt“ ATACAGCTCAGCTTGTACTTTGGTACAACTAA -40 to -9

17-20 ATACAGCTCAGCTTGTACTTaGGTACAACTAA -40 to -9 m-26 ATACAGCTCAGCTTcTACTTTGGTACAACTAA -40 to -9

AREGATCATAGTACGTGATGTTCTCAAGATC core II

m-2 1 ATACAGCTCAGCTTGTACTgTGGTACAACTAA -40 to -9

Rat prostatic binding protein gene

Intron seq Chicken ovalbumin gene

COUP CTATGGTGTCAAAGGTCAAACTTCT -90 to -65

The sequence and location of the top strand of the oligonucleotides used in com- petition binding assays are given. Mutated nucleotides are indicated by lower case letters.

done for the -20 T-A and -26 G+C mutated fI X pro- moters. Like the -21 mutation, they also produced only background levels of CAT activity in HepG2 cells (Fig 2A).5

Because the T+G mutation at -21 lies within a region that contains a HNF-4-binding site and an overlapping an- drogen-responsive element, we tested whether this muta- tion disrupts either of them. Oligonucleotides containing the -40 to -9 region of the fIX promoter (wild type: oligo “wt” and -2 1 T+G mutated: oligo m-21) were used in gel mobility shift assays (Table 1). HNF-4 protein, either from HepG2 cells (Fig 3A, lanes 1 and 3) or translated in vitro from HNF-4 cDNA (lane 8), bound the labeled oligo “wt” very well. When the experiments were carried out with la- beled oligo m-2 1, reduced binding of HNF-4 to -2 1 mu- tated site was found (lane 2). The labeled HNF-4-DNA complex was competed effectively by 40-fold molar excess of unlabeled oligo “wt” (lanes 4 and 9) and to a lesser extent by oligo m-21 (lanes 5 and IO). To confirm that indeed HNF-4 binding is involved, we incubated the mobility shift reaction mixtures with specific antibodies to HNF-4.” This resulted in a “supershift” of the complex (lane 6). The addi- tion of anti-NF- 1 antibody (lane 7, negative control16) had no effect. Additional competition experiments were per- formed with increasing amounts of unlabeled competitor DNA (oligo “wt”, m-2 1, m-20 or m-26; Table 1) added to a constant amount of rat liver nuclear extract and labeled oligo “wt” (Fig 3B). The experiments were repeated three times. Both the -21 mutation and the -20 mutation disrupt the HNF-4-binding site to a similar level (- I6 times more mutant DNA than wild-type DNA was needed to reduce the formation of labeled protein-DNA complex by 50%). The -26 mutated oligonucleotide (m-26) com- peted only marginally for HNF-4 binding. Similar observa- tions were made with HepG2 nuclear extracts (data not shown). These results indicate that the mutation at -21 interferes with HNF-4 binding to the fI X promoter. More- over, although the -21 mutation and the -20 mutation partially reduce HNF-4 binding, the -26 mutation seems to completely disrupt the HNF-4-binding site.

To determine whether the androgen-responsive element was also disrupted by the -2 1 mutation, we performed gel mobility shift assays with a recombinant androgen recep- tor-protein A fusion protein.15 When the experiments were carried out with labeled oligo “wt” as probe, only a small fraction ofthe probe was retarded (Fig 4A, lanes 1 and 2). In contrast, the fusion protein bound very well to a probe con- taining the well-characterized androgen-responsive element from the rat prostatic binding protein gene (oligo ARE, lanes 3 and 4). Therefore, in an attempt to establish a differ- ence in binding of the fusion protein to the wild-type and -2 1 mutated fl X promoter region, we performed competi- tion experiments with oligo ARE as probe and increasing concentrations of unlabeled oligo “wt” and oligo m-2 1 as competitors (Fig 4B). Compared with the competition with oligo ARE, large amounts (300- to 400-fold mol/L excess) of unlabeled oligo “wt” and oligo m-2 I were required to reduce the formation of labeled protein DNA complex by 50% (Fig 4B,C). There was no significant difference in com- petition for fusion protein binding between oligo “wt” and oligo m-2 1. When the experiments were carried out with

For personal use only.on March 28, 2018. by guest www.bloodjournal.orgFrom

Page 4: Hemophilia B Leyden: Substitution of Thymine for Guanine at ...

154

CAT activity/cpm per dish x 10,000 18

16

14

12

10

8

6

4

REIJNEN ET AL

CATOO.l -192CATOO.l (-21 T-G) (-26 G-C) (-20 T-A)

HeLa cells Fig 2. Effects of the - 21, - 26, and - 20 mutations on flX promoter activity in HepG2 cells (A) and Hela cells (B). Plasmid constructs

with the CAT reporter gene under control of wild-type ( - 192CATOO.l], - 21 T+G mutated, - 26 G - 4 mutated, and - 20 T+A mutated flX promoters were tested for CAT activity in the absence (m) or presence (B] of the HNF-4 expression vector pLEN4S." CATOO.l was the promoterless control plasmid. CAT activity was normalized to the activity of a @-galactosidase internal standard. Shown is the average normalized CAT activity of three experiments.

For personal use only.on March 28, 2018. by guest www.bloodjournal.orgFrom

Page 5: Hemophilia B Leyden: Substitution of Thymine for Guanine at ...

HEMOPHILIA B LEYDEN AND HNF-4 BINDING 155

A comp: -

n6"

3 4 6

,+ 4' d

B Residual Binding (%I 1207- __-

I

A

8 9 10

W T -c F

-+ M-21

-#+ M-26

M-20

6 0 .

0 4 10 20

Fold Molar Excess Competitor

Fig 3. Analysis ofthe effect of the - 21 T--G mutation on the binding affinity for hepatocyte nuclear factor 4 (HNF-4) by gel mobility shift assays. (A) Crude nuclear extract from H e 6 2 cells (lanes 1 through 7) or in vitro translated HNF-4 (lanes 8 through 10) was incubated with 150-lmol labeled oligonucleotide "wt" (lanes 1 and 3 through 10) or oligonucleotide m - 21 (lane 2) as probes. The assay was done in the absence ([ - 1, lanes 1 through 3,6,7, and 8) or presence ( + ) of 40-fold mol/L excess of unlabeled oligonucleotides "wt" (lanes 4 and 9) or m - 21 (lanes 5 and 10) or in the presence of antiserum (lane 6, anti-HNF-4; lane 7, anti-NF1). (B) Competition mobility shift assays with wild-type and mutated ( - 21, - 20, and - 26) factor IX promoter sequences ( - 40 to - 9) using crude rat liver nuclear extracts. Increasing amounts of unlabeled oligonucleotides "wt". m - 21. m - 26, and m - 20 were added to a constant amount of end-labeled oligonucleotide "wt" as probe and rat liver nuclear extracts. Binding was quantitated by densitometric scans (LKB Ultroscan XL densitometer) of the autoradiograms. The values of the formation of labeled HNF-&DNA complex throughout is shown relative to the value of labeled HNF-4- DNA complex in the absence of competitor, which is arbitrarily set at 100. The experiments were carried out three times. The values reported represent averages of the experiments.

unlabeled oligo m-20 as competitor. similar results were COUP-TF-binding sequence (COUP). These results indi- obtained (Fig 4C). The affinity of the fusion protein for cate that the HNF-4-binding site but not the androgen-re- oligo m-26 was lower since a twofold higher concentration sponsive element is disrupted by the -21 T+G mutation. of DNA was needed to reduce the formation of labeled pro- The functional consequence of the reduction in HNF-4 tein DNA complex by 50%. No competition was observed binding to the -21 mutated flX region was analyzed by with excess unlabeled oligonucleotide containing the transient cotransfection experiments in H e 6 2 and HeLa

For personal use only.on March 28, 2018. by guest www.bloodjournal.orgFrom

Page 6: Hemophilia B Leyden: Substitution of Thymine for Guanine at ...

156 RELJNEN ET AL

A probe WT ARE

B probe ARE

comp. M-21,

5 6 7 8 9 10 111213141516

1 2 3 4

Residual Binding (%I C

- - ~ ~ - --- 120 ,

1

<:-- I -- WT

\ I-- 1 A M-21 +--- __ M-26

L -;z M-20

-+ COUP

\. -1

;- . . L .\, -I:> -.-

* .\. 60

ARE 4 0 . ',

\ 1

20 c !L I

I

! ! I I , , I ! g o 0 t ' L ' l l '

40100 200 400 800

Fold Molar Excess Competitor Fig 4. Analysis of androgen receptor binding to wildtype and mutated factor IX promoter regions. (A) Mobility shift a m y with androgen

receptor-protein A fusion protein and labeled digo "wt" (lanes 1 and 2) or labeled oligo ARE (lanes 3 and 4) as probes. (B) Competition mobility shift assay done with labeled oligo ARE as probe and fusion protein (1 50 fmol of labeled DNA and 0.4 pg of androgen receptor-pro- tein A fusion protein) using oligo "wt" and oligo m - 21 as competitors. Binding was inhibited with an increasing mol/L excess of unlabeled oligo "wt" and oligo m - 21 (40-, loo-, 200-. 400-, and 800-fold mol/L excess). (C) Graph of the competition analysis done with androgen receptor-protein A fusion protein using wild-type (oligo "wt") and mutated (oligos m - 21, m - 20, and m - 26) factor IX promoter se- quences, the COUP-TF-binding site of the chicken ovalbumin promoter (COUP) and the androgen-responsive element of the rat prostatic binding protein (oligo ARE) as competitors (Table 1). Increasing amounts of unlabeled oligonucleotides "wt", m - 21, m - 26, m - 20, and ARE were added to a mixture of a fixed amount of end-labeled oligonucleotide ARE as probe and androgen receptor-protein A fusion protein. The amounts of radioactivity (protein bound and free probe) were measured on a Phosphor Imager using the Image Quant analysis system. The values of the formation of labeled androgen receptor-DNA complex throughout is shown relative to the value of labeled androgen receptor-DNA complex in the absence of competitor, which is arbitrarily set at 100. Shown is the average of three experiments.

For personal use only.on March 28, 2018. by guest www.bloodjournal.orgFrom

Page 7: Hemophilia B Leyden: Substitution of Thymine for Guanine at ...

HEMOPHILIA B LEYDEN AND HNF-4 BINDING 157

cells. In these experiments, an expression vector for HNF-4 (pLEN4S") was cotransfected with the reporter constructs described above. The results presented in Fig 2A,B show that HNF-4 transactivates the wild-type reporter construct - 192CAT00.1) in both cell types quite well. Compared with the wild-type construct, the -21 mutated plasmid (- 192[-21 T+G]CATOO. 1) was expressed at a significant lower level (1 8% in HepG2 cells and 15% in HeLa cells) in response to HNF-4 transactivation. Similar observations were made for the previously reported -20 T+A mutated promoter (1 7% in HepG2 cells and 20% in HeLa cells), whereas no transactivation was observed of the -26 G+C mutated promoter.

DISCUSSION

A T+G base change at position -2 I was detected in the fI X promoter region of two related patients with the hemo- philia B Leyden phenotype. The mothers ofthe patients also carried the defective allele suggesting that the original muta- tion has occurred in one of their parents or other forebears.

The T+G mutation at -2 I in both patients is associated with severe bleeding symptoms and plasma fIX levels below 1% of normal during childhood. The severity of the fIX deficiency in these two patients is similar to those observed in the patients with mutations at position -20. Interest- ingly, the residues at -22, -21, and -20 (all thymine resi- dues) are conserved in various mammalian species (ie, hu- man, macaque, dog, rat, and mouseI7). It seems that the residues at -2 1 and -20 are critical for transcription initia- tion.

The causal relationship between the -21 T+G base change and the hemophilia B Leyden phenotype was dem- onstrated by transient transfection analysis and in vitro binding studies. The mutation, which lies within overlap- ping binding sites for androgen receptor and HNF-4 in the fIX promoter, causes a significant reduction in promoter activity. We showed that the T+G mutation at -2 1 inter- feres with the binding of HNF-4 to its recognition site (be- tween -34 and -10). Moreover, we show that although HNF-4 transactivates the wild-type fIX promoter quite well, it could activate the -21 T+G mutated promoter only to a limited extent. The data presented here indicate that the disruption of the HNF-4-binding site by the -21 T-G mutation is the cause of the severely impaired (he- patic) flX gene expression in these patients during child- hood.

These results add further support for the notion that HNF-4 plays a dominant role in controlling fl X gene ex- pression in normal individuals. In fact, the observation that fIX promoter constructs are very efficiently activated by HNF-4 in the nonhepatic HeLa cells suggest that HNF-4 is the major determinant of the liver-specific production of BX.

It was recently reported that the fIX promoter contains a functional androgen-responsive element between -40 and -9.7 These studies demonstrated that four copies of the wild-type fIX promoter region (-42 to -17) confer andro- gen responsiveness to a herpes simplex thymidine kinase (tk) promoter in a heterologous system. When the -26 G+C mutation was present no transactivation was ob-

served, whereas the -20 T-A mutation did not affect trans- activation in HeLa cells. When we tested this candidate an- drogen-responsive element in gel mobility shift assays, the binding affinity of the androgen receptor (ie, recombinant androgen receptor-protein A fusion protein) for this site was rather low when compared with the androgen-respon- sive element from the rat prostatic binding protein gene. Furthermore, transient cotransfection experiments with sev- eral different androgen receptor coding plasmids in HepG2 cells showed that this potential androgen responsive ele- ment in the fIX promoter responded only poorly to the activation by androgen^.^,^* Although such transactivation experiments may not reflect the in vivo situation, this mar- ginal response to androgens is not comparable with the sig- nificant increase in flX expression in patients with hemo- philia B Leyden after puberty.

Assuming that the putative fIX androgen-responsive ele- ment is functional in the fIX promoter, it is interesting to note that the -26 mutation causes only a minor difference in binding affinity of the androgen receptor-protein A fu- sion protein. The fact that this mutation not only disrupts the androgen-responsive element but also completely blocks HNF-4 binding suggests a synergistic interaction be- tween androgen receptor and HNF-4. The observation that neither of the hemophilia B Leyden-like mutations at -2 1 and at -20 completely eliminates HNF-4 binding and trans- activation suggests that remnant HNF-4 binding is required for the androgen-mediated response after puberty. Both an- drogen receptor and HNF-4 are members ofthe steroid hor- mone receptor superfamily, a group of ligand-dependent transcription factors that possess a high degree of similarity in their DNA-binding domains. It is therefore possible that HNF-4 forms heterodimers with the androgen receptor, as has been seen for the thyroid hormone receptors and the retinoic acid receptor^.'^^*^

ACKNOWLEDGMENT

The authors thank F.M. Sladek for the kind gift of specific anti- bodies to HNF-4. We thank Dr P. De Vos for providing bacterially expressed androgen receptor-protein A fusion protein. We thank E.G.C. Wojcik for measuring the fIX clotting activities and fIX antigen levels.

REFERENCES I . Thompson AR: Structure, function and molecular defects of

factor 1X. Blood 67:565, 1986 2. Giannelli F. Green PM, High KA, Sommer S, Lillicrap DP,

Ludwig M, Olek K. Reitsma PH, Goossens M, Yoshioka A, Brown- lee GG: Haemophilia B: Database of point mutations and short additions and deletions-third edition. Nucleic Acids Res 20:2027, 1992

3. Bnet E, Bertina RM, van Tilburg NH, Veltkamp J: Hemo- philia B Leyden: A sex-linked hereditary disorder that improves after puberty. N Engl J Med 306:788, 1982

4. Briet E, Merk MD, Wijnands MD, Veltkamp J: The prophy- lactic treatment of hemophilia B Leyden with anabolic steroids. J Ann Intern Med 103:225, 1985

5. Reijnen JM, Bertina RM, Reitsma PH: Disruption of a bind- ing site for hepatocyte nuclear factor 4 results in hemophilia B Ley- den. Proc Natl Acad Sci USA 89:6300, 1992

6. Crossley M, Brownlee GG: Disruption of a C/EBP binding

For personal use only.on March 28, 2018. by guest www.bloodjournal.orgFrom

Page 8: Hemophilia B Leyden: Substitution of Thymine for Guanine at ...

158 REIJNEN ET AL

site in the factor IX promoter is associated with haemophilia B. Nature 345:444, 1990

7. Crossley M, Ludwig M, Stowell KM, de Vos P, Olek K, Brownlee G G Recovery from hemophilia B Leyden: An androgen- responsive element in the fIX promoter. Science 257:377, 1992

8. Veltkamp JJ, Drion EF, Loeliger EA: Detection of the camer state in hereditary coagulation disorder. Thromb Diath Haemorrh 19:279, 1968

9. Poort SR, van der Linden K, Krommenhoek-van Es C, Briet E, Bertina RM: Rabbit polyclonal antibodies against the calcium- dependent conformation of factor IX and their application in solid phase immunoradiometric assays. Thromb Haemost 55: 122, 1986

IO. Saiki RK, Horn GT, Mullis KB, Erlich HA: Primer-directed enzymatic amplification of DNA with a thermostable DNA poly- merase. Science 239:487, 1988

11. Sladek FM, Zhong W, Lai E, Darnell Jr JE: Liver enriched transcription factor HNF-4 is a novel member of the steroid hor- mone receptor superfamily. Genes Dev 4:235, 1990

12. Herbomel P, Bourachot B, Yamir M: Two distinct en- hancers with different cell specificities coexist in the regulatory re- gion of polyoma. Cell 39:653, 1984

13. Gorski K, Carneiro M, Schibler U: Tissue-specific in vitro transcription from the mouse albumin promoter. Cell 47:767, I986

14. Dignam JD, Lebovitz RM, Roeder RG: Accurate transcrip-

tion initiation by RNA polymerase I1 in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475, 1983

15. De Vos P, Claessens F, Winderickx J, Van Dijck P, Celis L, Peeters B, Rombauts W, Heyns W, Verhoeven G: Interaction of androgen response elements with the DNA-binding domain of the rat androgen receptor expressed in Escherichia coli. J Biol Chem 266:3439, 199 1

16. Rosenfeld PJ, Kelly T: Purification of Nuclear Factor I by DNA recognition site affinity chromatography. J Biol Chem 261:1398, 1986

17. Pang C-P, Crossley M, Brownlee GG: Comparative se- quence analysis of mammalian factor IX promoters. Nucleic Acids Res 185731, 1990

18. Hirosawa S, Fahner JB, Salier J-P, Wu C-T, Lovrien EW, Kurachi K Structural and functional basis of the developmental regulation of human coagulation factor IX gene: Factor IX Leyden. Proc Natl Acad Sci USA 87:442 I , 1990

19. Forman BM, Yan C-R, Au M, Casanova J, Ghysdael J, Sam- uels HH: A domain containing leucine-zipper-like motifs mediate novel in vivo interactions between the thyroid hormone and reti- noic acid receptors. Mol Endocrinol 3: I6 10, 1989

20. Glass CK, Lipkin SM, Devary OV, Rosenfeld MG: Positive and negative regulation of gene transcription by a retinoic acid-thy- roid hormone receptor heterodimer. Cell 59:697, I989

For personal use only.on March 28, 2018. by guest www.bloodjournal.orgFrom

Page 9: Hemophilia B Leyden: Substitution of Thymine for Guanine at ...

1993 82: 151-158  

MJ Reijnen, K Peerlinck, D Maasdam, RM Bertina and PH Reitsma in the factor IX promoter21 results in a disruption of a hepatocyte nuclear factor 4 binding site Hemophilia B Leyden: substitution of thymine for guanine at position - 

http://www.bloodjournal.org/content/82/1/151.full.htmlUpdated information and services can be found at:

Articles on similar topics can be found in the following Blood collections

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://www.bloodjournal.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

  Copyright 2011 by The American Society of Hematology; all rights reserved.Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American

For personal use only.on March 28, 2018. by guest www.bloodjournal.orgFrom