Heinrich & Corless Laboratories GIST Research Updates: May 2012
description
Transcript of Heinrich & Corless Laboratories GIST Research Updates: May 2012
GIST Research Updates: May 2012• Corless
– Will discuss new technologies for DNA sequencing– The goal is to further subclassify GISTs and better
understand the genes that contribute to malignancy
• Heinrich– Will discuss studies aimed at understanding how
to kill persistent GIST cells that imatinib and sunitinib cannot always control
‘Next Generation’ DNA Sequencing
• Traditional DNA sequencing is limited to just one part of one gene at a time
• Second- and third-generation DNA sequencers are now available at OHSU
• We have been using these new technologies to study GISTs
Second-Generation DNA Sequencing
Sequencing GIST ‘Exomes’
• Human genome consists of 3.2 billion letters (A, C, T, G)
• Genes comprise only ~2% of our DNA (about 64 million letters)
• We ‘pre-select’ the genes, so that only the 64 million letters of interest get sequenced – this is the ‘exome’
• Cost: $2,000 per sample
GIST Exome SequencingSpecimen Summary
Genotype Sequencing completed Sequencing in progress AvailablePatients Specimens Patients Specimens Pts Specimens
KIT exon 9 5 8 1 1
KIT exon 11 9 13 4 6
PDGFRA 3 3 1 1
Wildtype 1 1 3 3
BRAF 1 3
unknown 1 1
TOTAL 18 25 5 11 8 10
Additional matched normal specimens: 19 completed; 5 in progress; 8 available
Sequencing results: Mutant genes by group
• 25 specimens from 18 patients• 285 non-synonymousmutations• 276 unique genes
Apoptosis, autophagy , 6
Cell adhesion, 5 Cell cycle, 1 DNA damage response, 4
Epigenetic regulation, 8
GTPase regulation (Ras family) , 6
Golgi, intracellular transport , 7
Kinase, adaptor, RTK regulation , 15
Ribosome biogenesis, RNA Polymerase, RNA
splicing, 13Transcription
factor, 15
Tumor suppressor, TP53-related , 6
Ubiquitin , 9
Misc potentially interesting , 8
unknown, analysis in progress, 173
GIST AnalysisUsing Third-Generation DNA Sequencing• The Knight Labs have
partnered with Ion Torrent/Life Tech on the development of genotyping panels using third-generation DNA sequencing technology
• Sequencing is performed on a semiconductor chip
Sequencing Directly On A Chip
Traditional Sequence
ACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAG
3rd Generation Sequence
GIST PanelKnight Diagnostic Labs
AKT1 PDGFRAAKT2 PIK3CAAKT3 PTENATM PTPN11BRAF SDHACDKN2A SDHAF1HRAS SDHAF2KIT SDHBKRAS SDHCMAP2K1 SDHDNF1 TP53NRAS
Important in WT GISTs
Common GIST mutations
Predicting GIST prognosis
Rare GIST mutations of research interest