Supplementary Methods. SNP typing, quality control and imputation

DNA was quantified using PicoGreen (Invitrogen). The VICTOR, QUASAR2, CORGI and COGS cohorts (Houlston et al, Nat Genet. 2010; 42: 973-7) were genotyped using Illumina Hap300, Hap370, Hap240S or Hap550 arrays. NBS genotyping was performed on Illumina 1.2M arrays as part of the WTCCC2 study. To ensure quality of genotyping, a series of duplicate samples was genotyped, resulting in 99.9% concordant calls. We excluded telomere pathway SNPs from analysis if they failed one or more of the following thresholds: GenCall scores <0.25; overall call rates <95%; MAF<0.01; departure from Hardy-Weinberg equilibrium (HWE) in controls at P<10-4 or in cases at P<10-6; outlying in terms of signal intensity or X:Y ratio; discordance between duplicate samples; and, for SNPs with evidence of association, poor clustering on inspection of X:Y plots.

We excluded individuals from analysis if they failed one or more of the following thresholds: duplication or cryptic relatedness to estimated identity by descent (IBD) >6.25%; overall successfully genotyped SNPs <95%; mismatch between predicted and reported gender; outliers in a plot of heterozygosity versus missingness; and evidence of non-white European ancestry by PCA-based analysis in comparison with HapMap samples. In addition, PCA was used to exclude individuals or groups distinct from the main cluster using the first three principal components (details not shown). To identify individuals who might have non-northern European ancestry, we merged our case and control data with the European, Nigerian, Japanese and Han Chinese individuals from the International HapMap Project. For each pair of individuals, we calculated genome-wide identity-by-state distances based on markers shared between HapMap2 and our SNP panel, and used these as dissimilarity measures upon which to perform principal components analysis. The first two principal components for each individual were plotted and any individual not present in the main CEU cluster was excluded from subsequent analyses.

Deviation of the genotype frequencies in the cases and controls from those expected under HWE was assessed by a 2 test (1 d.f.), or Fisher’s exact test where an expected cell count was <5. Association between SNP genotype and telomere length was assessed in PLINK v1.07 using linear regression analysis, incorporating sex, age and study-of-origin as co-variates. The risks associated with each SNP were estimated and associated 95% confidence intervals (CIs) were calculated.

Joint analysis of data generated from multiple phases was conducted using standard methods for combining raw data based on the Mantel-Haenszel method in STATA (metan command) and PLINK. The reported meta-analysis statistics were derived from analysis of allele frequencies, and joint ORs and 95% CIs were calculated assuming fixed- and random-effects models. Tests of the significance of the pooled effect sizes were calculated using a standard normal distribution. Cochran’s Q statistic to test for heterogeneity and the I2 statistic 12 to quantify the proportion of the total variation due to heterogeneity were calculated, with large heterogeneity defined as I2≥75%. Where significant heterogeneity was identified, results from the random effects model were reported.

We used Haploview software v4.2 to infer the LD structure of the genome in the region near rs10936599. Genome co-ordinates were taken from the NCBI build 36/hg18 (dbSNP b126).

Imputation from HapMap2 build 36 was performed using the IMPUTE2 program (https://mathgen.stats.ox.ac.uk/impute/impute_v2.html), incorporating as a reference panel for the VQ58 Hap300-panel genotypes the Hap550-typed UK controls from the CORGI/CORGI study and, for all panels, the European samples from the 1000genomes (CEPH) and Hapmap3 (CEPH+TSI) projects. We excluded imputed SNPs with low proper_info scores (<0.5), imputation rate (<0.9) and MAF

(0.01). We used the program Meta to meta-analyse the association statistics in each one of the populations examined

Supplementary Figure 1. Examples of standard lines used to calculate telomere length.On the X-axis is concentration of the anonymous standard DNA on a log scale. On the Y-axis are shown the corresponding Ct values for the telomere (red) and control (blue) probes in the real-time quantitative PCR assay. Linear regression was used to fit lines relating concentration to Ct. These lines were subsequently used to calculate CorrDCt for each sample. Each plot illustrates standard lines for a different 96-well sample plate.

Supplementary Figure 2. Linkage disequilibrium relationships between the tagSNPs near TERC that were associated with telomere length.Views of selected SNPs (top panel) and all HapMap SNPs in the region (lower panels) are provided. r2

(black) and D’ (red) LD plots are shown. Data were taken from HapMap2 (NCBI Build 36). TERC lies just distal to rs12696304 and proximal to ARPM1.

Supplementary Figure 3. Relationship between the effect size of rs10936599 genotype (Y-axis) and telomere length decile (X-axis). coefficients (ln(odds ratio)) for rs10936599 (with case-control status as the dependent variable) were calculated using logistic regression by comparing cases in the relevant decile of each study with all controls, stratifying by study, sex and age.

Supplementary Figure 4. Predicted TERC mRNA secondary structure for rs2293607 A (CRC risk) and G alleles. The following RNA sequence was imported into RNAfold, varying only at the polymorphic A/G site.GCACCGGGTTGCGGAGGGTGGGCCTGGGAGGGGTGGTGGCCATTTTTTGTCTAACCCTAACTGAGAAGGGCGTAGGCGCCGTGCTTTTGCTCCCCGCGCGCTGTTTTTCTCGCTGACTTTCAGCGGGCGGAAAAGCCTCGGCCTGCCGCCTTCCACCGTTCATTCTAGAGCAAACAAAAAATGTCAGCTGCTGGCCCGTTCGCCCCTCCCGGGGACCTGCGGCGGGTCGCCTGCCCAGCCCCCGAACCCCGCCTGGAGGCCGCGGTCGGCCCGGGGCTTCTCCGGAGGCACCCACTGCCACCGCGAAGAGTTGGGCTCTGTCAGCCGCGGGTCTCTCGGGGGCGAGGGCGAGGTTCAGGCCTTTCAGGCCGCAGGAAGAGGAACGGAGCGAGTCCCCGCGCGCGGCGCGATTCCCTGAGCTGTGGGACGTGCACCCAGGACTCGGCTCACACATGCAGTTCGCTTTCCTGTTGGTGGGGGGAACGCCGATCGTGCGCATCCGTCACCCCTCGCCGGCAA/GTGGGGGCTTGTGAACCCCCAAACCTGACTGACTGGGCCA.This was then directionally cloned into pcDNA3.1.

Supplementary Figure 5. Fine mapping of associations between SNPs near TERC and CRC (red) and telomere length (black). The analyses comprise CORGI cases and controls, COGS cases and controls, and the VICTOR cases and the NBS controls. QUASAR2 samples were analysed as part of the same sample set with VICTOR samples for the CRC association analysis only. Note that the two analyses have some fundamental differences - CRC susceptibility uses a per allele test of association and telomere length utilises linear regression - and hence the absolute strengths of association for the two traits cannot be compared. SNPs were either genotyped or imputed using IMPUTE v2.

Supplementary Figure 6. Distribution of telomere lengths (CorrDCt) in all cases and controls

Cases

Controls

Supplementary Figure 7. Telomere length decreases with age in cases and controls.Linear regression analysis is shown separately for grouped cases and controls. For cases, t=14.0, P<0.001; for controls, t=12.4, P<0.001. Y-axis shows CorrDCt; X-axis shows age (years) at which blood sample was taken.

Supplementary Table 1.Summary of previous prospective studies on CRC risk and telomere length

Reference No. CRC cases OR 95% CIZee et al [1] 191 1.25 0.86-1.81Lee et al [2] 134 0.94 0.65-1.38Pooley et al [3] 185 1.13 0.64-1.36

OR = odds ratio estimated from logistic regression after conditioning on age, sex and other relevant clinical variables [1, 2], or derived from numbers of CRC cases and controls in first versus last telomere length quartiles [3]. Willeit et al [4] reported an association between shorter telomeres and overall cancer risk but there were only 8 CRCs in the study.

1 Zee RY, Castonguay AJ, Barton NS, et al. Mean telomere length and risk of incident colorectal carcinoma: a prospective, nested case-control approach. Cancer Epidemiol Biomarkers Prev 2009;18:2280-2.2 Lee IM, Lin J, Castonguay AJ, et al. Mean leukocyte telomere length and risk of incident colorectal carcinoma in women: a prospective, nested case-control study. Clin Chem Lab Med 2010;48:259-62.3 Pooley KA, Sandhu MS, Tyrer J, et al. Telomere length in prospective and retrospective cancer case-control studies. Cancer Res 2010;70:3170-6.4 Willeit P, Willeit J, Mayr A, et al. Telomere length and risk of incident cancer and cancer mortality. JAMA 2010;304:69-75.

Supplementary Table 2. Telomere biology genes (Mirabello et al. Hum Mutat. 2010; 31: 1050-8). Numbers of SNPs in dbSNP (www.ncbi.nlm.nih.gov/projects/SNP/) in the vicinity of each gene are shown.Gene SNPs

ShelterinACD 0POT1 21TERF1 18TERF2 10TERF2IP 8TINF2 3

DNA repair ATM 18MRE11A 35NBN 17RAD50 16RAD51AP1 12RAD51C 9RAD51L1 155RAD51L3 8RAD54L 5XRCC6 5

Helicase BLM 12DDX1 27DDX11 5PIF1 8RECQL 18RECQL4 1RECQL5 10WRN 32

Telomerase-associated NOLA2 11NOLA3 12TEP1 33TERC 718TERT 12

Other BICD1 63CLPTM1L 11MAD1L1 56MEN1 4MYC 15NOLA1 10PARP1 31PARP2 24PINX1 53PRKDC 7RTEL1 12SIP1 8TNKS 45TNKS2 12

Supplementary Table 3. All telomere biology gene tagSNPs and results of linear regression meta-analysis for association with telomere length in VICTOR, CORGI, COGS and NBS samples.Chr=chromosome, Position=SNP location in base pairs in NCBI genome Build 36, P(OR)=random effects P value, OR=odds ratio, Q=Cochran’s Q heterogeneity statistic, I=I2 test of heterogeneity.

SNP Chr Position N P P(R) OR OR(R) Q I

rs16854453 3 171,041,936 4 3.38E-06 4.86E-05 -0.067 -0.066 0.321 14.3

rs10936599 3 170,974,803 5 3.92E-05 3.92E-05 -0.055 -0.055 0.580 0.0

rs11709840 3 171,052,943 4 4.14E-05 4.14E-05 -0.059 -0.059 0.528 0.0

rs1920116 3 171,062,673 5 4.19E-05 4.19E-05 -0.055 -0.055 0.612 0.0

rs10936603 3 171,028,354 5 4.53E-05 7.39E-04 -0.055 -0.053 0.288 19.9

rs6793295 3 171,001,157 5 1.09E-04 4.20E-03 -0.052 -0.050 0.213 31.3

rs1997392 3 170,992,354 5 1.20E-04 3.81E-03 -0.052 -0.049 0.223 29.7

rs1881984 3 170,947,161 5 1.75E-03 1.75E-03 -0.042 -0.042 0.530 0.0

rs27061 5 1,415,793 5 2.00E-03 2.00E-03 0.042 0.042 0.591 0.0

rs9290375 3 171,048,792 4 2.58E-03 2.29E-02 -0.043 -0.041 0.259 25.4

rs3732451 3 171,040,727 4 2.90E-03 2.52E-02 -0.043 -0.040 0.258 25.6

rs11718668 3 170,940,901 5 4.85E-03 4.85E-03 -0.038 -0.038 0.748 0.0

rs3772190 3 170,983,189 3 6.43E-03 6.43E-03 -0.058 -0.058 0.448 0.0

rs7647589 3 171,064,925 5 7.25E-03 7.25E-03 -0.036 -0.036 0.606 0.0

rs7650849 3 171,079,610 5 8.86E-03 8.86E-03 -0.035 -0.035 0.939 0.0

rs4982038 14 19,932,382 5 1.05E-02 1.05E-02 0.034 0.034 0.459 0.0

rs3802650 10 93,567,604 5 1.65E-02 1.65E-02 0.032 0.032 0.452 0.0

rs1878705 14 19,975,355 5 2.24E-02 3.35E-02 -0.031 -0.039 0.177 36.6

rs4955686 3 171,099,164 4 2.47E-02 2.47E-02 0.032 0.032 0.930 0.0

rs16854522 3 171,100,107 5 2.70E-02 2.70E-02 -0.030 -0.030 0.938 0.0

rs6796010 3 171,096,453 5 2.88E-02 1.57E-01 0.029 0.026 0.165 38.5

rs4955684 3 171,094,714 3 2.90E-02 5.90E-02 0.046 0.045 0.286 20.1

rs11580815 1 222,947,412 4 3.76E-02 3.76E-02 -0.030 -0.030 0.523 0.0

rs7613633 3 171,113,291 4 4.40E-02 4.40E-02 0.029 0.029 0.907 0.0

rs753383 2 15,750,249 4 4.59E-02 4.59E-02 0.029 0.029 0.704 0.0

rs7085519 10 93,633,175 5 5.40E-02 5.40E-02 -0.026 -0.026 0.966 0.0

rs876718 2 15,759,533 5 5.50E-02 5.50E-02 0.026 0.026 0.737 0.0

rs10771923 12 32,212,179 4 6.88E-02 6.88E-02 -0.026 -0.026 0.767 0.0

rs1798255 12 32,178,526 5 7.07E-02 1.12E-01 -0.024 -0.028 0.203 32.8

rs6488035 12 32,195,894 4 7.76E-02 7.76E-02 0.025 0.025 0.925 0.0

rs3748276 12 32,372,844 4 8.60E-02 8.60E-02 -0.025 -0.025 0.536 0.0

rs807576 2 15,755,054 5 8.86E-02 8.86E-02 0.023 0.023 0.987 0.0

rs10275045 7 1,694,067 4 9.16E-02 1.17E-01 0.024 0.025 0.340 10.5

rs11051794 12 32,137,067 5 9.95E-02 9.95E-02 -0.022 -0.022 0.629 0.0

rs9878797 3 171,012,660 5 1.08E-01 1.08E-01 -0.022 -0.022 0.456 0.0

rs8031404 15 32,424,988 5 1.14E-01 1.14E-01 -0.021 -0.021 0.704 0.0

rs12545912 8 9,639,109 5 1.31E-01 1.31E-01 -0.020 -0.020 0.568 0.0

rs2037962 8 31,052,446 4 1.33E-01 5.68E-01 0.022 0.012 0.152 43.3

rs8179514 2 15,763,489 5 1.38E-01 3.36E-01 0.020 0.016 0.247 26.1

rs2725361 8 31,116,868 4 1.40E-01 3.41E-01 -0.021 -0.020 0.143 44.8

rs17211432 14 19,969,322 5 1.47E-01 2.43E-01 -0.020 -0.018 0.303 17.6

rs13273033 8 9,578,103 5 1.59E-01 1.34E-01 -0.019 -0.025 0.243 26.8

rs1260712 12 32,113,614 5 1.74E-01 1.74E-01 0.018 0.018 0.438 0.0

rs16854445 3 171,040,544 5 1.79E-01 2.98E-01 0.018 0.019 0.193 34.2

rs10100760 8 9,407,969 5 1.80E-01 1.77E-01 0.018 0.019 0.374 5.8

rs1136410 1 222,862,037 5 1.87E-01 3.50E-01 -0.018 -0.015 0.278 21.5

rs4840517 8 10,705,457 5 1.92E-01 1.92E-01 -0.018 -0.018 0.950 0.0

rs11991621 8 9,443,992 4 1.95E-01 1.95E-01 -0.019 -0.019 0.403 0.0

rs4698797 4 111,130,671 5 2.07E-01 2.07E-01 0.017 0.017 0.927 0.0

rs524386 11 64,341,535 4 2.21E-01 5.65E-01 0.018 0.013 0.128 47.3

rs325429 12 32,405,382 5 2.25E-01 2.25E-01 -0.016 -0.016 0.421 0.0

rs401681 5 1,375,087 5 2.34E-01 2.34E-01 0.016 0.016 0.738 0.0

rs2872810 20 61,712,375 5 2.59E-01 2.59E-01 0.015 0.015 0.730 0.0

rs1760907 14 19,914,699 5 2.59E-01 6.02E-01 0.015 0.009 0.201 33.1

rs6062292 20 61,734,769 5 2.60E-01 2.60E-01 0.015 0.015 0.698 0.0

rs347897 15 32,447,708 5 2.71E-01 2.71E-01 -0.015 -0.015 0.454 0.0

rs326644 12 32,292,559 4 2.79E-01 2.79E-01 0.016 0.016 0.904 0.0

rs8178071 8 48,977,140 4 3.19E-01 3.19E-01 0.014 0.014 0.424 0.0

rs10505504 8 128,769,526 5 3.30E-01 7.07E-01 0.013 0.008 0.090 50.3

rs7314141 12 32,421,314 4 3.48E-01 6.40E-01 -0.014 -0.008 0.253 26.5

rs155202 12 32,398,124 4 3.50E-01 3.50E-01 -0.014 -0.014 0.601 0.0

rs3093872 14 19,881,172 5 3.56E-01 3.56E-01 -0.012 -0.012 0.919 0.0

rs4762834 12 21,549,121 5 3.64E-01 3.75E-01 -0.012 -0.013 0.345 10.7

rs2898249 8 10,782,996 5 3.74E-01 3.78E-01 -0.012 -0.020 0.048 58.2

rs4841171 8 9,437,099 5 3.79E-01 3.79E-01 0.012 0.012 0.727 0.0

rs3778969 7 1,913,231 5 3.84E-01 3.84E-01 0.012 0.012 0.704 0.0

rs3219090 1 222,871,426 4 3.86E-01 3.86E-01 -0.013 -0.013 0.401 0.0

rs7628292 3 171,079,888 4 4.05E-01 4.05E-01 0.012 0.012 0.964 0.0

rs820215 17 71,205,405 5 4.11E-01 4.11E-01 -0.011 -0.011 0.690 0.0

rs2249844 1 222,907,870 5 4.14E-01 4.14E-01 -0.011 -0.011 0.581 0.0

rs10278591 7 1,694,603 4 4.18E-01 4.29E-01 -0.012 -0.012 0.383 1.9

rs7826189 8 10,665,270 4 4.20E-01 3.85E-01 0.012 0.024 0.030 66.4

rs17152302 8 10,657,436 4 4.21E-01 4.21E-01 -0.012 -0.012 0.720 0.0

rs12822390 12 31,086,539 5 4.25E-01 6.33E-01 -0.011 -0.008 0.285 20.4

rs326633 12 32,285,371 5 4.25E-01 4.25E-01 -0.011 -0.011 0.630 0.0

rs1538833 10 93,594,333 5 4.26E-01 6.68E-01 -0.011 -0.008 0.123 44.8

rs4733676 8 128,775,901 4 4.33E-01 9.03E-01 0.011 0.003 0.147 44.2

rs2945461 14 19,932,910 5 4.34E-01 5.17E-01 -0.011 -0.012 0.186 35.3

rs1805410 1 222,875,400 5 4.42E-01 4.42E-01 -0.010 -0.010 0.809 0.0

rs914561 20 61,741,349 4 4.60E-01 4.60E-01 0.011 0.011 0.786 0.0

rs2683471 12 32,171,607 5 4.64E-01 4.64E-01 0.010 0.010 0.939 0.0

rs4840437 8 9,643,674 4 4.65E-01 4.65E-01 -0.011 -0.011 0.992 0.0

rs6897423 5 177,540,801 3 4.73E-01 4.73E-01 0.015 0.015 0.376 0.0

rs7840975 8 128,774,343 4 4.75E-01 4.75E-01 0.010 0.010 0.962 0.0

rs2593993 12 32,350,775 5 4.96E-01 4.96E-01 -0.009 -0.009 0.837 0.0

rs3815003 15 89,113,827 5 5.10E-01 4.78E-01 0.009 0.011 0.340 11.6

rs17152632 8 10,764,482 5 5.18E-01 5.18E-01 0.009 0.009 0.576 0.0

rs6989930 8 10,707,518 5 5.33E-01 5.33E-01 0.008 0.008 0.759 0.0

rs261902 12 32,367,994 5 5.47E-01 5.47E-01 0.008 0.008 0.532 0.0

rs8041787 15 89,166,481 4 5.48E-01 6.05E-01 -0.009 -0.008 0.370 4.6

rs7531792 1 222,933,012 5 5.63E-01 5.63E-01 -0.008 -0.008 0.481 0.0

rs2957154 11 64,341,563 5 5.66E-01 5.66E-01 0.008 0.008 0.911 0.0

rs3743046 15 62,904,875 4 5.74E-01 5.74E-01 -0.008 -0.008 0.886 0.0

rs2287637 2 15,733,649 5 5.78E-01 5.78E-01 -0.008 -0.008 0.960 0.0

rs17734290 8 9,717,633 5 6.43E-01 6.43E-01 -0.006 -0.006 0.445 0.0

rs3800895 7 1,899,183 4 6.43E-01 6.43E-01 -0.007 -0.007 0.753 0.0

rs3741841 12 21,586,851 4 6.55E-01 6.55E-01 0.007 0.007 0.950 0.0

rs261900 12 32,354,282 5 6.56E-01 6.56E-01 -0.006 -0.006 0.695 0.0

rs1002170 7 2,026,227 5 6.77E-01 6.77E-01 -0.006 -0.006 0.806 0.0

rs1093992 17 71,125,952 4 6.89E-01 6.89E-01 -0.006 -0.006 0.857 0.0

rs6967879 7 1,979,150 4 6.91E-01 9.56E-01 -0.006 0.001 0.191 36.9

rs7610773 3 171,058,349 2 6.93E-01 6.64E-01 0.011 0.033 0.009 85.4

rs17150478 8 9,678,444 4 7.05E-01 9.85E-01 0.006 0.000 0.233 29.9

rs2652007 12 32,136,040 3 7.25E-01 7.25E-01 -0.008 -0.008 0.455 0.0

rs7843551 8 31,191,707 4 7.32E-01 7.32E-01 -0.005 -0.005 0.913 0.0

rs7719363 5 1,425,704 4 7.39E-01 7.39E-01 -0.005 -0.005 0.395 0.0

rs11046048 12 21,483,467 5 7.39E-01 5.53E-01 0.005 0.011 0.145 41.5

rs9644708 8 9,638,327 4 7.47E-01 7.47E-01 -0.005 -0.005 0.633 0.0

rs7594193 2 15,701,238 5 7.51E-01 7.51E-01 0.004 0.004 0.496 0.0

rs7153417 14 19,876,135 4 7.68E-01 9.51E-01 -0.004 -0.001 0.205 34.5

rs2853668 5 1,353,025 5 7.76E-01 7.76E-01 -0.004 -0.004 0.555 0.0

rs7171099 15 89,181,003 3 8.05E-01 9.76E-01 -0.005 -0.001 0.185 40.8

rs10844159 12 32,288,782 4 8.09E-01 8.09E-01 0.004 0.004 0.880 0.0

rs6571891 14 38,604,660 4 8.11E-01 8.11E-01 -0.004 -0.004 0.576 0.0

rs4256179 3 171,111,031 4 8.19E-01 8.81E-01 -0.003 -0.003 0.262 25.0

rs1800392 8 31,093,499 5 8.41E-01 8.41E-01 -0.003 -0.003 0.513 0.0

rs1062492 7 2,063,926 5 8.57E-01 8.57E-01 -0.002 -0.002 0.642 0.0

rs1760909 14 19,911,002 3 8.70E-01 8.70E-01 -0.004 -0.004 0.454 0.0

rs13278931 8 30,998,749 5 8.96E-01 8.96E-01 0.002 0.002 0.615 0.0

rs17152584 8 10,723,261 4 8.96E-01 8.96E-01 -0.002 -0.002 0.452 0.0

rs8030486 15 89,038,235 4 8.97E-01 5.21E-01 0.002 0.014 0.116 49.2

rs10228977 7 1,758,280 4 9.10E-01 7.36E-01 0.002 0.007 0.122 48.2

rs2275009 14 19,942,580 5 9.15E-01 9.15E-01 0.001 0.001 0.976 0.0

rs7961369 12 32,195,702 4 9.16E-01 8.20E-01 0.002 -0.005 0.132 46.6

rs1125841 8 30,977,596 4 9.35E-01 9.35E-01 0.001 0.001 0.480 0.0

rs2409667 8 10,767,033 4 9.45E-01 9.45E-01 0.001 0.001 0.808 0.0

rs6982140 8 31,118,970 4 9.47E-01 8.31E-01 0.001 0.003 0.333 12.0

rs7445640 5 1,289,212 5 9.66E-01 9.66E-01 0.001 0.001 0.847 0.0

Supplementary Table 4. Summary result for association of rs10936599 and other TERC region SNPs associated with telomere length with the risk of colorectal cancer.See Supplementary Table 2 legend for explanation of abbreviations.

SNP Studies P fixed P random OR OR randomQ I2rs16854453 4 1.97E-04 1.37E-03 0.900 0.895 0.245 27.9rs10936599 5 1.99E-06 1.91E-05 0.887 0.883 0.280 21.2rs11709840 4 1.30E-04 1.34E-03 0.901 0.894 0.211 33.5rs1920116 5 2.58E-05 2.58E-05 0.903 0.903 0.424 0.0rs10936603 3 1.62E-03 1.02E-02 0.886 0.877 0.193 39.3

Supplementary Table 5. SNPs correlated with rs10936599 with r2>0.5 and their functional annotation.SNPs of particular interest are highlighted.

Chr 3 Start End ID Notes170941263 170941269 rs11718804

170944262 170944268 rs16854335

170945514 170945520 rs7610569

170945711 170945717 rs61396429

170945712 170945718 rs61396429

170947150 170947156 rs1881984

170947633 170947639 rs13097028

170950172 170950178 rs10936596

170960197 170960203 rs12638862

170962895 170962901 rs12630450

170963962 170963968 rs12696304 Levy et al reported association with telomere length

170965026 170965032 rs2293607In 2 ESTs (AW207347 and AI825849) that overlap 3’

UTR of TERC. Within H3K4Me1 and H3K4Me3 sites.

170968835 170968841 rs9822885 >40% conservation. 6 bases away from ARPM1

170968962 170968968 rs9860874

170970128 170970134 rs12637184 CPG Island within ARPM1

170970192 170970198 rs9811216 CPG Island within ARPM1

170970342 170970348 rs9866776

170972003 170972009 rs28649851High nucleosome occupancy potentially within the

promoter of ARPM1 and MYNN

170972637 170972643 rs3821383

170974420 170974426 rs2251795

170974792 170974798 rs10936599 >40% conservation. Within coding region of MYNN

170975974 170975980 rs3950296

170980276 170980282 rs1317082

170983178 170983184 rs3772190 >40% conservation. In intron of MYNN

170984871 170984877 rs1920120

170986123 170986129 rs2141595

170988832 170988838 rs1920122

170988864 170988870 rs1920123

170990963 170990969 rs13069553

170991606 170991612 rs7625734

170991935 170991941 rs7633750

170992343 170992349 rs1997392

170993480 170993486 rs9868000

170994836 170994842 rs76216312 alternative splicing events within LRRC34-bleeding

exon and retained intron.

170997276 170997282 rs109366002 predicted transcription factor binding sites:

V$CEBP_C and V$HLF_01

171000127 171000133 rs9876206

171001146 171001152 rs6793295Alternative splicing event within LRRC34-cassette

exon

171005078 171005084 rs9827710

171006707 171006713 rs11711621

171007553 171007559 rs3796145

171008963 171008969 rs28626343

171011140 171011146 rs10936601

171011214 171011220 rs9831661

171012586 171012592 rs67795055 CpG Island within LRRC34