The FASEB Journal • FJ Express Full-Length Article

A negative feedback loop of transcription factors thatcontrols stem cell pluripotency and self-renewal

Guangjin Pan,1 Jun Li,1 Yali Zhou, Hui Zheng, and Duanqing Pei2

Institute of Pharmacology, Department of Biological Sciences & Biotechnology, State Key Laboratoryof Biomembrane and Membrane Biotechnology, Institutes of Biomedicine, School of Medicine,Tsinghua University, Beijing, China

ABSTRACT Embryonic stem (ES) cells possess theability to renew themselves while maintaining the capac-ity to differentiate into virtually all cell types of thebody. Current evidence suggests that ES cells maintaintheir pluripotent state by expressing a battery of tran-scription factors including Oct4 and Nanog. However,little is known about how ES cells maintain the expres-sion of these pluripotent factors in ES cells. Here wepresent evidence that Oct4, Nanog, and FoxD3 form anegative feedback loop to maintain their expression inpluripotent ES cells. First, Oct4 maintains Nanog activ-ity by directly activating its promoter at sub-steady-stateconcentration but repressing it at or above steady-statelevels. On the other hand, FoxD3 behaves as a positiveactivator of Nanog to counter the repressive effect ofOct4. The expression of Oct4 is activated by FoxD3and Nanog but repressed by Oct4 itself, thus, exertingan important negative feedback loop to limit its ownactivity. Indeed, overexpression of either FoxD3 orNanog in ES cells failed to increase the concentrationof Oct4 beyond the steady-state concentration, whereasknocking down either FoxD3 or Nanog reduces theexpression of Oct4 in ES cells. Finally, overexpressionof Oct4 or Nanog failed to compensate the loss ofNanog or Oct4, respectively, suggesting that both arerequired for ES self-renewal and pluripotency. Ourresults suggest the FoxD3-Nanog-Oct4 loop anchors aninterdependent network of transcription factors thatregulate stem cell pluripotency.—Pan, G., Li, J., Zhou,Y., Zheng, H., Pei, D. A negative feedback loop oftranscription factors that controls stem cell pluripo-tency and self-renewal. FASEB J. 20, E1094–E1102(2006)

Key Words: embryonic stem cells

The successful derivation and establishment ofhuman embryonic stem (ES) cell lines have generatedstrong interest in harnessing the therapeutic potentialof these pluripotent cells to treat human diseases (1).Derived from the inner cell masses of blastocysts, thesepluripotent ES cells retain two key characteristics foundin embryonic progenitor cells: self-renewal and pluri-potency, i.e., the ability of a ES cell to generate exactcopies of itself and the capacity of ES cells to differen-

tiate into all cell types in the body (2–5). At the present,there are considerable challenges in maintaining theseES cells in a pluripotent state or triggering ES cells todifferentiate into a particular cell type (2, 6). In fact,the precise mechanism that regulates stem cell self-renewal and pluripotency remains largely unknown(6). Thus, investigation into the molecular and cellularmechanisms of stem cell self-renewal and pluripotencyshould help meet these challenges and provide thenecessary tools to harness the regenerative potential ofembryonic stem cells for therapeutical purposes (2–5).

The homeodomain transcription factors Oct4 andNanog have been proposed as master regulators ofstem cell self-renewal and pluripotency (2, 7–10). Oct4-deficient embryos fail to develop pluripotent inner cellmass (ICM) cells, which in fact differentiate along theextraembryonic trophoblast lineage (7). Unlike thosetranscription factors that act in a binary on-off mode,Oct4 appears to regulate cell fates in a quantitativefashion (11). Oct4 must be maintained at a criticalconcentration to sustain ES cell self-renewal (11). Forexample, over-expression of Oct4 causes differentiationinto endoderm lineage, while its suppression triggersES cells to become trophectoderm (11). In contrast,over-expression of Nanog, a self-renewal transcriptionfactor isolated by expression cloning, did not induce EScell differentiation but actually augmented the self-renewal capacity of ES cells in the absence of LIF(9,10). Ablation of Nanog in ICMs or ES cells, on theother hand, led to the loss of self-renewal and thedifferentiation of endoderm-like cells (10). Recently, ithas been reported that these two master regulators,along with the HMG-containing transcription factorSox2, co-occupy a substantial portion of their targetgenes in human ES cells and thus may collaborate toregulate downstream genes important for stem cellself-renewal and differentiation (12). However, it is notclear how ES cells maintain the critical activity of thesetwo and other potential master regulators at the tran-scription concentration.

1 These authors contributed equally to this work.2 Correspondence: GIBH, Chinese Academy of Sciences

Guangzhou 510663, China. E-mail: pei-duanqing@gibh.ac.cndoi: 10.1096/fj.05-5543fje

E1094 0892-6638/06/0020-1094 © FASEB

Analysis of individual promoters of Oct4 and Nanogrevealed a complex set of cis-acting elements andtranscription factors that may control their levels ofexpression. For example, Oct4 promoter contains con-served distal and proximal enhancers that can eitherrepress or activate its expression depending on thebinding factors occupying these sites (for review, see ref2). On the other hand, the Nanog promoter has beensuggested as a direct target of the Oct4/Sox2 complexthrough ChiP analysis, in vitro binding experiments,and RNAi-mediated knockdowns (12–14). However,the functional outcome of these potential regulatorypotentials remains undefined. Furthermore, the dy-namic relationship between Oct4 and Nanog has notbeen explored enough to explain their purportedcollaboration to regulate stem cell self-renewal andpluripotency.

Nanog was originally proposed as a transcriptionrepressor that inhibits the expression of genes impor-tant for cell differentiation (9, 10). Our recent studiesrevealed that it actually contains two unusually strongtransactivators at the C-terminus, suggesting that itprimarily acts to activate those genes directly involvedin maintaining stem cell pluripotency (15, 16). On theother hand, the Oct4 protein appears to have a dualrole in mediating both activation and repression oftarget genes, mostly through interactions with otherprotein factors such as Sox2 and FoxD3 (2, 17, 18). Thewinged helix protein FoxD3, isolated as a transcriptionrepressor with restrictive expression in embryonic stemcells (19), is also required for the maintenance ofembryonic cells in early mouse embryos (20), suggest-ing that it may play a role in regulating stem cellself-renewal and pluripotency alongside Oct4 andNanog. Despite the fact that these transcription factorsare all required for the identity of early embryonicprogenitor cells, little is known about how Oct4,Nanog, and FoxD3 can regulate the activity of eachother and coordinate the expression of genes requiredfor stem cell self-renewal and pluripotency.

Here we present the first such attempt to construct aregulatory loop anchored by Oct4, Nanog, and FoxD3.We found that Oct4 regulates Nanog activity in a dose-dependent fashion. Oct4 activates Nanog promoterwhen expressed below steady-state yet represses it at orabove steady-state concentration in ES cells, thus, offer-ing a mechanism to explain the observed dose depen-dence of Oct4 to regulate stem cell pluripotency (11).We also identified FoxD3 as a novel activator of Nanog,apparently to counteract the repressive activity of Oct4on Nanog promoter at the steady-state. On the otherhand, Nanog and FoxD3 were found to activate Oct4promoter. Interestingly, Oct4 appears to serve as itsown repressor, thus, exerting a negative feedback pres-sure in the FoxD3-Nanog-Oct4 regulatory loop. Giventhe established roles of both Nanog and Oct4 inmaintaining stem cell pluripotency, we propose thatthis negative feedback loop anchors a large regulatory

network of transcription factors that control stem cellpluripotency.

MATERIALS AND METHODS

Cell lines and plasmids

NIH3T3, P19, and F9 cells were cultured in Dulbecco’smodified Eagle’s medium (DMEM; Invitrogen) supple-mented with 10% FBS (Hyclone) and antibiotics (penicillinand streptomycin, 100 �g/ml) as described previously (16,21). Mouse embryonic stem cells or ESCs were maintained onMEFs in ESC medium, which contains DMEM supplementedwith 20% FBS, nonessential amino-acids (100 mM), and 0.55mM 2-mercaptothanol (Invitrogen). The expression plasmidspCR3.1-NanogF and pCR3.1-Oct4 were prepared as describedpreviously (16, 21). The FoxD3 expression plasmid was pre-pared by inserting its coding sequence obtained by reversetranscription (RT)-polymerase chain reaction (PCR) to theEcoRV site in frame to a FLAG coding sequence as describedpreviously (16, 21). Nanog and Oct4 promoter fragmentswere amplified by PCR from the mouse liver genome DNAand inserted to the Sma lI site of a promoter less luciferasereporter vector pGL-basic (Promega). The primers were asfollows: forward: 5�-acagacaggactgctgggctgcagg-3�, reverse: 5�-tggaaagacggctcacctaggg-3� for Oct4 promoter, for a productof 2170 bp; and forward: 5�-tggaaataggaagatcaggagt-3�, re-verse: 5�-acagtggtagcaacggtggtagtggca-3� for Nanog promoterwith a product of 1120 bp. Nanog siRNA and Oct4 siRNAconstructs were prepared by inserting annealed oligo-nucleiotides, which encode the double strands RNA towardthe Oct4 and Nanog mRNA to pBSU6 vector, respectively,as described previously (22). The target sequences aregggtggattctcgaacctggc for Oct4 and gggaacgcctcatcaatgcctfor Nanog. A complete GFP expression cassette includingcytomeglovirus promoter, GFP coding sequence, andpoly(A) was obtained by PCR from a GFP expressionvector-pCR3.1 (21) and inserted to the siRNA vectors or tothe parental pBSU6 vector (U6-GFP). TK-3(E2)-luci, whichcontain three copies of ES cell-specific like elements fromNanog promoter, were made by the method as describedpreviously (21).

Transfection, RT-PCR, reporter assay, and stable lineselection

For RT-PCR analysis of lineage markers, ES-R1 cells culturedon 6 cm dishes were transfected with siRNA-GFP expressionvector (8 �g), Oct4, or Nanog or FoxD3 constructs (8 �geach) plus U6-GFP (2 �g). GFP-positive cells were sorted 4days after transfection by FACS and lysed by Trizon (Invito-gen), and the lineage markers were detected by RT-PCR. Theendogenous transcripts of Nanog and FoxD3 in NIH3T3,P19, F9, ES-R1 cells, and EBs were determined by RT-PCRusing GAPDH as a total RNA control. For reporter assay, cellsseeded in 24-well plate were transiently transfected withNanog promoter or Oct4 promoter reporters (0.1 �g each)and effector plasmids with increasing doses (0.1–0.4 �g)using Lipofectamine2000 (Invitrogen) according to the man-ufacturer’s instruction. pCMV-Renilla plasmids (0.005 �g pertransfection, Promega) were cotransfected in each well asinternal references, and the DNA concentrations for alltransfections were normalized to equal amounts by addingpCR3.1 empty vector. Thirty-six hours later, cells were washedby PBS and lysed in 70 �l of 1� PLB buffer (Promega).Luciferase activity was measured using the Dual-luciferase

E1095INTERDEPENDENCE BETWEEN Oct4, Nanog, AND FoxD3 IN ES CELLS

Reporter Assay System (Promega) and TD2020 Luminometer(Turner Design). Each transfection was carried out in dupli-cate and repeated at least twice. For the ES stable lineselection, feeder free ES cells maintained in ES mediumcontaining 103 unit/ml LIF (Chemicom) were seeded in 3.5cm dishes and transfected with 2 �g of each expressionplasmid. Twenty-four hours after transfection, the cells weredivided by 1:15 and seeded to new 10 cm dishes for selection.G418 (500 �g/ml, Invitrogen) was added to the medium forthe selection.

Chromatin immunoprecipitation assay

For chromatin immunoprecipitation (Chip) assays, ES-R1cells cultured in 6 cm dishes were transfected with 8 �g ofindicated expression constructs. Thirty-six hours later, cellswere washed twice with PBS and crosslinked by incubation in1% formaldehyade for 10 min. The crosslink was thenstopped by adding glycine to a final concentration of 0.125 M.The cells were then washed twice with PBS and lysed in 0.5 mllysis buffer (0.25% SDS, 200 mM NaCl, 50 mM Tris, pH 8.0,100 �g/ml salmon sprerm DNA, and 1� proteinase inhibitorcocktail from Sigma, St. Louis, MO). Crosslinked chromatinwas then sonicated to an average fragment length of 600 bp.The sonicated chromatin was cleared by centrifugation andpreabsorbed with 30 �l protein A agarose. The preabsorbedchromatin solutions was diluted with two volumes chip buffer(1% Nonidet P-40, 350 mM NaCl) and divided to threeportions. One was incubated with 1 �g of anti-Oct4 antibody(Ab; 21), one with 1 �g of antiflag Ab (Sigma), and the otherwithout any first Ab as control at 4°C overnight. The com-plexes were absorbed by adding 30 �l protein A resin to eachtube and incubated for 1 h. The resin was then washed threetimes by wash buffer (1% TrionX100, 1% deoxycholate 0.2 MTris, pH 8.1, 0.1 M EDTA, and 0.25 M NaCl) and two times byTE buffer. The complexes were eluted by 250 �l elutionbuffer (1% SDS, 0.1 M NaHCO3), and the crosslink wasreversed by adding 20 �l of 5 M NaCl and a further incuba-tion at 65°C for 4 h. After treatment with proteinase K for 1 hat 45°C, the DNA was analyzed by PCR using the followingprimers: forward: 5�-cttttgcattacaatgtccatgg-3�, reverse: 5�-gt-cagtgtgatggcgagggaagggat-3� for the amplification of the Chipproduct by anti-Oct4; and forward: 5�ttgggcatggtggtaga-caagc3�, reverse: 5�-gtcagtgtgatggcgagggaaggg-3� for the Chipproduct by anti-Flag. Three separate PCR reactions wereperformed, analyzed, and presented in Fig. 1E and Fig. 2F todemonstrate consistency.

RESULTS

Oct4 induced mouse ES cells differentiationby suppressing Nanog

Oct4 has been shown to determine the fate of embry-onic progenitor cells in vivo and stem cells in vitro (8,11, 18). Specifically, down-regulation of Oct4 triggersthe mouse ES cells to differentiate into trophectoderm,while over-expression of Oct4 causes the differentiationof mouse ES cells into endoderm tissues (11). However,the precise mechanism through which Oct4 mediatessuch diverse effects remains unknown. To this end, wecompared the phenotypes of ES cells that either over-express Oct4 or underexpress Nanog. As shown in Fig.1A, ES cells over-expressing Oct4 are morphologicallyidentical to those underexpressing Nanog, suggesting

that both factors may have opposing functions insideES cells. Indeed, analysis of pluripotent and differenti-ation markers revealed that these two cell populationsexpressed identical markers of endoderm origin (Fig.1B), suggesting that ES cells over-expressing Oct4 phe-nocopy those with Nanog knockdown. Interestingly, wealso noticed that the expression of Nanog was sup-pressed in ES cells with elevated Oct4 (Fig. 1B, toppanel), arguing that over-expressed Oct4 mediates itseffect via repressing Nanog directly.

To test this possibility, we cloned the promoterregion of Nanog and investigated its regulation by Oct4in pluripotent cells. A 926 bp fragment upstream thetranscription start site was cloned into a reporter vec-tor, pGL-basic, as shown in Fig. 1C. As shown in Fig 1C,Nanog promoter functioned as expected with highactivities in F9 and ES cells and low and no activities inP19 and NIH3T3, respectively, paralleling the endoge-nous levels of Nanog in these cells. To see if Oct4 cansuppress Nanog promoter directly, we cotransfectedOct4 with this Nanog reporter into F9 cells. As acontrol, we also included a reporter that carries sixcopies of Oct4-binding sites. As shown in Fig. 1D, Oct4suppressed the activity of Nanog promoter in a dose-dependent fashion, while it activated the control re-porter bearing Oct4 binding sites. As these assays wereperformed transiently within 48 h before the expecteddifferentiation triggered by Oct4 over-expression, thesedata suggested that over-expressed Oct4 act as a repres-sor of Nanog, consistent with our prediction from Fig.1A and B.

There is one Oct4 binding site at �181 positionwithin the Nanog promoter (12–14), and we subse-quently confirmed its occupation by Oct4 by ChiP asshown in Fig. 1E. Two deletion constructs were made,one deleting sequences upstream of �554 position andanother deleting upstream of the �181 position but allretaining the Oct4 binding site. As expected, bothconstructs were repressed by Oct4 in non pluripotentNIH3T3 cells (Fig. 1F). However, a mutation at theOct4 binding site rendered the 926 bp promoter insen-sitive to coexpressed Oct4 or Oct4 siRNA, suggestingthat Oct4 regulates Nanog promoter specifically (Fig.1G). These data strongly suggested a negative role ofOct4 in regulating Nanog. Indeed, the concentrationof Nanog in ES cells over-expressing Oct4 is alsoreduced significantly as monitored by Western blot todetect endogenous Nanog (Fig. 1H, upper panel) andtransfected Oct4 (Fig. 1H, middle panel). Together,these data demonstrate that elevated Oct4 induces EScell differentiation by suppressing Nanog.

Biphasic regulation of Nanog by Oct4 in ES cells

The repressive effect of Oct4 we observed on Nanogpromoter appears to be contradictory to the recentreport that Oct4 is required to maintain Nanog activityin ES cells by RNAi-mediated knockdown (14). Toreconcile this difference, we monitored Nanog pro-moter activity in a range of Oct4 siRNA concentrations.

E1096 Vol. 20 August 2006 PAN ET AL.The FASEB Journal

As shown in Fig. 1I, an initial up-regulation of Nanogwas observed at lower doses of Oct4 siRNA (lanes 3, 4vs. 2), while higher doses suppressed Nanog activity asreported previously (14). These data demonstrated thatOct4 is essential in maintaining the expression ofNanog. To further confirm this observation, we com-

pared the activities of reporter plasmids carrying thewild-type promoter or a mutated one at the Oct4binding site in pluripotent cells. As shown in Fig 1J, themutant plasmid has much lower activity than the wild-type promoter (Fig. 1J, lanes 3 vs. 2), suggesting thatOct4 does play an essential role in maintaining Nanog

Figure 1. Dose-dependent regulation of Nanogby Oct4. A) ES cells with overexpressed Oct4 ordown-regulated Nanog share same morphol-ogy. R1 ES cells were transfected with U6-GFP,siNanog-GFP, or Oct4F plus U6GFP as indi-cated. GFP-positive cells were sorted by FACSand cultured further in the presence of LIF.Viable colonies were obtained and passaged.Morphology of obtained clones was photo-graphed in bright fields (left panels) or in fluo-rescence (right panels) as presented. CK, control(in all figures). B) Overexpression of Oct4 anddown-regulation of Nanog induced identicaldifferentiation pattern. ES cells transfected withGFP vector (lane 2), Oct4 (lane 3), NanogsiRNA vector (lane 4), and day 6 embryonicbodies (EB6, lane 5) were analyzed by RT-PCRfor the expression of pluripotent as well asdifferentiation markers as indicated. Note iden-tical pattern of marker expression betweenOct4 and Nanog siRNA transfected cells. T:brachyury; TM: thrombomodulin. C) Nanogpromoter (�1 kb) recapitulates the endoge-nous expression of Nanog. Endogenous Nanogtranscripts in NIH3T3, P19, F9, and ES cellswere analyzed by RT-PCR. Activity of Nanogpromoter was also analyzed in these cell lines toshow its specificity in pluripotent cells as indi-cated as described previously (16). D) Oct4suppresses the activity of Nanog promoter in F9cells. Nanog promoter construct (NanP, lanes2–5) and Oct4 reporter (6w-lu, lanes 6–9) werecotransfected with Oct4 expression constructswith increasing doses into F9 EC cells andluciferase activities were measured and ana-lyzed as described previously (16). E) Binding ofNanog promoter by Oct4 in ES cells. Chroma-tin immuno-precipitation analysis was per-formed to demonstrate the in vivo binding ofNanog promoter by Oct4 as described in Mate-rials and Methods. F) Oct4 suppresses Nanogpromoter constructs in NIH3T3 cells. Cotrans-fecton of Oct4 with reporters carrying deletionsin the Nanog promoter was performed andanalyzed as described in D. G) a mutation in theOct4 binding site abolished the regulation ofNanog promoter by Oct4. Reporters carryingwild-type and mutant promoters were cotrans-fected with Oct4 or Oct4 siRNA vectors andanalyzed as in D. H) Overexpressed Oct4 re-duces the expression of Nanog in ES cells. ES orOct4 transfected ES cells were lysed, and lysateswere separated by SDS-PAGE (10%). Endoge-nous Nanog or transfected Oct4 protein weredetected by anti-Nanog or anti-FLAG (Oct4 isFLAG tagged) antibodies, respectively. Levels ofactin in the cell lysate were detected by antiac-

tin Ab as a loading control. I) Regulation of Nanog by Oct4 siRNA in F9 cells. Nanog promoter construct (NanP, lanes 2–6) wascotransfected with increasing doses of Oct4 siRNA construct (lanes 3–6) into F9 cells, and activities were analyzed by luciferaseassay. J) Oct4 binding site is required for activity of Nanog promoter in F9 cells. Wide-type and mutant Nanog promoterconstructs (lanes 2 and 3) were transfected to F9 cells, and their activities were evaluated by luciferase assay as in D.

E1097INTERDEPENDENCE BETWEEN Oct4, Nanog, AND FoxD3 IN ES CELLS

expression at steady-state concentration. Taken allthese observations together, we can conclude that Oct4regulates Nanog biphasically, i.e., a steady-state concen-tration maintains its expression, while an elevatedconcentration suppresses its expression.

FoxD3 as an activator of Nanog

The fact that Oct4 represses Nanog activity in ES cellsraises the possibility that there must be positive activa-tors in ES cells to sustain the expression of Nanog.Indeed, Nanog is expressed in Oct4 deficient embryos(10). One of the candidate transcription factors isFoxD3, a forkhead family transcription factor highlyexpressed in mouse ES cells and pluriopotent cells inearly embryos (19, 20). FoxD3 null embryos diedshortly after implantation with a loss of epiblast, a

phenotype similar to Nanog deficient embryos (20),suggesting a likely regulatory relationship betweenthese two factors. We analyzed the expression patternof FoxD3 in pluripotent cells and differentiated EBs. Asshown in Fig. 2A, upper panel), FoxD3 is expressedamong pluripotent cells such as P19, F9, and ES cellsbut not in nonpluripotent NIH3T3 cells. During thedifferentiation of embryonic bodies, FoxD3 is ex-pressed from day 0 to day 4 and then downregulated indays 5 and 6 (Fig. 2A, lower panels). These data suggestthat FoxD3 may play an important role in maintainingES cell pluripotency in a similar fashion as Nanog. It isalso apparent that FoxD3 and Nanog are coexpressedfrom day 0 to day 3 (Fig. 2A, lower panel), indicating alikely regulatory relationship between them.

To test this possibility, we performed cotransfectionof Nanog promoter reporter with FoxD3 expression

Figure 2. FoxD3 activates expression of Nanog. A) Expression of FoxD3 is restricted in pluripotent cells and down regulatedduring the differentiation of EBs. FoxD3 was analyzed by RT-PCR in indicated cells and EBs to show its restriction in pluripotentcells. B, C, D) FoxD3 activates Nanog only in puripotent cells. Nanog promoter construct was transfected alone (lane 2) or withFoxD3 (lane 3–5) with increasing doses to F9 cells (B), ES-R1 cells (C), and NIH3T3 cells (D). Activities were evaluated byluciferase assay as described (16). E) A cis-acting element between �269 and �554 on the Nanog promoter is responsible forthe observed activation. A series of 5� deletion constructs of Nanog promoter were made and cotransfected with FoxD3 in a dosefashion and the activities were measured by luciferase assay as before. F) FoxD3 binds to the Nanog promoter. F9 cells weretransfected with FoxD3-Flag construct and the cell lysate was analyzed by Chip assay using antiflag Ab as described in Materialsand Methods. G) An ES cell specific enhancer (E2) like element is present between �269–�299 on Nanog promoter. The entire926 bp of Nanog promoter is presented with deletion sites marked by downward vertical arrows and E2 element by a reversearrow. H) FoxD3 suppresses the reporter gene bearing 3 copies of E2 like element from Nanog promoter. An alignment betweenE2 ES cell specific enhancer and the fragment of �269– �299 on Nanog promoter were shown. E2 like element was insertedupstreamly to luciferase reporter carrying a minimal TK promoter. This reporter was cotransfected with FoxD3 in a dose fashionto F9 cells and luciferase activity was evaluated as before.

E1098 Vol. 20 August 2006 PAN ET AL.The FASEB Journal

vector in F9 EC cells. As shown in Fig. 2B, FoxD3activated Nanog promoter in a dose-dependent fashionin F9 cells (Fig. 2B). To further confirm this finding, weperformed the same experiments in ES cells andNIH3T3 cells. As expected, FoxD3 strongly up-regu-lated the activity of Nanog in ES cells (Fig. 2C), butsurprisingly, had no effect on the same reporter innonpluripotent NIH3T3 cells (Fig. 2D). These findingssuggest that FoxD3 may activate Nanog in a pluripo-tency-specific manner.

FoxD3 was originally identified as a transcriptionrepressor through binding an AT rich cis-element (20).To map the cis-elements that FoxD3 utilizes to activateNanog, a series of deletions were made in Nanogpromoter and their activities analyzed. As shown in Fig.2E, FoxD3 strongly activated reporters bearing �554,�676, and �733 deletions but failed to activate aconstruct deleting sequences upstream of �269, sug-gesting that there is a FoxD3 binding site between�269 and �544 in Nanog promoter. Indeed, ChiPanalysis confirmed the binding of FoxD3 within thisregion in vivo in F9 cells (Fig. 2F). A closer examinationof the sequences in the �269 and �554 region identi-fied an AT rich element, which is highly homologous tothe identified ES specific enhancer (Fig. 2G, H). This

enhancer was shown as a FoxD3 binding site in vitro(20). To further investigate this AT element, we in-serted three copies of this element upstream of aminimal TK promoter driving a luciferase reporter(Fig. 2H). When coexpressed with FoxD3, we foundthat this element is indeed regulated by FoxD3, albeitnegatively as reported previously (Fig. 2H; ref 19).Given our finding that FoxD3 activates Nanog expres-sion transcriptionally, we suggest that FoxD3 may as-sume a dual role in regulating downstream genes,either activation or repression, depending on the con-text of the target promoter. In the case of Nanog, weshowed here that FoxD3 is an activator and, thus, mayplay an important role in sustaining the expression ofNanog in ES cells.

Oct4 activity is maintained at the steady-stateconcentration by a negative feedback loop in ES cells

It is well established that Oct4 must be maintained at arigid concentration for ES cells to remain pluripotent(8, 11). To date, there has been no attempt to under-stand how ES cells achieve such a rigid control overOct4 expression. The apparent biphasic regulation ofNanog by Oct4 observed in Fig. 1 prompted us to

Figure 3. Regulation of Oct4 by Nanog, FoxD3,and Oct4. A) Oct4 promoter is highly active inpluripotent cells and not in nonpluripotentcells. A 2 kb promoter fragment was isolated forOct4 and analyzed in P19, F9 or NIH3T3 cellsby luciferase assay. B, C, D, E) Nanog, FoxD3can positively regulate the expression of Oct4while Oct4 suppresses itself. The Oct4 pro-moter reporter was transfected alone or withNanog (B, lanes 3–5), FoxD3 (C, lanes 3–5),Oct4 (D, lanes 3–5), and Oct4 siRNA (E, lanes3–5) to F9 cells and the activity were evaluatedby luciferase assay as described previously (16).F) Modulation of endogenous Oct4 by Nanog,FoxD3 and their siRNAs in ES cells. R1 ES cellswere transfected with vector alone (lane 2) orwith FoxD3 (FoX, lane 3), Nanog (Nan, lane 4),and siRNAs for Nanog (SiN, lane 5) or FoxD3(SiF, lane 6), respectively. RNAs were extractedfrom these transfected cells and analyzed byRT-PCR for expression of Nanog and Oct4 inES cells.

E1099INTERDEPENDENCE BETWEEN Oct4, Nanog, AND FoxD3 IN ES CELLS

investigate the regulation of Oct4 by FoxD3 and Nanog.To this end, we cloned the promoter region of Oct4and analyzed its expression in the context of Nanog,FoxD3, and Oct4 itself. First, we evaluated the activity ofthis promoter in the P19 and F9 cells and NIH3T3 cells(P19 and F9 are positive for Oct4 and NIH3T3 negativeby RT-PCR, data not shown). As expected, the Oct4promoter has robust activity in pluripotent P19 and F9cells but not in NIH3T3 cells (Fig. 3A), suggesting thatthis promoter region is regulated similarly as endoge-nous Oct4. When analyzed with Nanog and FoxD3, theOct4 promoter was activated strongly by both factors ina dose-dependent fashion (Fig. 3B and C). Interest-ingly, when cotransfected with Oct4, we found thatOct4 protein appeared to be a repressor of its ownpromoter (Fig. 3D). These data suggested that Oct4had a feedback loop to limit its own quantity. We thenperformed siRNA knockdown experiment to down-regulate endogenous Oct4 and confirmed the inhibi-tory effect of Oct4 even at the endogenous concentra-tion (Fig. 3E). Thus, we concluded that Oct4 behaves asa persistent repressor of its own promoter in contrast toits biphasic regulation of Nanog (see Fig. 1).

The negative autoregulation of Oct4 promoter byOct4 protein raises the possibility that Oct4 works as anegative feedback mechanism to ensure its own expres-sion set at a steady state in ES cells. To test thispossibility, we examined the concentration of Oct4expression in ES cells over-expressing both FoxD3 andNanog. As shown in Fig. 3F, neither FoxD3 nor Nanogwas able to increase the expression concentration ofOct4 in ES cells (lanes 3 and 4 vs. 2). On the otherhand, knockdown of either FoxD3 or Nanog by siRNAssignificantly reduced the expression of Oct4 as ex-pected (Fig. 3F, lanes 5, 6 vs. 2). Similar results werealso obtained in F9 cells (data not shown). These datademonstrate a potential feedback inhibitory loop thatcounterbalances the activation potential of FoxD3 andNanog on Oct4. The suppression of Oct4 by Oct4 itselfis sufficient to achieve the critical concentration ofOct4 at equilibrium, a hallmark function of Oct4 inregulating stem cell pluripotency. Taken together, ourresults demonstrate a regulatory circuitry amongFoxD3, Nanog, and Oct4, which ensures the properexpression of Oct4 in ES cells.

Neither Oct4 nor Nanog is dispensable in sustainingthe self-renewal of mouse ES cells

The interdependence between Nanog and Oct4 tomaintain their transcription activity suggest that bothmaster regulators may cooperate to sustain stem cellpluripotency. Indeed, either gene is required for earlyembryo development and stem cell pluripotency (7, 9,10). Unlike Oct4, overexpression of Nanog has beendemonstrated to positively promote stem cell self-re-newal by bypassing the requirement of LIF/Stat path-way (9, 10), raising the possibility that over expressionof Nanog may be able to compensate the activity ofOct4. Alternatively, Oct4 and Nanog may function in

parallel or tandem as master regulators of stem cellpluripotency. To test these possibilities, we attemptedto rescue the loss of Oct4 activity by overexpressingNanog and vice versa. We cotransfected the RNAi vec-tors for Oct4 or Nanog either alone or with Nanog orOct4 expression vectors, respectively, and then ana-lyzed the self-renewal activity of these transfected cells.As expected, stem cells expressing siRNAs for Oct4 orNanog failed to undergo self-renewal (Fig. 4A,b, c vs. a).Interestingly, the overexpressed Nanog failed to com-pensate the loss of Oct4 in sustaining self-renewal (Fig.4A, d vs. a). Conversely, overexpression of Oct4 alsofailed to rescue the loss of Nanog (Fig. 4A, e vs. a).These data demonstrate that two master regulators,Oct4 and Nanog, need to function in parallel inmaintaining ES cell self-renewal and that neither isdispensable and nor capable of compensating the roleof the another.

DISCUSSION

We report here that Oct4, Nanog, and FoxD3 form aninteractive and interdependent circuit for the regula-

Figure 4. Both Oct4 and Nanog are required for the ESself-renewal. A) Oct4 and Nanog are required for the self-renewal of ES cells. ES cells were transfected with the con-structs for pCR3.1 and U6-GFP (a), pCR3.1 and siOct4 (b),pCR3.1 and siNanog (c), Nanog and siOct4 (d) or Oct4 andsiNanog (e) as indicated and treated with G418 selection.Plates were photographed to show differences in pluripo-tency. Number of drug resistant colonies was counted after 2wk selection and presented in f. B) A proposed model forOct4, Nanog, FoxD3 regulatory circuit. FoxD3 and Nanogwork positively to regulate Oct4 while Oct4 negatively regu-late itself. FoxD3 can up-regulate Nanog while Oct4 cansuppress the expression of Nanog.

E1100 Vol. 20 August 2006 PAN ET AL.The FASEB Journal

tion of stem cell pluripotency. Nanog is a direct targetof Oct4, and the suppression of Nanog by Oct4 canhelp explain the previous observation that overexpres-sion of Oct4 leads to endoderm-like differentiation inES cells (11). Furthermore, we demonstrated thatFoxD3 also participates in the regulation of stem cellself-renewal and pluripotency by activating the expres-sion of the two known master regulators, Nanog andOct4, in ES cells. We propose that this FoxD3-Nanog-Oct4 circuit may anchor a much larger network oftranscription factors dedicated to stem cell self-renewaland pluripotency.

Self-renewal and pluripotency are two critical prop-erties of embryonic progenitor cells in vivo and embry-onic stem cells in vitro, which should be under strictcontrol at the molecular concentration. Given theirsignificant role in development, considerable amountof resources must have been devoted to maintain thesetwo important properties and ensure the continuity oflife. At the core of this investment, transcriptionalfactors such as Oct4 and Nanog have been shown toplay a critical role at the individual basis in controllingstem cell self-renewal and pluripotency. Yet, the regu-latory logic among these important factors remainsunresolved. To this end, the interdependent relation-ship among Oct4, Nanog, and FoxD4 illustrated in Fig.4B represents the first step toward a rational under-standing of stem cell self-renewal and pluripotetncy.This regulatory circuit also reveals an important nega-tive feedback loop. Whereas a positive feedback systemleads to unsustainable escalation or downward spiral ofactivities, a negative feedback system is destined toachieve a state of equilibrium and a sustaining fixedconcentration of output. Most of the biological pro-cesses tend to adapt a negative feedback loop. In thecase of ES cell self-renewal and pluripotency, a negativefeedback loop presented in Fig. 4B appears to evolve tocontrol these important properties for animal develop-ment. Anchored by Oct4, this negative feedback loopmay also serve as an integrator or converter for allintracellular and extracellular signals that destined toregulate stem cell pluripotency. This is in agreementwith a previous report that only a “critical” concentra-tion of Oct4 can maintain stem cells at pluripotentstate, both under- and overexpression of Oct4 lead tocell differentiation (11). In contrast, Nanog does nothave a self-regulatory loop (data not shown). Its over-expression has been shown to further enhance thestemness of ES cells and prevent the differentiation ofES cells induced by retinoic acid (9), suggesting that itmay regulate other critical genes in addition to Oct4.This will also explain why they can not rescue eachother because this loop is interrupted when one ofthem is missing from the circuit. We believe that thiscircuit operates in the ES cells to ensure the activityof the critical master regulators, namely Nanog andOct4.

This work was supported in part by the Tsinghua UniversityBaiRen Scholar Program, NSFC 30270287 and 30470839, the

973 Project-2001CB5101 (P.I. Lingsong Li) from The Ministryof Science and Technology of China, and the TsinghuaYue-Yuen Medical Fund. D. Pei is a CheungKong(Changjiang) Scholar of the Li Ke-Shing Foundation andMinistry of Education, China. We acknowledge the support ofProfessor Nanming Zhao at Tsinghua University. The assis-tance from M. Chen, Y.Q. Guo, and the rest of the Peilaboratory made this study possible.

REFERENCES

1. Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A.,Swiergiel, J. J., Marshall, V. S., and Jones, J. M. (1998) Embry-onic stem cell lines derived from human blastocysts. Science 282,1145–1147

2. Pan, G. J., Chang, Z. Y., Scholer, H. R., and Pei, D. (2002) Stemcell pluripotency and transcription factor Oct4. Cell Res. 12,321–329

3. Audet, J. (2004) Stem cell bioengineering for regenerativemedicine. Expert. Opin Biol Ther. 4, 631–644

4. Constantinescu, S. (2003) Stemness, fusion and renewal ofhematopoietic and embryonic stem cells. J. Cell Mol. Med. 7,103–112

5. Koike, N., Fukumura, D., Gralla, O., Au, P., Schechner, J. S., andJain, R. K. (2004) Tissue engineering: creation of long-lastingblood vessels. Nature 428, 138–139

6. Chambers, I., and Smith, A. (2004) Self-renewal of teratocarci-noma and embryonic stem cells. Oncogene 23, 7150–7160

7. Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebe-nius, D., Chambers, I., Scholer, H., and Smith, A. (1998)Formation of pluripotent stem cells in the mammalian embryodepends on the POU transcription factor Oct4. Cell 95, 379–391

8. Pesce, M., and Scholer, H. R. (2000) Oct-4: control of totipo-tency and germline determination. Mol. Reprod. Dev. 55, 452–457

9. Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S.,Tweedie, S., and Smith, A. (2003) Functional expression clon-ing of Nanog, a pluripotency sustaining factor in embryonicstem cells. Cell 113, 643–655

10. Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M.,Takahashi, K., Maruyama, M., Maeda, M., and Yamanaka, S.(2003) The homeoprotein Nanog is required for maintenanceof pluripotency in mouse epiblast and ES cells. Cell 113,631–642

11. Niwa, H., Miyazaki, J., and Smith, A. G. (2000) Quantitativeexpression of Oct-3/4 defines differentiation, dedifferentiationor self-renewal of ES cells. Nat. Genet. 24, 372–376

12. Boyer, L. A., Lee, T. I., Cole, M. F., Johnstone, S. E., Levine,S. S., Zucker, J. P., Guenther, M. G., Kumar, R. M., Murray,H. L., Jenner, R. G., et al. (2005) Core transcriptionalregulatory circuitry in human embryonic stem cells. Cell 122,947–956

13. Kuroda, T., Tada, M., Kubota, H., Kimura, H., Hatano, S. Y.,Suemori, H., Nakatsuji, N., and Tada, T. (2005) Octamer andSox elements are required for transcriptional cis regulationof Nanog gene expression. Mol. Cell. Biol. 25, 2475–2485

14. Rodda, D. J., Chew, J. L., Lim, L. H., Loh, Y. H., Wang, B., Ng,H. H., and Robson, P. (2005) Transcriptional regulation ofnanog by OCT4 and SOX2. J. Biol. Chem. 280, 24731–24737

15. Pan, G. J., and Pei, D. Q. (2003) Identification of two distincttransactivation domains in the pluripotency sustaining factornanog. Cell Res. 13, 499–502

16. Pan, G., and Pei, D. (2005) The stem cell pluripotency factorNANOG activates transcription with two unusually potent sub-domains at its C terminus. J. Biol. Chem. 280, 1401–1407

17. Guo, Y., Costa, R., Ramsey, H., Starnes, T., Vance, G.,Robertson, K., Kelley, M., Reinbold, R., Scholer, H., andHromas, R. (2002) The embryonic stem cell transcriptionfactors Oct-4 and FoxD3 interact to regulate endodermal-specific promoter expression. Proc. Natl. Acad. Sci. USA. 99,3663–3667

E1101INTERDEPENDENCE BETWEEN Oct4, Nanog, AND FoxD3 IN ES CELLS

18. Pesce, M., and Scholer, H. R. (2001) Oct-4: gatekeeper in thebeginnings of mammalian development. Stem Cells 19, 271–278

19. Sutton, J., Costa, R., Klug, M., Field, L., Xu, D., Largaespada,D. A., Fletcher, C. F., Jenkins, N. A., Copeland, N. G., Klemsz,M., and Hromas, R. (1996) Genesis, a winged helix transcrip-tional repressor with expression restricted to embryonic stemcells. J. Biol. Chem. 271, 23126–23133

20. Hanna, L. A., Foreman, R. K., Tarasenko, I. A., Kessler, D. S.,and Labosky, P. A. (2002) Requirement for Foxd3 in maintain-ing pluripotent cells of the early mouse embryo. Genes Dev. 16,2650–2661

21. Pan, G., Qin, B., Liu, N., Scholer, H. R., and Pei, D. (2004)Identification of a nuclear localization signal in OCT4 andgeneration of a dominant negative mutant by its ablation. J. Biol.Chem. 279, 37013–37020

22. Sui, G., Soohoo, C., Affar el, B., Gay, F., Shi, Y., and Forrester,W. C. (2002) A DNA vector-based RNAi technology to suppressgene expression in mammalian cells. Proc. Natl. Acad. Sci. USA.99, 5515–5520

Received for publication January 15, 2006.Accepted for publication March 20, 2006.

E1102 Vol. 20 August 2006 PAN ET AL.The FASEB Journal

The FASEB Journal • FJ Express Summary

A negative feedback loop of transcription factors thatcontrols stem cell pluripotency and self-renewal

Guangjin Pan,1 Jun Li,1 Yali Zhou, Hui Zheng, and Duanqing Pei2

Institute of Pharmacology, Department of Biological Sciences and Biotechnology, State KeyLaboratory of Biomembrane and Membrane Biotechnology, Institutes of Biomedicine,School of Medicine, Tsinghua University, Beijing, China

To read the full text of this article, go to http://www.fasebj.org/cgi/doi/10.1096/fj.05-5543fje

SPECIFIC AIMS

The successful derivation and establishment of humanembryonic stem (ES) cell lines have generated stronginterest in harnessing the therapeutic potential of thesepluripotent cells to treat human diseases. At thepresent, there are considerable challenges in maintain-ing these ES cells in a pluripotent state or triggering EScells to differentiate into a particular cell type. In fact,the precise mechanism that regulates stem cell self-renewal and pluripotency remains largely unknown.

The homeodomain transcription factors Oct4 andNanog have been proposed as master regulators of stemcell self-renewal and pluripotency. However, it is not clearhow ES cells maintain the critical activity of these two andother potential master regulators at the transcriptionlevel. We would like to determine the molecular mecha-nism that governs the regulation of Oct 4 and ES cells.

PRINCIPAL FINDINGS

1. Oct4 induced mouse ES cells differentiation bysuppressing Nanog

Our initial aim was to define the relationship betweenNanog and Oct4, two transcription factors implicatedin stem cell self-renewal and pluripotency. More specif-ically, we would like to define if Oct4 and Nanogregulate each other in ES cells. To this end, we com-pared the phenotypes of ES cells that either over-express or underexpress Oct4 or Nanog by their expres-sion constructs or siRNA constructs. To our surprise, EScells over-expressing Oct4 are morphologically identi-cal to those with Nanog knocked down by siRNA (Fig.1A), suggesting that both factors may have opposingfunction inside ES cells. Indeed, analysis of pluripotentand differentiation markers revealed that these two cellpopulations expressed identical markers of endodermorigin (Fig. 1B), suggesting that ES cells over-express-ing Oct4 phenocopy those with Nanog knockdown.Interestingly, we also noticed that the expression ofNanog was suppressed in ES cells with elevated Oct4

(Fig. 1B, top panel), arguing that over-expressed Oct4mediates its effect via repressing Nanog directly.

To test this possibility, we analyzed the effect of Oct4 onthe Nanog promoter directly. As shown in Fig 1C, theNanog promoter functioned as expected with high activ-ities in F9 and ES cells and low and no activities in P19 andNIH3T3, respectively, paralleling the endogenous levelsof Nanog in these cells. Oct4 when coexpressed sup-pressed the activity of Nanog promoter in a dose-depen-dent fashion while activating the control reporter bearingOct4 binding sites (Fig 1D). There is one Oct4 bindingsite at �181 position within the Nanog promoter of whichwe confirmed its occupation by Oct4 by chromatin immu-noprecipitation assay (ChiP) as shown in Fig. 1E. Deletionanalysis shown in Fig. 1F demonstrated that the twoconstructs bearing this Oct4 binding site were repressedby Oct4 in nonpluripotent NIH3T3 cells. Mutation at theOct4 binding site rendered the 926bp promoter insensi-tive to coexpressed Oct4 or Oct4 siRNA, suggesting thatOct4 regulates Nanog promoter specifically (Fig. 1G).These data strongly suggested a negative role of Oct4 inregulating Nanog. Indeed, the concentration of Nanog inES cells over-expressing Oct4 is also reduced significantlyas monitored by Western blot (Fig. 1H). Together, thesedata demonstrate that elevated Oct4 induces ES celldifferentiation by suppressing Nanog.

2. Biphasic regulation of Nanog by Oct4 in ES cells

The repressive effect of Oct4 we observed on Nanogpromoter appears to be contradictory to the recentreport that Oct4 is required to maintain Nanog activityin ES cells by RNAi-mediated knockdown. To reconcilethis difference, we monitored Nanog promoter activityin a range of Oct4 siRNA concentrations. Figure 1Idemonstrated an initial up-regulation of Nanog bylower doses of Oct4 siRNA (lanes 3, 4 vs. 2), and higherdoses suppressed Nanog activity as reported. Figure 1J

1 These authors contributed equally to this work.2 Correspondence: GIBH, Chinese Academy of Science,

Guangzhou 510663, China. E-mail: pei-duanqing@gibh.ac.cndoi: 10.1096/fj.05-5543fje

1730 0892-6638/06/0020-1730 © FASEB

shows that the mutant plasmid bearing Oct4 site muta-tion has much lower activity than the wild-type pro-moter (Fig. 1J, lanes 3 vs. 2), suggesting that Oct4 doesplay an essential role in maintaining Nanog expressionat steady-state concentration. Taken all these observa-tions together, we can conclude that Oct4 regulatesNanog biphasically, i.e., a steady-state concentration

maintains its expression, while an elevated concentra-tion suppresses its expression.

3. FoxD3 as an activator of Nanog

The second aim was to identify additional factors thatmay positively regulate the expression of Nanog, thus,

Figure 1. Regulation of Nanog by Oct4. A) EScells with overexpressed Oct4 or down-regu-lated Nanog share same morphology. R1 EScells were transfected with U6-GFP, siNanog-GFP, or Oct4F plus U6GFP as indicated. Mor-phology of obtained clones was photographedin bright fields (left panels) or in fluorescence(right panels) as presented. B) Overexpression ofOct4 and down-regulation of Nanog inducedidentical differentiation pattern. ES cells trans-fected with GFP vector (lane 2), Oct4 (lane 3),Nanog siRNA vector (lane 4), and day 6 embry-onic bodies (EB6, lane 5) were analyzed byreverse transcriptase-polymerase chain reactionfor the expression of pluripotent as well asdifferentiation markers as indicated. Note iden-tical pattern of marker expression betweenOct4 and Nanog siRNA transfected cells. C)Nanog promoter (�1 kb) recapitulates the en-dogenous expression of Nanog. EndogenousNanog transcripts in NIH3T3, P19, F9, and EScells were analyzed by reverse transcription(RT)-polymerase chain reaction (PCR). Activityof Nanog promoter was also analyzed in thesecell lines to show its specificity in pluripotentcells as indicated as described (16). D) Oct4suppresses activity of Nanog promoter in F9cells. Nanog promoter construct (NanP, lanes2–5) and Oct4 reporter (6w-lu, lanes 6–9) werecotransfected with Oct4 expression constructswith increasing doses into F9 EC cells, andluciferase activities were measured and ana-lyzed as described previously (16). E) Binding ofNanog promoter by Oct4 in ES cells. Chroma-tin immuno-precipitation analysis was per-formed to demonstrate in vivo binding ofNanog promoter by Oct4. F) Oct4 suppressesNanog promoter constructs in NIH3T3 cells.Cotransfecton of Oct4 with reporters carryingdeletions in the Nanog promoter was per-formed and analyzed as described in D. G) Amutation in the Oct4 binding site abolishedregulation of Nanog promoter by Oct4. Report-ers carrying wild-type and mutant promoterswere cotransfected with Oct4 or Oct4 siRNAvectors and analyzed as in D. H) OverexpressedOct4 reduces the expression of Nanog in EScells. ES or Oct4 transfected ES cells were lysedand fractioned by 10% SDS-PAGE. EndogenousNanog or transfected Oct4 protein was detectedby anti-Nanog or anti-FLAG (Oct4 is FLAGtagged) antibodies, respectively. Levels of actinin the cell lysate were detected by antiactinantibody as a loading control. I) Regulation ofNanog by Oct4 siRNA in F9 cells. Nanog pro-moter construct (NanP, lane2–6) was cotrans-fected with increasing doses of Oct4 siRNA

construct (lane 3–6) into F9 cells, and activities were analyzed by luciferase assay. J) Oct4 binding site is required for activity ofNanog promoter in F9 cells. Wide-type and mutant Nanog promoter constructs (lanes 2 and 3) were transfected to F9 cells, andtheir activities were evaluated by luciferase assay as in D.

1731INTERDEPENDENCE BETWEEN Oct4, Nanog, AND FoxD3 IN ES CELLS

counteracting the repressive effects of Oct4 observed inthe previous section. FoxD3 is expressed among pluri-potent cells such as P19, F9, and ES cells but not innonpluripotent NIH3T3 cells. We thus hypothesizedthat FoxD3 may play an important role in maintainingES cell pluripotency in a similar fashion as Nanog. Wethen performed cotransfection of Nanog promoterreporter with FoxD3 expression vector in F9 EC cellsand demonstrated that FoxD3 is a very potent activatorof Nanog in a pluripotency specific manner, apparentlythrough a FoxD3 binding site between �269 and �544in Nanog promoter.

4. Oct4 activity is maintained at the steady-stateconcentration by a negative feedback loop in ES cells

The third aim was to establish a regulatory circuitamong FoxD3, Nanog, and Oct4 in ES cells. Theapparent biphasic regulation of Nanog by Oct4 ob-served in Fig. 1 prompted us to investigate the regula-tion of Oct4 by FoxD3 and Nanog. To this end, wecloned the promoter region of Oct4 and analyzed itsexpression in the context of Nanog, FoxD3, and Oct4itself. First, we evaluated the activity of this promoter inpluripotent P19 and F9 cells and nonpluripotentNIH3T3 cells. As expected, the Oct4 promoter hasrobust activity in pluripotent P19 and F9 cells but not inNIH3T3 cells. When analyzed with Nanog and FoxD3,the Oct4 promoter was activated strongly by bothfactors in a dose-dependent fashion. Interestingly,when cotransfected with Oct4, we found that Oct4protein appeared to be a repressor of its own promoter.These data suggested that Oct4 had a feedback loop tolimit its own quantity. We then performed siRNA

knockdown experiment to down-regulate endogenousOct4 and confirmed the inhibitory effect of Oct4 evenat the endogenous concentration. Thus, we concludedthat Oct4 behaves as a persistent repressor of its ownpromoter, in contrast to its biphasic regulation ofNanog (see Fig. 1).

The negative autoregulation of Oct4 promoter byOct4 protein raises the possibility that Oct4 works as anegative feedback mechanism to ensure its own expres-sion set at a steady state in ES cells. Indeed, our datademonstrate a feedback inhibitory loop that counter-balances the activation potential of FoxD3 and Nanogon Oct4. The suppression of Oct4 by Oct4 itself issufficient to achieve the critical concentration of Oct4at equilibrium, a hallmark function of Oct4 in regulat-ing stem cell pluripotency. Taken together, our resultsdemonstrate a regulatory circuitry among FoxD3,Nanog, and Oct4, which ensures the proper expressionof Oct4 in ES cells.

5. Neither Oct4 nor Nanog is dispensable insustaining the self-renewal of mouse ES cells

The interdependence between Nanog and Oct4 tomaintain their transcription activity suggests that bothmaster regulators may cooperate to sustain stem cellpluripotency. We cotransfected the RNAi vectors forOct4 or Nanog either alone or with Nanog or Oct4expression vectors, respectively, and then analyzed theself-renewal activity of these transfected cells. Stem cellsexpressing siRNAs for Oct4 or Nanog failed to undergoself-renewal. The overexpressed Nanog also failed tocompensate the loss of Oct4 in sustaining self-renewal.Conversely, overexpression of Oct4 failed to rescue theloss of Nanog. These data demonstrate that two masterregulators, Oct4 and Nanog, need to function in par-allel in maintaining ES cell self-renewal and that nei-ther is dispensable and nor capable of compensatingthe role of the another.

CONCLUSIONS AND SIGNIFICANCE

We conclude that Oct4, Nanog, and FoxD3 form aninteractive and interdependent circuit for the regula-tion of stem cell pluripotency. Nanog is a direct targetof Oct4, and the suppression of Nanog by Oct4 canhelp explain the previous observation that overexpres-sion of Oct4 leads to endoderm-like differentiation inES cells. Furthermore, we demonstrated that FoxD3also participates in the regulation of stem cell self-renewal and pluripotency by activating the expressionof the two known master regulators, Nanog and Oct4,in ES cells. We propose that this FoxD3-Nanog-Oct4circuit may anchor a much larger network of transcrip-tion factors dedicated to stem cell self-renewal andpluripotency.

Figure 2. Schematic diagram.

1732 Vol. 20 August 2006 PAN ET AL.The FASEB Journal