Gerstner_et_al-2016-Journal_of_Neuroscience_Research

Amyloid-b Induces Sleep FragmentationThat Is Rescued by Fatty Acid BindingProteins in Drosophila

Jason R. Gerstner,1,2* Olivia Lenz,1 William M. Vanderheyden,2

May T. Chan,1 Cory Pfeiffenberger,1 and Allan I. Pack1

1Center for Sleep and Circadian Neurobiology, Perelman School of Medicine, University of Pennsylvania,Philadelphia, Pennsylvania2Department of Biomedical Sciences, Elson S. Floyd College of Medicine, Washington State University,Spokane, Washington

Disruption of sleep/wake activity in Alzheimer’s disease(AD) patients significantly affects their quality of life andthat of their caretakers and is a major contributing factorfor institutionalization. Levels of amyloid-b (Ab) have beenshown to be regulated by neuronal activity and to corre-late with the sleep/wake cycle. Whether consolidatedsleep can be disrupted by Ab alone is not well under-stood. We hypothesize that Ab42 can increase wakeful-ness and disrupt consolidated sleep. Here we report thatflies expressing the human Ab42 transgene in neuronshave significantly reduced consolidated sleep comparedwith control flies. Fatty acid binding proteins (Fabp) aresmall hydrophobic ligand carriers that have been clinicallyimplicated in AD. Ab42 flies that carry a transgene ofeither the Drosophila Fabp or the mammalian brain-typeFabp show a significant increase in nighttime sleep andlong consolidated sleep bouts, rescuing the Ab42-induced sleep disruption. These studies suggest thatalterations in Fabp levels and/or activity may be associ-ated with sleep disturbances in AD. Future work todetermine the molecular mechanisms that contribute toFabp-mediated rescue of Ab42-induced sleep loss willbe important for the development of therapeutics in thetreatment of AD. VC 2016 Wiley Periodicals, Inc.

Key words: neurodegeneration; fruit fly; amyloid-b

Circadian disturbances and nocturnal problems suchas sleeplessness are common among Alzheimer’s disease(AD) patients and are major contributing factors for insti-tutionalization (Pollak and Perlick, 1991; Weldemichaeland Grossberg, 2010). Evidence suggests that sleep is dis-rupted in AD (Prinz et al., 1982), and sleep disorders mayincrease the risk of AD (Osorio et al., 2011, 2015).Recent studies in humans and animal models suggest thata bidirectional relationship exists between sleep/wakebehavior and amyloid-b (Ab), a small peptide that is asso-ciated with plaque formation and is found in AD patients

(Kang et al., 2009; Roh et al., 2012; Ju et al., 2013;Rothman et al., 2013; Spira et al., 2013; Liguori et al.,2014; Mander et al., 2015; Sprecher et al., 2015). Ab isproduced following sequential cleavage of the amyloidprecursor protein by b- and g-secretases (Haass and Sel-koe, 2007) and begins to aggregate in the human brainyears before clinical symptoms, neuronal damage, andsynaptic loss in AD (Holtzman et al., 2011a; Sperlinget al., 2011). Ab aggregation forms the hallmark of insol-uble plaques observed in AD pathology, and it is knownthat clinically asymptomatic people already have reducedsteady-state functional connectivity in brain areas contain-ing amyloid deposits (Sperling et al., 2009; Sheline et al.,2010). This suggests that other biomarkers of preclinicalAD associated with Ab deposition may exist, and theidentification of such factors is essential for developing

SIGNIFICANCE

Sleep problems are common among Alzheimer’s disease (AD) patients

and are a major contributing factor for institutionalization. Clinical

studies have suggested a bidirectional relationship between sleep and

amyloid-b (Ab), a small peptide associated with plaque formation in

AD. Recent biomarker studies show associations between AD and

fatty acid binding proteins (Fabps). Fabps are reduced in brains of AD

patients but elevated in the cerebrospinal fluid and sera compared

with healthy individuals. Knowledge of the relationships among Ab,

Fabp expression, and underlying sleep disturbance would aid in

understanding AD pathogenesis and may guide therapeutic strategies

to delay AD disease progression.

Contract grant sponsor: National Institutes of Health; Contract grant

numbers: T32 HL07713 (to J.R.G.); T32 HL110952 (to W.M.V.);

P01AG017628 (to A.I.P.)

*Correspondence to: Jason R. Gerstner, Pharmaceutical and Biomedical

Sciences, Washington State University, 412 E. Spokane Falls Blvd.,

Room 215, Spokane, WA 99202. E-mail: [email protected]

Received 4 February 2016; Revised 15 April 2016; Accepted 9 May

2016

Published online 00 Month 2016 in Wiley Online Library

(wileyonlinelibrary.com). DOI: 10.1002/jnr.23778

VC 2016 Wiley Periodicals, Inc.

Journal of Neuroscience Research 00:00–00 (2016)

treatments to slow or prevent AD pathogenesis (Holtz-man et al., 2011b).

Levels of Ab in cerebrospinal fluid (CSF) cyclebased on time of day in humans, with a progressivedecline in circadian amplitude occurring with age andamyloid deposition (Huang et al., 2012). Diurnal cyclingof Ab has also been shown to be correlated negativelywith Ab aggregation and increased wakefulness (Rohet al., 2012). Ab concentrations are elevated followingperiods of chronic sleep restriction in AD mouse models(Kang et al., 2009; Rothman et al., 2013), supporting apositive feedback loop hypothesis among Ab levels, clear-ance, aggregation, and the sleep/wake cycle (Gerstneret al., 2012a; Ju et al., 2013; Lim et al., 2014). Given thatAb levels are higher during periods of wakefulness (Kanget al., 2009) and that the peak in amplitude of cycling Ablevels in human CSF precedes the peak in total sleep timeby 6 hr (Huang et al., 2012), we test the hypothesis thatneural expression of Ab increases wakefulness and disruptsconsolidated sleep. Sleep disturbance is thought to occurat ages prior to the onset of cognitive deficits in AD andtherefore could represent a preclinical marker (Ju et al.,2014). Because of the link between sleep disturbance andAb levels, we also examine whether any Ab-inducedsleep disruption exists at ages prior to the onset of tradi-tionally established AD phenotypic markers.

The fruit fly Drosophila melanogaster is an excellentanimal model system for testing these questions for threereasons. First, the fly AD model recapitulates most of theclinically relevant hallmark traits of the disease, includingthe formation of amyloid deposits, progressive memoryloss, neurodegeneration, and premature death (Iijimaet al., 2004; Iijima-Ando and Iijima, 2010). Second,Drosophila is an established model for studying sleep/wakebehavior, and, unlike wild-type mice, which havecomparatively more fragmented sleep and are nocturnal,Drosophila has a very consolidated period of sleep duringthe dark phase of the light–dark cycle (Ho and Sehgal,2005; Cirelli and Bushey, 2008; Zimmerman et al.,2008). This becomes more fragmented with aging (Kohet al., 2006; Bushey et al., 2010; Koudounas et al., 2012).Third, the fly model offers the opportunity to evaluaterapidly specific genetic targets that could inform thetherapeutic potential for treatments that delay or preventneurodegenerative disease (Bilen and Bonini, 2005; Luand Vogel, 2009).

This current study shows that flies that expresshuman Ab have significant sleep fragmentation at 2 or 3days posteclosion, an age prodromal to memory deficitspreviously reported in adult flies (Iijima et al., 2004). ADflies that contain either the fly fatty acid binding proteins(Fabp) or the murine Fabp7 transgene rescue the Ab-induced disruption in consolidated sleep. These findingssuggest that 1) Ab neuronal expression affects sleep qual-ity, 2) Ab-induced sleep fragmentation may be an earlymarker in the course of human AD, and 3) therapeuticapproaches targeting Fabp may have clinical implicationsfor reducing sleep-associated disturbances observed inAD.

MATERIALS AND METHODS

Drosophila Genetics and Stocks

Male flies (D. melanogaster) carrying a human Ab42 trans-gene expressed in the presence of neuronal promoter elav(C155-GAL4; Finelli et al., 2004; Iijima et al., 2004) wereexamined for changes in sleep compared with flies overexpress-ing either dFabp or mFabp7 (Gerstner et al., 2011a,b) with avideo monitoring assay (Zimmerman et al., 2008). The parentalgenotypes of flies used in this study were elavc155-GAL4/Y(elav-GAL4; obtained from J. Williams), GeneSwitch (GS)-elav-GAL4 (GS-elav-GAL4; Bloomington), UAS-Ab42(obtained from M. Konsolaki), hs-dFabp (101-4), hs-mFabp7(103-5), and the isogenic w (isoCJ1) background strain (Gerst-ner et al., 2011b). Fly genotypes were all back-crossed into thew(isoCJ1) background for a minimum of six generations and aresummarized in Table 1, with descriptions of each genotype andabbreviations. For the GeneSwitch experiments (Vanderheydenet al., 2013), food was prepared by vortexing RU486 (mifepri-stone) with melted food and allowing the mixture to solidify.Briefly, 500 lM RU486 dissolved in 80% ethanol was preparedin 1% agar and 5% sucrose minimal media. Flies were firstrecorded in tubes containing only 1% agar and 5% sucrose min-imal media and after 2 days were switched to minimal mediacontaining drug or vehicle and were replaced under the camerafor the duration of the recording. Heat-shock treatmentconsisted of increasing the ambient room temperature to 298Cfor 3 days following baseline recording.

Sleep Behavior

Flies were collected following eclosion and placed onstandard cornmeal agar media. Two or three days after eclo-sion, flies were transferred individually under CO2 anesthesiainto tubes 6 cm long containing food at one end and a yarnplug at the other. Behavioral recordings of fly sleep were col-lected under a 12-hr white light:12 hr-infrared light (wave-length 950 nm) cycle at 258C in Precision Instruments 818incubators equipped with two fluorescent bulbs and two infra-red lights mounted horizontally beside cameras (Zimmermanet al., 2008). Cameras took an image every 5 sec, and pixelsubtraction was used for Matlab CSCN analysis (softwareobtained from Dr. Pack, [email protected]) to trackmovement of flies. Sleep is defined as 5 min or more ofcontinuous inactivity, the minimum amount of time to qualifyas a single sleep bout. The assessment of activity/inactivity isexplained more fully below. Zeitgeber time (ZT) 0 is definedas the time of lights on, and ZT12 is defined as the time oflights off. Daytime sleep measures were from lights on to lightsoff (ZT0–ZT12), nighttime measures were from lights off tolights on (ZT12–ZT24). Average sleep-bout duration isdefined as the mean of all sleep bouts for the given period forthe group. Average maximal sleep bout duration is defined asthe mean of the longest sleep bout of all flies within a group.Bout counts are defined as the mean number of transitionsbetween sleep and wake states for the group. Latency isdefined as the amount of time to first sleep episode followinglights off (ZT12).

2 Gerstner et al.

Journal of Neuroscience Research

Consolidation Index

Consolidation index (CI) is a measure of consolidation ofsleep for a group. Greater CI values reflect less interrupted sleep(i.e., less sleep fragmentation), whereas lower CI values indicatemore sleep fragmentation. CI was calculated by summing thesquare of all sleep-bout lengths (in minutes) and dividing by thetotal amount of sleep (Pitman et al., 2006).

Locomotor Activity

The digital image analysis method previously described isbased on frame subtraction and was used to determine a quies-cent fly from a moving fly (Zimmerman et al., 2008) as well asto calculate locomotor activity. The amount of movement of afly was calculated by summing the number of pixels changedbetween consecutive subtracted images at the same samplingrate used to determine sleep (5 sec). Briefly, corresponding pix-els from two temporally adjacent images were subtracted and aresulting difference image was generated. Each pixel in the differ-ence image has the value GS(XiYj) 5 ([GS2(XiYj) 2

GS1(XiYj)]/2) 1 127, where GS(XiYj) is the difference imagegray-scale value centered around a value of 127 at pixels Xposition i and Y position j, and GS2 and GS1 are the gray-scalevalues at that same pixel for the second and first video frames,respectively, in a pair of temporally adjacent frames. The imageswere digitized with eight bits per pixel; therefore, the range ingray-scale values for a single pixel was from 0 to 255. Areas ofinterest corresponding to each monitor tube, i.e., each fly, wereanalyzed separately. Gray pixels, ones in which motion did notoccur, have values close to 127. They are not exactly 127because of noise in image acquisition. Because the degree ofnoise varied between incubators and cameras, for every experi-ment the degree of this noise was determined by analyzing aportion of the image that was outside the monitoring tubesand, therefore, contained no movement. Movement perminute awake was defined by summing the number of pixelschanged between images accounting for this inherent noise anddividing by the amount of time (minutes) spent in wakefulnessover each 1-hr bin.

Reverse-Transcription QuantitativePolymerase Chain Reaction

RNA transcript levels were determined with reverse-transcription quantitative polymerase chain reaction (RT-qPCR). For qPCR experiments, 50 fly heads were collected atZT6 for each of six biological replicates. RNA was isolatedwith Trizol reagent (Life Technologies, Grand Island, NY)according to the manufacturer’s protocol, with the addition ofan overnight incubation in isopropanol at –208C before a 30-min centrifugation at 13,000g at 48C to precipitate the RNA.RNA pellets were resuspended in nuclease-free water and sub-jected to an RQ1 RNase-Free DNase (Promega, Madison,WI) treatment according the manufacturer’s protocol, followedby a second RNA purification as before. RNA was quantifiedwith an ND-1000 spectrophotometer (NanoDrop Technolo-gies, Wilmington, DE). Complementary DNA was generatedwith the High Capacity cDNA reverse transcription kit(Applied Biosystems, Foster City, CA) and 4 lg of total RNA.The reaction volume was brought to 20 ll total volume withPCR-grade water, and the cDNA synthesis was completedwith the PTC-100 programmable thermal controller (MJResearch, Quebec, Canada) according to the kit’s instructions.Quantitative PCR was carried out with PowerSYBR GreenPCR master mix (Applied Biosystems) and 10 ng cDNA perreaction, with technical duplicates of each sample. All reactionswere performed with the 7900HT Fast Real-Time PCR Sys-tem (Applied Biosystems) and analyzed in the 7900HT softwareScience Detection System 2.4. The primers used were dFabp-AB forward primer ATCATCACCCTGGATGGCAA, reverseprimer ATGGTGAGGGTGGTGATCAG; mFabp7 forwardprimer CCAGCTGGGAGAAGAGTTTG, reverse primer TTTCTTTGCCATCCCACTTC; hAB42 forward primer GCAGAATTCCGACATGACTCA, reverse primer TGCACCTTTGTTTGAACCCA; dGapdh2 forward primer TTTCTCAGCCATCACAGTCG, reverse primer CCGATGCGACCAAATCCATT; actin forward primer ACACACCCATTGCAGACAAA, reverse primer TTCTGAAGGAGCGGAAGTGT;and RPL32 forward primer GCTAAGCTGTCGCACAAATGG, reverse primer GGTGGGCAGCATGTGG. The results

TABLE 1. Drosophila Stocks

St# Genotype Notes Abbreviation

1 w; UAS-Ab42; GeneSwitch-elav-GAL4 GeneSwitch-elav-GAL4 with UAS- Ab42 (for conditional

expression of Ab42 specifically in neurons upon treatment with

RU486)

Ab42; GS-elav

2 w; UAS-Ab42; 1 UAS-Ab42 (control) UAS-Ab42/1

3 w; 1; GeneSwitch-elav-GAL4 GeneSwtich-elav-GAL4 Driver (control) GS-elav/1

4 w (isoCJI); 1; 1 wild type isogenic background strain (also known as 2202U; control) w (isoCJI)

5 w. elav-GAL4; 1; 1 elav-GAL4 Driver (control) elav/Y

6 w, elav-GAL4; UAS- Ab42; 1 elav-GAL4 WITH UAS-Ab42 (for constitutive expression of Ab42

specifically in neurons)

Ab42/1

7 w; UAS- Ab42; hs-dFabp UAS-Ab42 with hs-dFabp (control) UAS-Ab42/1; dFabp/1

8 w, elav-GAL4; 1; hs-dFabp elav-GAL4 with hs-dFabp (control) dFabp/1

9 w, elav-GAL4; UAS- Ab42; hs-dFabp elav-GAL4 with UAS-Ab42 and hs-dFabp (for constitutive expression

of Ab42 specifically in neurons, with dFabp overexpression)

Ab42/1; dFabp/1

10 w, elav-GAL4; UAS-Ab42; hs-mFabp7 elav-GAL4 with UAS-Ab42 and hs-mFabp7 (for constitutive expression

of Ab42 specifically in neurons, with mFabp7 overexpression)

Ab42/1; mFabp7/1

Fabp Rescue of Ab-Disrupted Sleep 3


were normalized against the geometric mean of the mRNAlevels of the three housekeeping genes dGapdh2, actin, andRPL32 to determine the DCt (cycle threshold) values. ForGeneSwitch studies, 50 fly heads were collected at ZT6 foreach of six biological replicates with either 3 or 4 days ofRU486 or vehicle treatment (as described above), and RNAwas prepared and quantified as above.

Western Blotting

For each genotype, 50 fly heads were homogenized inTris-HCl buffer with protease inhibitor cocktail (P2714; Sigma,St. Louis, MO) for 45 sec and centrifuged at 14,000 rpm for 1min. Lysate samples were separated on 12% Tris-HCl 0.75-mmgels and transferred to nitrocellulose membranes (Invitrogen,Carlsbad, CA). The membranes were blocked with 5% nonfatdry milk (Nestl�e, Vevey, Switzerland) and blotted with anti-dFabp antibody (1:1,000), antiactin antibody (1:1,000; Cell Sig-naling Technology, Danvers, MA), and anti-rabbit secondaryantibody IR 680 (1:5,000, Li-Cor Biosciences, Lincoln, NE)according to previously published methods (Gerstner et al.,2011a,b). Each time point had three biological replicates andconsisted of 50 fly heads pooled per time point (n 5 50 3 3biological replicates).

Antibody Characterization

See Table 2 for a list of all antibodies used. The b-actinantiserum recognized only the expected monomeric (45 kD)band on Western blot of Drosophila head lysate. The dFabpantiserum recognized a single band of 14.5-kD molecularweight on Western blot of Drosophila head lysate (Gerstneret al., 2011b).

Statistical Analysis

Statistical significance was determined by a two-tailedStudent’s t-test, and whether equal variance is assumed foreach test is indicated. Unless otherwise indicated, we usedone-way or two-way ANOVA (SigmaPlot 11) and post hoctests (for example, Holm-Sidak to test multiple comparisons).P < 0.05 was considered significant. Flies were excluded fromsleep analysis if they died during the course of the experiment,and, in the figures, when multiple days are present, samplesizes (n) are consistent throughout and are indicated in thelegends.

RESULTS

Short-Term Neuronal Human Ab ExpressionInduces Wakefulness in Drosophila

To test the hypothesis that neuronal Ab expressionincreases wakefulness and disrupts consolidated sleep, weemployed the GS-GAL4 system of Drosophila, whichallows for the spatial and temporal control of transgeneexpression (Osterwalder et al., 2001; Roman et al., 2001;Nicholson et al., 2008). In the presence of the steroidRU486, the upstream activating sequence (UAS) effectorline UAS-Ab42 (Iijima et al., 2004) conditionallyexpresses the human Ab42 via the panneural driver GS-elav-GAL4 (Osterwalder et al., 2001). Previous studieswith a similar model have shown that the GS-elav-GAL4system can induce UAS-driven arctic Ab42 mRNA levelswith 2 days of exposure to RU486 (Rogers et al., 2012)and that the GS-inducible drug does not have any effecton sleep (Vanderheyden et al., 2013). Short-term neuro-nal expression (3 days) of Ab42 in adult w;UAS-Ab42;GS-elav-GAL4(Ab42;GS-elav) flies yielded a signif-icant increase in Ab42 transcript levels but not in w;UAS-Ab42;1(UAS-Ab42/1) or w;1;GS-elav-GAL4 (GS-elav/1) control flies (Fig. 1A). We also observed adecrease in sleep specific to the daytime in Ab42;GS-elavflies following short-term expression of Ab42 (Fig. 2A).The average daytime sleep-bout length and the averagemaximum daytime sleep-bout length were both reducedafter short-term neural Ab42 activation (Fig. 2B,C). Thenumber of daytime bouts was also significantly increasedafter Ab42 neural expression (Fig. 2D), whereas the CI (ameasure of consolidated sleep) was concomitantly reduced(Fig. 2E). No difference was observed in nighttime con-solidation (Fig. 2F). The reduction in daytime sleep wasnot due to increased activity (defined as pixels moved)because daytime movements were unchanged betweenRU486-treated and untreated control flies (Fig. 2G).However, Ab induced a reduction in nighttime activity(Fig. 2H). Total nighttime sleep, average night boutlength, average maximum night bout length, averagenumber of night bouts, and latency to sleep followinglights off were not significantly affected between RU486-treated and untreated flies (data not shown). Analysis ofindividual days of RU486 treatment revealed a progres-sive decrease in average daytime sleep-bout length andaverage maximum daytime bout length (Fig. 3A,B) overthe 3 days of observation. This progressive loss in

TABLE 2. Table of Primary Antibodies Used

Antigen Description of Immunogen Source, Host Species, Cat. #, Clone or Lot#, RRID

Concentration/

Dilution Used

Actin Monoclonal antibody is produced by immunizing

animals with a synthetic peptide corresponding to

residues near the amino-terminus of human b-actin

protein.

Cell Signaling Technology; b-Actin (13E5) Rabbit

mAb #4970

1:1000

dFabp Recombinant Protein corresponding to amino acids 1-

130 of Drosophila dFabp-B

Generated at Cocalico Biologicals Inc., Rabbit (#181);

(Gerstner et al.; 2011b)

1:1000

4 Gerstner et al.


consolidated daytime sleep was not associated with anychanges in daytime activity (Figs. 2G, 3C). However,Ab-induced nighttime activity was reduced on days 1–3(Fig. 3D). These data indicate that Ab expression alonecan modulate daytime sleep and that these effects are notexplained by changes in movement.

Constitutive Neuronal Expression of Human AbDisrupts Both Daytime and Nighttime Sleep inDrosophila

Because we had observed that short-term neuronalexpression of Ab can modulate sleep and that sleep dis-turbance may occur at ages prior to cognitive impairmentsin AD, we next characterized the effect of constitutiveAb expression on sleep in flies. We used a well-established genetic model that had been previously deter-mined to possess the negative effects of Ab-induction,

such as reduced cognitive performance, climbing ability,and survival as well as neurodegeneration (Iijima et al.,2004). We specifically determined whether Ab-inducedsleep disruption might exist at ages prior to the onset oftraditionally established AD phenotypic markers. To dothis, we examined sleep in 2- or 3-day-old male w,elav-GAL4;UAS-Ab42;1(Ab42/1) flies, which expressUAS-Ab42 under control of the constitutive panneuraldriver elav-GAL4, and compared them with controls. Pre-vious work has established that learning impairments notyet observed in 2- or 3-day-old Ab42/1 flies occur later,first appearing in males (but not yet in females) by 6 or 7days of age, with progressive loss in both males andfemales by 14 or 15 days of age (Iijima et al., 2004). Com-pared with 2- or 3-day-old male controls, sleep reductionwas observed in age-matched Ab42/1 male flies (Fig.4A–C,G). This Ab-induced sleep loss in Ab42/1 flieswas accompanied by a reduction in daytime maximalsleep-bout length (Fig. 4E) with a decrease in daytimebout number (Fig. 4F). The average day and night sleep-bout length was not affected in Ab42/1 flies comparedwith w,elav-GAL4;1;1(elav/Y) controls (Fig. 4D,H).Similarly, the average maximal night sleep bout and nightbout counts were not affected in Ab42/1 flies comparedwith w,elav-GAL4;1; 1(elav/Y) controls (Fig. 4I,J). Con-trol UAS-Ab42/1 flies that carry UAS-Ab42 in theabsence of the driver line had more sleep time (24 hr) andmore total nighttime sleep, with no differences in nightbout number, night bout length, maximum night boutlength, or CI compared with w(isoCJ1);1;1(w[isoCJ1])isogenic background strain controls (Fig. 5A–F). Thesedata indicate that constitutive neuronal Ab expressiondecreases total sleep and increases sleep fragmentation andthat these changes in sleep likely precede other pheno-typic markers of AD, including cognitive impairments.

Constitutive Neuronal Ab Expression Effectson dFabp Protein and dFabp mRNA Levels

To determine whether Ab can influence the expres-sion of Fabp, we measured dFabp mRNA levels withRT-qPCR in Ab42 transgenic and control flies. First, weevaluated dFabp expression in Ab42;GS-elav flies withand without RU486. We did not observe any changes indFabp mRNA in Ab42;GS-elav flies compared with con-trol flies (Fig. 1B). Second, we measured levels of dFabpmRNA in Ab42/1 flies and compared them with elav/Yand UAS-Ab42/1 controls, and, again, we did not seedifferences (Fig. 6A). To determine whether Ab42 affectsdFabp at the protein level, we next measured dFabp atfour time points across the light–dark cycle in 2- or 3-day-old male Ab42/1 flies compared with controls byWestern blotting. Flies that express Ab42 appeared tohave a disruption of dFabp protein levels in the light-to-dark transition compared with controls (Fig. 7A). Wethen compared dFabp expression in Ab42/1 flies com-pared with elav/Y controls (Fig. 7B) and found a trend forreduction of dFabp in Ab42/1 flies (P 5 0.054, two-way ANOVA, factors genotype and time). These data

Fig. 1. RU486 induces Ab42 and does not alter dFabp mRNAexpression in w;UAS-Ab42;GS-elav-GAL4 flies. A: Induction ofAb42 mRNA in w;UAS-Ab42;GS-elav-GAL4 (Ab42;GS-elav) fliescompared with w;UAS-Ab42;1 (UAS-Ab42/1) and w;1;GS-elav-GAL4 (GS-elav/1) control flies treated (1) or untreated (–) withRU486 for 3 days assessed by RT-qPCR. B: Induction of dFabpmRNA in Ab42; GS-elav flies compared with UAS-Ab42/1 andGS-elav/1 control flies treated (1) or untreated (–) with RU486 for3 or 4 days assessed by RT-qPCR. Values are mean 6 SEM; n 5 50per replicate, six replicates/genotype. ***P < 0.001, two-tailed Stu-dent’s t-test, equal variance.



indicate that constitutive neuronal Ab expression mayregulate diurnal dFabp protein levels but does not affectdFabp mRNA levels.

Ab-Induced Sleep Loss Is Rescued by Fabps

Previously, we have shown that overexpression ofeither dFabp or mouse brain Fabp (mFabp7) in Drosophilais able to modulate sleep and enhance cognitive perform-ance (Gerstner et al., 2011a,b). Therefore, we next exam-ined whether the Ab42-induced sleep disruption in 2- or3-day-old flies could be rescued by an extra copy of Fabp.We observed that the reduced sleep in Ab42/1 flies

could be rescued in age-matched w,elav-GAL4;UAS-Ab42;hs-dFabp(Ab42/1;dFabp/1) flies over the courseof the day (P < 0.001, two-way ANOVA, factors geno-type and time, post hoc Holm-Sidak; Fig. 4A). We thendetermined the amount of total sleep (24 hr) in Ab42/1flies and found a significant reduction in sleep comparedwith elav/Y and elav-GAL4;1;hs-dFabp(dFabp/1) con-trols, which was rescued by dFabp (P < 0.001, one-wayANOVA, post hoc Holm-Sidak; Fig. 4B). Similar effectswere observed for total sleep during day (Fig. 4C) andnight (Fig. 4G). This dFabp rescue of Ab-induced sleeploss was accompanied by an increase in daytime maximalbout length (Fig. 4E), with nominal effects on other sleep

Fig. 2. Short-term neuronal Ab induction fragments daytime sleep.A–F: Comparison of daytime sleep profile in w;UAS-Ab42;GS-elav-GAL4 (Ab42;GS-elav) flies treated (1) or untreated (–) with RU486averaged across 3 days assessed as minutes of sleep (A–C), number ofbouts (D), consolidation (E) during the 12-hr light period, and consol-idation (F) during the 12-hr dark period. G,H: Comparison of activ-

ity profile in Ab42;GS-elav flies treated (1) or untreated (–) withRU486 averaged across 3 days assessed as pixels moved during thelight period (G) or the dark period (H). Values are mean 6 SEM; n5 14 per group. *P < 0.05, **P < 0.01, ***P < 0.001, two-tailedStudent’s t-test, equal variance (A–G).

6 Gerstner et al.


measures (Fig. 4D,F,H–J). Control w;UAS-Ab42;hs-dFab-p(UAS-Ab42/1;dFabp/1) flies (without the elav-GAL4driver) had less total sleep time (24 hr) compared withUAS-Ab42/1 control flies, with nominal effects on othersleep measures (Fig. 5). Control UAS-Ab42/1 and UAS-Ab42/1;dFabp/1 flies did not exhibit any differences insleep consolidation compared with the w(isoCJ1) isogenicbackground strain (Fig. 5F). Previously, we have shownthat heat-shock induction of dFabp in flies furtheraugments sleep and enhances cognitive performance(Gerstner et al., 2011b). Ab-induced sleep loss that wasobserved in Ab42/1 flies was rescued in Ab42/1;dFabp/1 flies with heat-shock treatment (P < 0.001,

two-way ANOVA, factors genotype and time, post hocHolm-Sidak; Fig. 8). These data suggest that Ab42-induced sleep loss can be rescued by Fabp.

Ab42-Induced Sleep Fragmentation IsRescued by Fabps

Ab induces reductions in total sleep (Fig. 4B) andmaximal sleep-bout length (Fig. 4E), and this suggeststhat constitutive neuronal Ab expression disrupts consoli-dated sleep. Therefore, we examined aspects of sleep frag-mentation in Ab42/1 flies. Examples of individualdiurnal sleep-bout histograms for each genotype showed

Fig. 3. Conditional neuronal expression of Ab induces progressivesleep loss. A–C: Comparison of daytime profile in w;UAS-Ab42;GS-elav-GAL4 (Ab42;GS-elav) flies treated (1) or untreated (–) withRU486 assessed as minutes of sleep (A,B) and pixels moved (C) dur-ing the 12-hr light period across 3 days (d1, d2, d3). D: Comparison

of activity profile in Ab42;GS-elav flies treated (1) or untreated (–)with RU486 assessed as pixels moved during the night period across 3days. Values are mean 6 SEM; n 5 14 per group (P < 0.001, two-way ANOVA, factors day and RU486 treatment, post-hoc Holm-Sidak). *P < 0.05, **P < 0.01, ***P < 0.001.



Fig. 4. Constitutive neuronal Ab42 disrupts sleep and is rescued byFabp overexpression. A,B: Comparison of diurnal sleep profile in 2-or 3-day-old w,elav-GAL4;UAS-Ab42;1 (Ab42/1) flies vs. controlw,elav-GAL4;1;1 (elav/Y) flies, w,elav-GAL4;1;hs-dFabp (dFabp/1)flies, and w,elav-GAL4;UAS-Ab42;hs-dFabp (Ab42/1;dFabp/1) fliesassessed as minutes of sleep during the full 24-hr period. Significancefor each point is shown below the x-axis in A. C–F: Comparison ofdaytime sleep profile in 2- or 3-day-old Ab42/1 flies vs. controlelav/Y, w, dFabp/1 and Ab42/1; dFabp/1 flies assessed as minutes

of sleep (C–E) and number of bouts (F) during the 12-hr light period.G–J: Comparison of nighttime sleep profile in 2- or 3-day-old Ab42/1 flies vs. control elav/Y, w, dFabp/1 and Ab42/1; dFabp/1 fliesassessed as minutes of sleep (G–I) and number of bouts (J) during the12-hr dark period (elav/Y and Ab42/1 n 5 40/group; dFabp/1 n5 36; Ab42/1; dFabp/1 n 5 34). Values are mean 6 SEM (P <0.001 two-way ANOVA, factors genotype and time, post hoc Holm-Sidak [A]; P < 0.001 one-way ANOVA, post hoc Holm-Sidak[B–J]). *P < 0.05, **P < 0.01, ***P < 0.001; n.s., not significant.

8 Gerstner et al.


that timing and length of sleep bouts were altered inAb42/1 flies compared with controls and that the Ab42-induced sleep fragmentation was rescued in Ab42/1;dFabp/1 flies (Fig. 9A–D). We also measured night-time sleep consolidation and observed that Ab42/1 flies

had a reduced CI compared with controls, which was res-cued in Ab42/1;dFabp/1 flies (Fig. 9E).

To determine whether these Ab42-induced effectscan be rescued by the mammalian ortholog, we alsoexamined sleep in Ab42/1 flies carrying a copy of the

Fig. 5. Control w;UAS-Ab42;1 and w;UAS-Ab42;hs-dFabp flies donot exhibit any difference in sleep consolidation compared with w(isoCJ1) isogenic background strain. A–F: Comparison of sleep profilein 2- or 3-day-old isogenic background strain control w (isoCJ1) fliesvs. control w;UAS-Ab42;1 (UAS-Ab42/1) and w;UAS-Ab42;hs-dFabp (UAS-Ab42/1;dFabp/1) flies assessed as minutes of sleep for

the 24-hr period (A), and as minutes of sleep (B–D), number of bouts(E), and CI (F) during the 12-hr dark period. Values are mean 6SEM (w[isoCJ1] n 5 74/group; UAS-Ab42/1 n 5 74; UAS-Ab42/1; dFabp/1 n 5 49). *P < 0.05, **P < 0.01, ***P < 0.001,one-way ANOVA, post hoc Holm-Sidak.



mouse Fabp mFabp7. As with Ab42/1;dFabp/1 flies,we observed an increase in nighttime sleep in w,elav-GAL4;UAS- Ab42;hs-mFabp7(Ab42/1;mFabp7/1) flies(Fig. 10A). This increase in sleep was also accompaniedby an increase in average night sleep-bout length (Fig.10B) and average nighttime maximal bout length (Fig.10C). No change was observed in night bout count (Fig.10D). The sleep CI was also augmented in Ab42/1;mFabp7/1 flies (Fig. 10E). Expression of mFabp7mRNA was only observed in Ab42/1;mFabp7/1 over-expressing flies and was not detected in elav/Y,UAS-Ab42/1, or Ab42/1;dFabp/1 flies (Fig. 6B). Alto-gether, these data indicate that Ab42 induces sleep frag-mentation and that expressing either fly or mammalianFabp7 is sufficient to rescue this effect.

Constitutive Neuronal Expression ofHuman Ab Increases Activity

Because we had previously demonstrated that con-stitutive neuronal Ab expression induces fragmentedsleep, we also tested whether the presence of Ab is associ-ated with changes in locomotor activity. Therefore, weexamined movement in Ab42/1 flies and found thatthere was an increase in pixels moved compared withcontrols (Fig. 11A,B), which was more pronounced atnight (Fig. 11C,D). Rescue of Ab-induced activity wasobserved in Ab42/1;dFabp/1 flies (P < 0.001, two-wayANOVA, factors genotype and time, post hoc Holm-Sidak; Fig. 11A,B). Movement per minute of wakeful-ness, a measure used to indicate differences in hyperactiv-ity, differs from normal activity measures (pixels moved)because it accounts for the amount of activity per unittime spent awake. Hyperactivity did not differ in Ab42/

1 flies compared with controls during the day or thenight (Fig. 11E,F), suggesting that the mechanism forAb-induced activity is at least partially distinct from thatfor Ab-induced sleep disturbance associated withhyperactivity.

DISCUSSION

This study indicates that human Ab disrupts sleep in aDrosophila model of AD. Inducible transgenic neuronalexpression of Ab disrupted daytime consolidated sleep.These data provide evidence suggesting that neuronal Abexpression alone is able to disrupt sustained periods ofsleep prior to long-term accumulation and subsequentaggregation. Constitutive neuronal Ab expression dis-rupted consolidated nighttime sleep and reduced totalsleep time in flies 2 or 3 days posteclosion (or 2- or 3-day-old flies). We were able to rescue this Ab-inducedsleep fragmentation in transgenic flies carrying an addi-tional copy of dFabp. Similar findings were observed intransgenic flies carrying a copy of the mouse brain-typeFabp mFabp7. These findings indicate that Ab alone canperturb consolidated sleep behavior and that Fabp genesrescue Ab-induced sleep fragmentation.

The sleep/wake cycle is a behavior that occursbroadly throughout animal phyla and is an essential prop-erty of normal brain function. Disturbances in sleep acrossmany species, including flies, mice, and humans, havebeen shown to cause cognitive impairment and memorydeficits (Graves et al., 2001; McDermott et al., 2003;Ganguly-Fitzgerald et al., 2006; Abel et al., 2013; Goelet al., 2013). Ab accumulation is also believed to causecognitive deficits across these species (Iijima et al., 2004;Lesne et al., 2006, 2013; Kittelberger et al., 2012). It has

Fig. 6. Expression of dFabp mRNA is normal in w,elav-GAL4;UAS-Ab42;1 flies. A: qPCR results of dFabp mRNA in 2- or 3-day-oldw,elav-GAL4;UAS-Ab42;1 (Ab42/1) fly heads compared withw,elav-GAL4;1;1 (elav/Y) and w;UAS-Ab42;1 (UAS-Ab42/1)control flies. Also shown are w,elav-GAL4;UAS-Ab42;hs-dFabp(Ab42/1;dFabp/1) and w,elav-GAL4;UAS- Ab42;hs-mFabp7 (Ab42/1;mFabp7/1) flies. No significant differences were observed between

groups (one-way ANOVA, n 5 6/group, each group consisted of�50 heads). B: RT-qPCR results of mFabp7 mRNA in the heads of2- or 3-day-old Ab42/1; mFabp7/1 flies compared with elav/Y,UAS-Ab42/1, Ab42/1, and Ab42/1; dFabp/1 flies. Values repre-sent means 6 SEM; n 5 6/group, each group consisted of 50 heads.Significant differences were observed between groups. ***P < 0.001,one-way ANOVA, Holm-Sidak post hoc.

10 Gerstner et al.


been shown that circadian rhythms are affected by neuralexpression of Ab in flies while the molecular clockremains intact (Chen et al., 2014), suggesting that Abmay influence other behaviors, such as sleep. A recentstudy indicated that increases in Ab led to reduced andfragmented sleep in Drosophila (Tabuchi et al., 2015), sim-ilarly to our observations here. Studies on AD mousemodels and AD patients also support a role for Ab-associated sleep/wake perturbations (Vitiello and Borson,2001; Wisor et al., 2005; Zhang et al., 2005; Wu andSwaab, 2007; Jyoti et al., 2010). Whether Ab affects con-solidated sleep at ages prior to the onset of amyloid-associated cognitive decline has remained elusive; how-ever, sleep disturbance may be a preclinical marker ofAD, occurring at ages before cognitive disturbance (Juet al., 2014; Lim et al., 2014). Here we found that short-term expression of Ab disrupted consolidated sleep inflies, although these effects were specific to daytime.Short-term Ab expression reduced daytime sleep consoli-dation (Fig. 2E) but tended to increase nighttime sleepconsolidation (Fig. 2F). This induced expression occurred

on a time scale within days (Fig. 1); therefore, the differ-ences in daytime and nighttime sleep consolidation likelyare from short-term effects of Ab rather than from long-term effects that may include more extracellular accumu-lation. We also provide evidence that long-term expres-sion of Ab is able to disrupt daytime and nighttime sleep(Fig. 4). Flies with constitutive neuronal Ab expressionexhibit loss of both daytime and nighttime sleep at an agethat precedes learning deficits previously reported withthis same model (Iijima et al., 2004). Short-term expres-sion of Ab already disrupts sleep (albeit daytime sleep;Figs. (2 and 3)), whereas long-term Ab expression dis-rupts both daytime and nighttime sleep that is rescued bydFabp and mFabp7 (Figs. (4 and 9), 10), suggesting thatchronic Ab expression generates progressive sleep loss andthat this progressive sleep loss can be rescued by Fabp.This also suggests that disrupted sleep may be prodromalto Ab-associated cognitive decline in AD. It has beenshown that interstitial levels of Ab increase in the brainsof young AD model mice during wakefulness anddecrease during sleep (Roh et al., 2012) even in theabsence of Ab plaques, similarly to wakefulness-associatedlevels of Ab in human CSF fluid (Bateman et al., 2007;Huang et al., 2012). Our results show that short-term Abexpression results in decreased sleep in flies, indicatingthat the Ab peptide can induce wakefulness, albeit only in

Fig. 8. Heat-shock induction of Fabp rescues neuronal Ab42-inducedsleep/wake disruption. Comparison of diurnal sleep profile with heat-shock treatment (5 days at 298C) in w,elav-GAL4;UAS-Ab42;1(Ab42/1) flies vs. control w,elav-GAL4;1;1 (elav/Y), w,elav-GAL4;1;hs-dFabp (dFabp/1), and w,elav-GAL4;UAS-Ab42;hs-dFabp(Ab42/1;dFabp/1) flies assessed as minutes of sleep during the full24-hr period. Significance for each point is shown below the x-axis(elav/Y and Ab42/1 n 5 39/group; dFabp/1 n 5 32; Ab42/1;dFabp/1 n 5 34; P < 0.001 two-way ANOVA, factors genotypeand time, post hoc Holm-Sidak). Values are mean 6 SEM. Open bar,light period; solid bar, dark period.

Fig. 7. Expression of dFabp protein is reduced in w,elav-GAL4;UAS-Ab42;1 flies. Western blots show a trend in reduction of dFabp pro-tein in the heads of 2- or 3-day-old w,elav-GAL4;UAS-Ab42;1(Ab42/1) flies compared with control w,elav-GAL4;1;1 (elav/Y)flies. A: Diurnal Western blots of actin (44 kD) and dFabp (14.5 kD)in elav/Y and Ab42/1 fly heads. B: Average normalized dFabpexpression level shows a trend in reduction in Ab42/1 flies comparedwith elav/Y controls. Values are mean 6 SEM (P 5 0.054 two-wayANOVA, factors for genotype and time). Open bars, light period;solid bars, dark period.



the daytime. On the other hand, our results demonstratethat long-term constitutive neuronal expression of Ab iscapable of disrupting both daytime and nighttime sleep,

suggesting that Ab aggregation may be responsible forperturbing consolidated nighttime sleep, similarly torecent reports (Tabuchi et al., 2015). Our study did notdiscriminate between intracellular and extracellular Abaccumulation over time; however, other studies usingsimilar models have indicated a relationship between Abaccumulation and sleep disruption (Ju et al., 2014; Limet al., 2014). It has been shown that Ab aggregation leadsto dysregulation of the sleep/wake cycle and that sleepdeprivation in turn produces further Ab aggregation(Roh et al., 2012; Tabuchi et al., 2015). Recently, sleephas been shown to facilitate clearance of Ab in mammals(Xie et al., 2013) and to reduce Ab accumulation in flies(Tabuchi et al., 2015). Levels of Ab in human CSF asso-ciated with deposition were also linked to sleep disruptionin preclinical AD (Ju et al., 2013). Altogether, these datasuggest a positive feedback loop among sleep/wakebehavior and Ab levels, metabolism, and aggregation(Gerstner et al., 2012a; Lim et al., 2014). An early disrup-tion in consolidated sleep may accelerate Ab accumula-tion, which would lead to further wakefulness-associatedAb release, aggregation, sleep disruption, and cognitiveloss (Kang et al., 2009; Gerstner et al., 2012a). Future lon-gitudinal studies in animal models and humans arerequired to assess whether such a relationship betweenAD pathology and disruption in sleep/wake states exists.

Previously, we and others have shown changes inthe time-of-day expression of dFabp mRNA in normalflies (Ceriani et al., 2002; Gerstner et al., 2011b) andFabp7 mRNA in mice (Panda et al., 2002; Gerstner et al.,2006, 2008, 2012b). Additionally, we have shown thatflies that overexpress dFabp or mFabp7 have improvedcognitive performance and increased sleep (Gerstneret al., 2011b). We have also reported that the relativenuclear to cytoplasmic ratio of Fabp correlates with spe-cific forms of cognitive performance in flies (Gerstneret al., 2011a). Recently it has been shown that increasingdFabp expression rescues memory deficits in learning andmemory in mutant flies and that sleep reverses memorydefects in a fly Alzheimer’s model (Dissel et al., 2015).Our studies suggest that the Ab-induced nighttime sleepfragmentation can be rescued genetically with additionalcopies of either dFabp or mFabp7. It remains possible thatincreasing Fabp expression may enhance sleep throughcompensatory mechanisms rather than restoring sleepbecause it mitigates the impact of Ab on sleep. Futurestudies determining functional relationships between Fabpexpression and Ab aggregation will be important forunderstanding the relationships among Ab, Fabp, andsleep. Although we used the mFabp7 transgenic fliesbecause of our previous studies (Gerstner et al., 2011a,b),future work using hFabp7 transgenic flies will be impor-tant for determining whether the human Fabp7 orthologcan ameliorate the negative effects of Ab on sleep. Addi-tional studies focused on determining whether reducingFabp expression leads to sleep loss and negatively affectsAb aggregation will also be important to elucidate mech-anisms relating Ab, Fabp, and sleep. Because we cannotrule out possible developmental effects in our model,

Fig. 9. Constitutive neuronal Ab42 fragments sleep and is rescued byFabp overexpression. A–D: Sleep-bout histograms showing four repre-sentative examples of each group by genotype. Solid bars in histogramsare sleep bouts; open spaces are awake. Fragmented sleep in Ab42/1flies is indicated by arrows. E: CI during the ZT12–24-hr dark period in2- or 3-day-old w,elav-GAL4;UAS-Ab42;1 (Ab42/1) flies vs. w,elav-GAL4;1;1 (elav/Y) flies, w,elav-GAL4;1;hs-dFabp (dFabp/1) flies,and w,elav-GAL4;UAS-Ab42;hs-dFabp (Ab42/1;dFabp/1) flies(elav/Y n 5 31; Ab42/1 n 5 32; dFabp/1 n 5 37; Ab42/1; dFabp/1 n 5 26). Values are mean 6 SEM (P < 0.001 one-way ANOVA,post hoc Holm-Sidak). **P < 0.01, ***P < 0.001. Open bars, lightperiod; solid bars, dark period.

12 Gerstner et al.


future studies seeking to determine whether Fabp can alsorescue cognitive deficits, Ab42 aggregation, and reducedlongevity in the inducible Ab42;GS-elav fly model willbe important for understanding Fabp pathways in AD.Previous studies have shown progressive learning impair-ments that first appear in males (but not females) by 6–7days old, with further learning deficits in both genders by14–15 days of age (Iijima et al., 2004). Future studiesexamining whether female flies have a similar delay in theprogression of sleep deficits compared with males andwhether gender differences in Fabp expression exist willbe important for determining how generalizable theeffects of Fabp expression are on Ab-associated sleep dis-ruption. It is also important to note that the model usedin our study does not address other aspects of AD patho-genesis, such as tau pathology. For example, tau mayinfluence sleep in ways that are independent of Ab (DiMeco et al., 2014; Menkes-Caspi et al., 2015). Therefore,although our data suggest a pathway involved in Ab-derived sleep fragmentation, they may not fully capture thecomplex relationship between sleep and AD pathology.

Abnormal Fabp levels in CSF and blood plasmahave recently been shown to be associated with AD(Chiasserini et al., 2010; Ohrfelt et al., 2011; Teunissenet al., 2011; Desikan et al., 2013; Guo et al., 2013;O’Bryant et al., 2013; Olsson et al., 2013;). Although lev-els of Fabp in the CSF were shown to be elevated in ADpatients compared with cognitively normal subjects (Huet al., 2010), levels of Fabp3 within the brains of ADpatients were actually lower (Cheon et al., 2003), inagreement with our results in Drosophila. These data sug-gest an inverse relationship in relative Fabp levels betweenbrain tissue and CSF in AD, in opposition to that

observed for Ab levels in AD. Studies in human AD sup-port an inverse correlation between brain and CSF amy-loid load (Fagan et al., 2006; Forsberg et al., 2008;Grimmer et al., 2009). Alterations in normal Fabp levelsobserved in AD may contribute to AD-associated sleepdisturbances. Although the precise mechanisms responsi-ble for Ab42-induced sleep disruption are not known,our results show that having an extra copy of Fabp canameliorate these sleep deficits. Fabp7 binds the omega-3fatty acid DHA with high affinity (Xu et al., 1996), andDHA-mediated nuclear localization of Fabp7 is thoughtto regulate PPAR transactivity (Mita et al., 2010). Giventhat polyunsaturated fatty acids such as DHA can rescuecognitive decline in AD animal models and have beensuggested to reduce the risk of AD in humans (Calon andCole, 2007; Boudrault et al., 2009), DHA may be operat-ing through Fabp7 nuclear translocation and targeting ofPPAR-mediated transcription. PPAR activation has beenshown to facilitate the clearance of Ab in AD animalmodels (Mandrekar-Colucci et al., 2012; Yamanaka et al.,2012), and, because DHA triggers nuclear localization ofFabp7 to regulate PPAR-mediate transcription (Mitaet al., 2010), this pathway may represent one mechanismrelating Fabp7 with reducing Ab accumulation and con-solidated sleep. DHA is also thought to reduce oxidativestress and inflammation, both of which are associated withAD (Dyall, 2010). One way in which Ab may contributeto neurodegeneration in AD is by inducing oxidativestress through lipid peroxidation in brain cell membranesand increased production of 4-hydroxynonenal (Butter-field and Lauderback, 2002). Fabps have been shown tobe modified by 4-hydroxynonenal (Bennaars-Eiden et al.,2002; Hellberg et al., 2010) and, therefore, may represent

Fig. 10. Murine Fabp7 rescues constitutive neuronal Ab42-inducedsleep loss and fragmentation. A–D: Comparison of night sleep profilein w,elav-GAL4;UAS-Ab42;1 (Ab42/1) flies vs. w,elav-GAL4;UAS-Ab42;hs-mFabp7 (Ab42/1;mFabp7/1) flies assessed as minutes of

sleep (A–C) and number of bouts (D) during the 12-hr dark period.E: CI during the 12-hr dark period (Ab42/1 n 5 31; Ab42/1;mFabp7/1 n 5 25). Values are mean 6 SEM. *P < 0.05, **P <0.01, two-tailed Student’s t-test, equal variance.



one scavenging mechanism to operate as an antioxidantprotein in response to lipid peroxidation generated byAb. Fabp overexpression in flies has been shown toincrease longevity and resistance to oxidative stress (Leeet al., 2012), supporting a role for this concept in the nor-mal aging process. Future work determining whetherFabp expression influences Ab42 clearance mechanismsor oxidative load and whether Ab42 affects Fabp levels ornuclear localization across sleep/wake states will beimportant for evaluating mechanisms associated with sleepdisturbance in AD.

Sleep amount and quality are known to decline withage. This effect is even more pronounced in AD and is amajor contributing factor for institutionalization. Here,

we show that sleep quality is significantly disrupted in aDrosophila AD model at an age that precedes other previ-ously established phenotypic markers. Furthermore, wecan rescue the sleep fragmentation genetically with Fabpoverexpression. These studies implicate Fabp signalingpathways in mediating Ab-induced sleep/wake fragmen-tation and provide further support for Drosophila as amodel organism with which to study the relationshipsamong Ab, sleep/wake behavior, and AD.

ACKNOWLEDGMENTS

The authors thank M. Konsolaki for sharing the flies; C.Davis, K. Iijima, and workers in their laboratory for

Fig. 11. Neuronal expression of Ab42 peptide induces activity. A,B:Comparison of movement profiles in 2- or 3-day-old w,elav-GAL4;UAS-Ab42;1 (Ab42/1) flies vs. control w,elav-GAL4;1;1(elav/Y) flies, w,elav-GAL4;1;hs-dFabp (dFabp/1) flies, and w,elav-GAL4;UAS-Ab42;hs-dFabp (Ab42/1;dFabp/1) flies assessed as pixelsmoved (A,B). C–F: Comparison of movement profiles in 2- or 3-day-old Ab42/1 flies vs. elav/Y, dFabp/1 and Ab42/1; dFabp/1

flies assessed as pixels moved (C,D) and pixels moved per minuteawake (movement/min awake; E,F; elav/Y and Ab42/1 n 5 40/group; dFabp/1 n 5 36; Ab42/1; dFabp/1 n 5 34). Values aremean 6 SEM (P < 0.001 two-way ANOVA, factors genotype andtime, post hoc Holm-Sidak [A,B]; one-way ANOVA, post hocHolm-Sidak [C–F]). *P < 0.05, **P < 0.01.

14 Gerstner et al.


consultation; and M. Lim and K. Singletary for commentson the article.

CONFLICT OF INTEREST STATEMENT

JRG is a coinventor of the U.S. patent application Meth-ods and compositions for improving sleep and memory; US 13/751,213.

ROLE OF AUTHORS

JRG and AIP designed the study. JRG, OL, MTC, andCP performed the experiments. JRG, WMV, and CPanalyzed the data. JRG wrote the article with critical eval-uation from coauthors.

REFERENCES

Abel T, Havekes R, Saletin JM, Walker MP. 2013. Sleep, plasticity, and

memory from molecules to whole-brain networks. Curr Biol 23:R774–

R788.

Bateman RJ, Wen G, Morris JC, Holtzman DM. 2007. Fluctuations of

CSF amyloid-beta levels: implications for a diagnostic and therapeutic

biomarker. Neurology 68:666–669.

Bennaars-Eiden A, Higgins L, Hertzel AV, Kapphahn RJ, Ferrington

DA, Bernlohr DA. 2002. Covalent modification of epithelial fatty acid-

binding protein by 4-hydroxynonenal in vitro and in vivo. Evidence

for a role in antioxidant biology. J Biol Chem 277:50693–50702.

Bilen J, Bonini NM. 2005. Drosophila as a model for human neurodege-

nerative disease. Annu Rev Genet 39:153–171.

Boudrault C, Bazinet RP, Ma DW. 2009. Experimental models and

mechanisms underlying the protective effects of n-3 polyunsaturated

fatty acids in Alzheimer’s disease. J Nutr Biochem 20:1–10.

Bushey D, Hughes KA, Tononi G, Cirelli C. 2010. Sleep, aging, and

lifespan in Drosophila. BMC Neurosci 11:56.

Butterfield DA, Lauderback CM. 2002. Lipid peroxidation and protein

oxidation in Alzheimer’s disease brain: potential causes and consequen-

ces involving amyloid beta-peptide-associated free radical oxidative

stress. Free Radic Biol Med 32:1050–1060.

Calon F, Cole G. 2007. Neuroprotective action of omega-3 polyunsatu-

rated fatty acids against neurodegenerative diseases: evidence from ani-

mal studies. Prostaglandins Leukotr Essent Fatty Acids 77:287–293.

Ceriani MF, Hogenesch JB, Yanovsky M, Panda S, Straume M, Kay SA.

2002. Genome-wide expression analysis in Drosophila reveals genes con-

trolling circadian behavior. J Neurosci 22:9305–9319.

Chen KF, Possidente B, Lomas DA, Crowther DC. 2014. The central

molecular clock is robust in the face of behavioural arrhythmia in a

Drosophila model of Alzheimer’s disease. Dis Model Mech 7:445–458.

Cheon MS, Kim SH, Fountoulakis M, Lubec G. 2003. Heart type fatty

acid binding protein (H-FABP) is decreased in brains of patients with

Down syndrome and Alzheimer’s disease. J Neural Transm Suppl:225–

234.

Chiasserini D, Parnetti L, Andreasson U, Zetterberg H, Giannandrea D,

Calabresi P, Blennow K. 2010. CSF levels of heart fatty acid binding

protein are altered during early phases of Alzheimer’s disease.

J Alzheimers Dis 22:1281–1288.

Cirelli C, Bushey D. 2008. Sleep and wakefulness in Drosophila mela-

nogaster. Ann N Y Acad Sci 1129:323–329.

Desikan RS, Thompson WK, Holland D, Hess CP, Brewer JB,

Zetterberg H, Blennow K, Andreassen OA, McEvoy LK, Hyman BT,

Dale AM. 2013. Heart fatty acid binding protein and Ab-associated

Alzheimer’s neurodegeneration. Mol Neurodegen 8:39.

Di Meco A, Joshi YB, Pratico D. 2014. Sleep deprivation impairs mem-

ory, tau metabolism, and synaptic integrity of a mouse model of Alzhei-

mer’s disease with plaques and tangles. Neurobiol Aging 35:1813–1820.

Dissel S, Angadi V, Kirszenblat L, Suzuki Y, Donlea J, Klose M, Koch

Z, English D, Winsky-Sommerer R, van Swinderen B, Shaw PJ. 2015.

Sleep restores behavioral plasticity to Drosophila mutants. Curr Biol 25:

1270–1281.

Dyall SC. 2010. Amyloid-beta peptide, oxidative stress, and inflammation

in Alzheimer’s disease: potential neuroprotective effects of omega-3

polyunsaturated fatty acids. Int J Alzheimers Dis 2010:10.

Fagan AM, Mintun MA, Mach RH, Lee SY, Dence CS, Shah AR,

LaRossa GN, Spinner ML, Klunk WE, Mathis CA, DeKosky ST,

Morris JC, Holtzman DM. 2006. Inverse relation between in vivo

amyloid imaging load and cerebrospinal fluid Abeta42 in humans. Ann

Neurol 59:512–519.

Finelli A, Kelkar A, Song HJ, Yang H, Konsolaki M. 2004. A model for

studying Alzheimer’s Abeta42-induced toxicity in Drosophila mela-

nogaster. Mol Cell Neurosci 26:365–375.

Forsberg A, Engler H, Almkvist O, Blomquist G, Hagman G, Wall A,

Ringheim A, Langstrom B, Nordberg A. 2008. PET imaging of amy-

loid deposition in patients with mild cognitive impairment. Neurobiol

Aging 29:1456–1465.

Ganguly-Fitzgerald I, Donlea J, Shaw PJ. 2006. Waking experience

affects sleep need in Drosophila. Science 313:1775–1781.

Gerstner JR, Vander Heyden WM, Lavaute TM, Landry CF. 2006. Pro-

files of novel diurnally regulated genes in mouse hypothalamus: expres-

sion analysis of the cysteine and histidine-rich domain-containing, zinc-

binding protein 1, the fatty acid-binding protein 7, and the GTPase,

ras-like family member 11b. Neuroscience 139:1435–1448.

Gerstner JR, Bremer QZ, Vander Heyden WM, Lavaute TM, Yin JC,

Landry CF. 2008. Brain fatty acid binding protein (Fabp7) is diurnally

regulated in astrocytes and hippocampal granule cell precursors in adult

rodent brain. PLoS One 3:e1631.

Gerstner JR, Vanderheyden WM, Shaw PJ, Landry CF, Yin JC. 2011a.

Cytoplasmic to nuclear localization of fatty-acid binding protein corre-

lates with specific forms of long-term memory in Drosophila. Commun

Integr Biol 4:623–626.

Gerstner JR, Vanderheyden WM, Shaw PJ, Landry CF, Yin JC. 2011b.

Fatty-acid binding proteins modulate sleep and enhance long-term

memory consolidation in Drosophila. PLoS One 6:e15890.

Gerstner JR, Perron IJ, Pack AI. 2012a. The nexus of Ab, aging, and

sleep. Sci Transl Med 4:150fs134.

Gerstner JR, Vanderheyden WM, LaVaute T, Westmark CJ, Rouhana L,

Pack AI, Wickens M, Landry CF. 2012b. Time of day regulates subcel-

lular trafficking, tripartite synaptic localization, and polyadenylation of

the astrocytic Fabp7 mRNA. J Neurosci 32:1383–1394.

Goel N, Basner M, Rao H, Dinges DF. 2013. Circadian rhythms, sleep

deprivation, and human performance. Prog Mol Biol Transl Sci 119:

155–190.

Graves L, Pack A, Abel T. 2001. Sleep and memory: a molecular per-

spective. Trends Neurosci 24:237–243.

Grimmer T, Riemenschneider M, Forstl H, Henriksen G, Klunk WE,

Mathis CA, Shiga T, Wester HJ, Kurz A, Drzezga A. 2009. Beta-amy-

loid in Alzheimer’s disease: increased deposition in brain is reflected in

reduced concentration in cerebrospinal fluid. Biol Psychiatry 65:927–

934.

Guo LH, Alexopoulos P, Perneczky R. 2013. Heart-type fatty acid bind-

ing protein and vascular endothelial growth factor: cerebrospinal fluid

biomarker candidates for Alzheimer’s disease. Eur Arch Psychiatry Clin

Neurosci 263:553–560.

Haass C, Selkoe DJ. 2007. Soluble protein oligomers in neurodegenera-

tion: lessons from the Alzheimer’s amyloid-beta peptide. Nat Rev Mol

Cell Biol 8:101–112.

Hellberg K, Grimsrud PA, Kruse AC, Banaszak LJ, Ohlendorf DH,

Bernlohr DA. 2010. X-ray crystallographic analysis of adipocyte fatty

acid binding protein (aP2) modified with 4-hydroxy-2-nonenal. Protein

Sci 19:1480–1489.



Ho KS, Sehgal A. 2005. Drosophila melanogaster: an insect model for fun-

damental studies of sleep. Methods Enzymol 393:772–793.

Holtzman DM, Goate A, Kelly J, Sperling R. 2011a. Mapping the road

forward in Alzheimer’s disease. Sci Transl Med 3:114ps48.

Holtzman DM, Morris JC, Goate AM. 2011b. Alzheimer’s disease: the

challenge of the second century. Sci Transl Med 3:77sr71.

Hu WT, Chen-Plotkin A, Arnold SE, Grossman M, Clark CM, Shaw

LM, Pickering E, Kuhn M, Chen Y, McCluskey L, Elman L,

Karlawish J, Hurtig HI, Siderowf A, Lee VM, Soares H, Trojanowski

JQ. 2010. Novel CSF biomarkers for Alzheimer’s disease and mild cog-

nitive impairment. Acta Neuropathol 119:669–678.

Huang Y, Potter R, Sigurdson W, Santacruz A, Shih S, Ju YE, Kasten

T, Morris JC, Mintun M, Duntley S, Bateman RJ. 2012. Effects of age

and amyloid deposition on Ab dynamics in the human central nervous

system. Arch Neurol 69:51–58.

Iijima K, Liu HP, Chiang AS, Hearn SA, Konsolaki M, Zhong Y. 2004.

Dissecting the pathological effects of human Abeta40 and Abeta42 in

Drosophila: a potential model for Alzheimer’s disease. Proc Natl Acad

Sci U S A 101:6623–6628.

Iijima-Ando K, Iijima K. 2010. Transgenic Drosophila models of Alzhei-

mer’s disease and tauopathies. Brain Struct Funct 214:245–262.

Ju YE, McLeland JS, Toedebusch CD, Xiong C, Fagan AM, Duntley

SP, Morris JC, Holtzman DM. 2013. Sleep quality and preclinical Alz-

heimer disease. JAMA Neurol 70:587–593.

Ju YE, Lucey BP, Holtzman DM. 2014. Sleep and Alzheimer disease

pathology—a bidirectional relationship. Nat Rev Neurol 10:115–119.

Jyoti A, Plano A, Riedel G, Platt B. 2010. EEG, activity, and sleep archi-

tecture in a transgenic AbetaPPswe/PSEN1A246E Alzheimer’s disease

mouse. J Alzheimers Dis 22:873–887.

Kang JE, Lim MM, Bateman RJ, Lee JJ, Smyth LP, Cirrito JR, Fujiki

N, Nishino S, Holtzman DM. 2009. Amyloid-beta dynamics are regu-

lated by orexin and the sleep–wake cycle. Science 326:1005–1007.

Kittelberger KA, Piazza F, Tesco G, Reijmers LG. 2012. Natural

amyloid-beta oligomers acutely impair the formation of a contextual

fear memory in mice. PLoS One 7:e29940.

Koh K, Evans JM, Hendricks JC, Sehgal A. 2006. A Drosophila model for

age-associated changes in sleep:wake cycles. Proc Natl Acad Sci U S A

103:13843–13847.

Koudounas S, Green EW, Clancy D. 2012. Reliability and variability of

sleep and activity as biomarkers of ageing in Drosophila. Biogerontology

13:489–499.

Lee SH, Lee SK, Paik D, Min KJ. 2012. Overexpression of fatty-acid-

beta-oxidation-related genes extends the lifespan of Drosophila mela-

nogaster. Oxid Med Cell Longev 2012:854502.

Lesne S, Koh MT, Kotilinek L, Kayed R, Glabe CG, Yang A, Gallagher

M, Ashe KH. 2006. A specific amyloid-beta protein assembly in the

brain impairs memory. Nature 440:352–357.

Lesne SE, Sherman MA, Grant M, Kuskowski M, Schneider JA, Bennett

DA, Ashe KH. 2013. Brain amyloid-beta oligomers in ageing and Alz-

heimer’s disease. Brain 136:1383–1398.

Liguori C, Romigi A, Nuccetelli M, Zannino S, Sancesario G,

Martorana A, Albanese M, Mercuri NB, Izzi F, Bernardini S, Nitti A,

Sancesario GM, Sica F, Marciani MG, Placidi F. 2014. Orexinergic sys-

tem dysregulation, sleep impairment, and cognitive decline in Alzhei-

mer disease. JAMA Neurol 71:1498–1505.

Lim MM, Gerstner JR, Holtzman DM. 2014. The sleep–wake cycle and

Alzheimer’s disease: what do we know? Neurodegener Dis Manag 4:

351–362.

Lu B, Vogel H. 2009. Drosophila models of neurodegenerative diseases.

Annu Rev Pathol 4:315–342.

Mander BA, Marks SM, Vogel JW, Rao V, Lu B, Saletin JM, Ancoli-

Israel S, Jagust WJ, Walker MP. 2015. b-Amyloid disrupts human

NREM slow waves and related hippocampus-dependent memory con-

solidation. Nat Neurosci 18:1051–1057.

Mandrekar-Colucci S, Karlo JC, Landreth GE. 2012. Mechanisms under-

lying the rapid peroxisome proliferator-activated receptor-gamma-medi-

ated amyloid clearance and reversal of cognitive deficits in a murine

model of Alzheimer’s disease. J Neurosci 32:10117–10128.

McDermott CM, LaHoste GJ, Chen C, Musto A, Bazan NG, Magee JC.

2003. Sleep deprivation causes behavioral, synaptic, and membrane excit-

ability alterations in hippocampal neurons. J Neurosci 23:9687–9695.

Menkes-Caspi N, Yamin HG, Kellner V, Spires-Jones TL, Cohen D,

Stern EA. 2015. Pathological tau disrupts ongoing network activity.

Neuron 85:959–966.

Mita R, Beaulieu MJ, Field C, Godbout R. 2010. Brain fatty acid-

binding protein and omega-3/omega-6 fatty acids: mechanistic insight

into malignant glioma cell migration. J Biol Chem 285:37005–37015.

Nicholson L, Singh GK, Osterwalder T, Roman GW, Davis RL,

Keshishian H. 2008. Spatial and temporal control of gene expression in

Drosophila using the inducible GeneSwitch GAL4 system. I. Screen for

larval nervous system drivers. Genetics 178:215–234.

O’Bryant SE, Xiao G, Edwards M, Devous M, Gupta VB, Martins R,

Zhang F, Barber R. 2013. Biomarkers of Alzheimer’s disease among

Mexican Americans. J Alzheimers Dis 34:841–849.

Ohrfelt A, Andreasson U, Simon A, Zetterberg H, Edman A, Potter W,

Holder D, Devanarayan V, Seeburger J, Smith AD, Blennow K, Wallin

A. 2011. Screening for new biomarkers for subcortical vascular demen-

tia and Alzheimer’s disease. Dement Geriatr Cogn Dis Extra 1:31–42.

Olsson B, Hertze J, Ohlsson M, Nagga K, Hoglund K, Basun H, Annas

P, Lannfelt L, Andreasen N, Minthon L, Zetterberg H, Blennow K,

Hansson O. 2013. Cerebrospinal fluid levels of heart fatty acid binding

protein are elevated prodromally in Alzheimer’s disease and vascular

dementia. J Alzheimers Dis 34:673–679.

Osorio RS, Pirraglia E, Aguera-Ortiz LF, During EH, Sacks H, Ayappa

I, Walsleben J, Mooney A, Hussain A, Glodzik L, Frangione B,

Martinez-Martin P, de Leon MJ. 2011. Greater risk of Alzheimer’s dis-

ease in older adults with insomnia. J Am Geriatr Soc 59:559–562.

Osorio RS, Gumb T, Pirraglia E, Varga AW, Lu SE, Lim J, Wohlleber

ME, Ducca EL, Koushyk V, Glodzik L, Mosconi L, Ayappa I,

Rapoport DM, de Leon MJ. 2015. Sleep-disordered breathing advances

cognitive decline in the elderly. Neurology 84:1964–1971.

Osterwalder T, Yoon KS, White BH, Keshishian H. 2001. A conditional

tissue-specific transgene expression system using inducible GAL4. Proc

Natl Acad Sci U S A 98:12596–12601.

Panda S, Antoch MP, Miller BH, Su AI, Schook AB, Straume M,

Schultz PG, Kay SA, Takahashi JS, Hogenesch JB. 2002. Coordinated

transcription of key pathways in the mouse by the circadian clock. Cell

109:307–320.

Pitman JL, McGill JJ, Keegan KP, Allada R. 2006. A dynamic role for

the mushroom bodies in promoting sleep in Drosophila. Nature 441:

753–756.

Pollak CP, Perlick D. 1991. Sleep problems and institutionalization of

the elderly. J Geriatr Psychiatry Neurol 4:204–210.

Prinz PN, Vitaliano PP, Vitiello MV, Bokan J, Raskind M, Peskind E,

Gerber C. 1982. Sleep, EEG, and mental function changes in senile

dementia of the Alzheimer’s type. Neurobiol Aging 3:361–370.

Rogers I, Kerr F, Martinez P, Hardy J, Lovestone S, Partridge L. 2012.

Ageing increases vulnerability to ab42 toxicity in Drosophila. PLoS One

7:e40569.

Roh JH, Huang Y, Bero AW, Kasten T, Stewart FR, Bateman RJ,

Holtzman DM. 2012. Disruption of the sleep–wake cycle and diurnal

fluctuation of beta-amyloid in mice with Alzheimer’s disease pathology.

Sci Transl Med 4:150ra122.

Roman G, Endo K, Zong L, Davis RL. 2001. P[Switch], a system for

spatial and temporal control of gene expression in Drosophila mela-

nogaster. Proc Natl Acad Sci U S A 98:12602–12607.

Rothman SM, Herdener N, Frankola KA, Mughal MR, Mattson MP.

2013. Chronic mild sleep restriction accentuates contextual memory

16 Gerstner et al.


impairments and accumulations of cortical Ab and pTau in a mouse

model of Alzheimer’s disease. Brain Res 1529:200–208.

Sheline YI, Raichle ME, Snyder AZ, Morris JC, Head D, Wang S,

Mintun MA. 2010. Amyloid plaques disrupt resting state default mode

network connectivity in cognitively normal elderly. Biol Psychiatry 67:

584–587.

Sperling RA, Laviolette PS, O’Keefe K, O’Brien J, Rentz DM,

Pihlajamaki M, Marshall G, Hyman BT, Selkoe DJ, Hedden T,

Buckner RL, Becker JA, Johnson KA. 2009. Amyloid deposition is

associated with impaired default network function in older persons

without dementia. Neuron 63:178–188.

Sperling RA, Aisen PS, Beckett LA, Bennett DA, Craft S, Fagan AM,

Iwatsubo T, Jack CR Jr, Kaye J, Montine TJ, Park DC, Reiman EM,

Rowe CC, Siemers E, Stern Y, Yaffe K, Carrillo MC, Thies B,

Morrison-Bogorad M, Wagster MV, Phelps CH. 2011. Toward defining

the preclinical stages of Alzheimer’s disease: recommendations from the

National Institute on Aging-Alzheimer’s Association workgroups on diag-

nostic guidelines for Alzheimer’s disease. Alzheimers Dement 7:280–292.

Spira AP, Gamaldo AA, An Y, Wu MN, Simonsick EM, Bilgel M,

Zhou Y, Wong DF, Ferrucci L, Resnick SM. 2013. Self-reported sleep

and beta-amyloid deposition in community-dwelling older adults.

JAMA Neurol 70:1537–1543.

Sprecher KE, Bendlin BB, Racine AM, Okonkwo OC, Christian BT,

Koscik RL, Sager MA, Asthana S, Johnson SC, Benca RM. 2015.

Amyloid burden is associated with self-reported sleep in nondemented

late middle-aged adults. Neurobiol Aging 36:2568–2576.

Tabuchi M, Lone SR, Liu S, Liu Q, Zhang J, Spira AP, Wu MN. 2015.

Sleep interacts with ab to modulate intrinsic neuronal excitability. Curr

Biol 25:702–712.

Teunissen CE, Veerhuis R, De Vente J, Verhey FR, Vreeling F, van

Boxtel MP, Glatz JF, Pelsers MA. 2011. Brain-specific fatty acid-

binding protein is elevated in serum of patients with dementia-related

diseases. Eur J Neurol 18:865–871.

Vanderheyden WM, Gerstner JR, Tanenhaus A, Yin JC, Shaw PJ. 2013.

ERK phosphorylation regulates sleep and plasticity in Drosophila. PLoS

One 8:e81554.

Vitiello MV, Borson S. 2001. Sleep disturbances in patients with Alzhei-

mer’s disease: epidemiology, pathophysiology, and treatment. CNS

Drugs 15:777–796.

Weldemichael DA, Grossberg GT. 2010. Circadian rhythm disturbances

in patients with Alzheimer’s disease: a review. Int J Alzheimers Dis

2010.

Wisor JP, Edgar DM, Yesavage J, Ryan HS, McCormick CM, Lapustea

N, Murphy GM Jr. 2005. Sleep and circadian abnormalities in a trans-

genic mouse model of Alzheimer’s disease: a role for cholinergic trans-

mission. Neuroscience 131:375–385.

Wu YH, Swaab DF. 2007. Disturbance and strategies for reactivation of

the circadian rhythm system in aging and Alzheimer’s disease. Sleep

Med 8:623–636.

Xie L, Kang H, Xu Q, Chen MJ, Liao Y, Thiyagarajan M, O’Donnell J,

Christensen DJ, Nicholson C, Iliff JJ, Takano T, Deane R, Nedergaard

M. 2013. Sleep drives metabolite clearance from the adult brain. Sci-

ence 342:373–377.

Xu LZ, Sanchez R, Sali A, Heintz N. 1996. Ligand specificity of brain

lipid-binding protein. J Biol Chem 271:24711–24719.

Yamanaka M, Ishikawa T, Griep A, Axt D, Kummer MP, Heneka MT.

2012. PPARg/RXRa-induced and CD36-mediated microglial

amyloid-b phagocytosis results in cognitive improvement in amyloid

precursor protein/presenilin 1 mice. J Neurosci 32:17321–17331.

Zhang B, Veasey SC, Wood MA, Leng LZ, Kaminski C, Leight S, Abel

T, Lee VM, Trojanowski JQ. 2005. Impaired rapid eye movement

sleep in the Tg2576 APP murine model of Alzheimer’s disease with

injury to pedunculopontine cholinergic neurons. Am J Pathol 167:

1361–1369.

Zimmerman JE, Raizen DM, Maycock MH, Maislin G, Pack AI. 2008.

A video method to study Drosophila sleep. Sleep 31:1587–1598.



Gerstner_et_al-2016-Journal_of_Neuroscience_Research

Documents

Transcript of Gerstner_et_al-2016-Journal_of_Neuroscience_Research