Genomics for Librarians

Stuart M. Brown, Ph.D.Director, Research Computing, NYU School of

Medicine

A Genome Revolution in Biology and Medicine

We are in the midst of a "Golden Era" of biology

The Human Genome Project has produced a huge storehouse of data that will be used to change every aspect of biological research and medicine

The revolution is about treating biology as an information science, not about specific biochemical technologies.

The Human Genome Project

The job of the biologist is changing

– The biologist will spend more time using computers

& on experimental design and data analysis (and less time doing tedious lab biochemistry)

– Biology will become a more quantitative science (think how the periodic table affected chemistry)

As more biological information becomes available and laboratory equipment becomes more automated ...

A review of some basic genetics

DNA

4 bases (G, C, T, A)

base pairs

G--C

T--A

genes

non-coding regions

Decoding Genes

What is Bioinformatics?• The use of information technology to collect,

analyze, and interpret biological data.• An ad hoc collection of computing tools that are

used by molecular biologists to manage research data.– Computational algorithms– Database schema– Statistical methods– Data visualization tools

Genomics What is Genomics?

– An operational definition:• The application of high throughput automated

technologies to molecular biology.

– A philosophical definition:

• A wholistic or systems approach to the study of information flow within a cell.

Genomics make LOTS of data!

Investigators need complex databases just to manage their own experiments

Biologists need to know how to do data mining to answer even simple questions in these huge data sets

Librarians understand the challenges of storage and searching of large amounts of data

New Biology => New Librarians?

How do Genomics and Bioinformatics overlap or interact with Library Science?

1. The NCBI (Natl. Center for Biotechnology Information), the home of GenBank, is part of the National Library of Medicine

2. We store and organize genes like Journal articles - accession number, annotation, etc.

3. A big part of bioinformatics involves keyword searches and SQL queries in relational databases

Bioinformatics is Not Library Science

We are NOT cataloging a set of known information

Programming and complex algorithms - pattern matching, string matching, biostatistics

Data mining and multi-dimensional visualization tools

Uncertainty of the data and constant revision of the “known”– Genes are guesses based on complex algorithms,

not books on the shelf

Raw Genome Data:

>gb|BE588357.1|BE588357 194087 BARC 5BOV Bos taurus cDNA 5'.

Length = 369

Score = 272 bits (137), Expect = 4e-71

Identities = 258/297 (86%), Gaps = 1/297 (0%)

Strand = Plus / Plus

Query: 17 aggatccaacgtcgctccagctgctcttgacgactccacagataccccgaagccatggca 76

|||||||||||||||| | ||| | ||| || ||| | |||| ||||| |||||||||

Sbjct: 1 aggatccaacgtcgctgcggctacccttaaccact-cgcagaccccccgcagccatggcc 59

Query: 77 agcaagggcttgcaggacctgaagcaacaggtggaggggaccgcccaggaagccgtgtca 136

|||||||||||||||||||||||| | || ||||||||| | ||||||||||| ||| ||

Sbjct: 60 agcaagggcttgcaggacctgaagaagcaagtggagggggcggcccaggaagcggtgaca 119

Query: 137 gcggccggagcggcagctcagcaagtggtggaccaggccacagaggcggggcagaaagcc 196

|||||||| | || | ||||||||||||||| ||||||||||| || ||||||||||||

Sbjct: 120 tcggccggaacagcggttcagcaagtggtggatcaggccacagaagcagggcagaaagcc 179

Query: 197 atggaccagctggccaagaccacccaggaaaccatcgacaagactgctaaccaggcctct 256

||||||||| | |||||||| |||||||||||||||||| ||||||||||||||||||||

Sbjct: 180 atggaccaggttgccaagactacccaggaaaccatcgaccagactgctaaccaggcctct 239

Query: 257 gacaccttctctgggattgggaaaaaattcggcctcctgaaatgacagcagggagac 313

|| || ||||| || ||||||||||| | |||||||||||||||||| ||||||||

Sbjct: 240 gagactttctcgggttttgggaaaaaacttggcctcctgaaatgacagaagggagac 296

BLAST Similarity Search

Multiple Alignment

Protein domains (Pattern analysis)

Clustering (Phylogenetics)

UCSC

The Challenge of New Data Types (Genomics)

• Gene expression microarrays– thousands of genes, imprecise measurements

– huge images, private file formats

• Proteomics– high-throughput Mass Spec

– protein chips: protein-protein interactions

• Genotyping– thousands of alleles, thousands of individuals

• Regulatory Networks

Biological Information

Microarray Technology

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Spot your own Chip (plans available for free from Pat Brown’s website)

Robot spotter

Ordinary glass microscope slide

cDNA spotted microarrays

Goal of Microarray experiments

Microarrays are a very good way of identifying a bunch of genes involved in a disease process– Differences between cancer and normal tissue– Tuberculosis infected vs resistant lung cells

Mapping out a pathway – Co-regulated genes

Finding function for unknown genes– Involved these processes

Proteomics

Identify all of the proteins in an organism– Potentially many more than genes due to

alternative splicing and post-translational modifications

Quantitate in different cell types and in response to metabolic/environmental factors

Protein-protein interactions

Yeast ProteomeJeong H, Mason SP, A.-L Barabasi

Nature 411 (2001) 40-41

Human Genetic Variation Every human has essentially the same set of genes But there are different forms of each gene -- known as alleles

– blue vs. brown eyes

– genetic diseases such as cystic fibrosis or Huntington’s disease are caused by dysfunctional alleles

Alleles are created by mutations in the DNA sequence of one person - which are passed on to their descendants

High-Throughput Genotyping

Relate genes to Organisms

Diseases– OMIM: Human Genetic Disease

Metabolic and regulatory pathways– KEGG

– Cancer Genome Project

Human Alleles The OMIM (Online Mendelian Inheritance

in Man) database at the NCBI tracks all human mutations with known phenotypes.

It contains a total of about 2,000 genetic diseases [and another ~11,000 genetic loci with known phenotypes - but not necessarily known gene sequences]

It is designed for use by physicians:– can search by disease name– contains summaries from clinical studies

Training "computer savvy" scientists

Know the right tool for the job

Get the job done with tools available

Network connection is the lifeline of the scientist

Jobs change, computers change, projects change, scientists need to be adaptable

Why teach genomics in undergraduate (or Medical) education?

Demand for trained graduates from the biomedical industry

Bioinformatics is essential to understand current developments in all fields of biology

We need to educate an entire new generation of scientists, health care workers, etc.

Use bioinformatics to enhance the teaching of other subjects: genetics, evolution, biochemistry

Genomics in Medical Education

“The explosion of information about the new genetics will create a huge problem in health education. Most physicians in practice have had not a single hour of education in genetics and are going to be severely challenged to pick up this new technology and run with it."

Francis Collins

Long Term Implications

A "periodic table for biology" will lead to an explosion of research and discoveries - we will finally have the tools to start making systematic analyses of biological processes (quantitative biology).

Understanding the genome will lead to the ability to change it - to modify the characteristics of organisms and people in a wide variety of ways

Stuart M. Brown, Ph.D.stuart.brown@med.nyu.edu

www.med.nyu/rcr

Bioinformatics: A Biologist's Guide to Biocomputing and the Internet

Essentials of Medical Genomics

www.GenomicsHelp.com