GENOMES & THEIR EVOLUTION

Campbell & Reece Chapter 21

Genomics

study of a specie’s whole set of genes & their interactions

bioinformatics: use of computers, software, & mathematical modes to process & integrate biological informationfrom large data sets

Human Genome Project

sequencing the human genome 1990 – 2003 20 large centers in 6 countries +

many other small labs working on small parts of it

FISH

Cytogenetic Map: chromosome banding pattern & location of specific genes by flourescence in situ hybridization (FISH)

b/4 Human Genome Project the # of chromosomes & their banding patterns known for many species

some human genes already located

FISH

method in which flourescently labeled nucleic acid probes allowed to hybridize to immobilized array of whole chromosomes

maps generated from this used as starting point

3 Stages to Genome Sequencing

1. Linkage Mapping2. Physical Mapping3. DNA Sequencing

Linkage Mapping

ordering of genetic markers (1000’s) spaced thru-out chromosomes order & spacing determined by

recombinant frequencies markers: genes, RFLPs, (restriction

fragment length polymorphism) or STRs (short tandem repeats)

RFLP

in gel electrophoresis, fragments of DNA are separated by length (-) charge of phosphate groups moves

DNA thru gel (acting like a sieve) toward (+) end

resulting in: bands that each consist of thousands of DNA molecules of same length

RFLP

1 useful technique has been to apply restriction fragment analysis to these bands information about DNA sequences

restriction enzymes “cut” DNA at known nucleotide sequences then these fragments produced are put thru gel electrophoresis

RFLP

DNA can be recovered undamaged from gel bands (so can be used to prepare pure sample of individual fragments)

can be used to compare 2 different DNA molecules (2 alleles of same gene) if nucleotide sequence affects a restriction site: change in even 1 nucleotide will prevent the “cut”

RFLP (restriction fragment length polymorphism)

polymorphisms: variations in DNA sequence among a population

this particular type of sequence change is called RFLP (“rif-lip”)

if 1 allele contains a RFLP, digestion with the enzyme will produce a fragment of different length

Short Tandem Repeats: STR

technique used by forensic scientists

are tandemly repeated units of 2 to 5 base sequences in specific regions of the genome

# repeats present is highly variable person to person (polymorphic)

1 individual’s may vary if has 2 alleles

STR

PCR (polymerase chain react is used to amplify particular STRs

quicker technique than RFLP analysis

can be used with less pure samples of DNA or if only have minute sample

PCR

3 Stages to Genome Sequencing

1. Linkage Mapping2. Physical Mapping3. DNA Sequencing

Physical Mapping

ordering of large fragments cloned in YAC & BAC vectors

followed by ordering of smaller fragments cloned in phage & plasmid vectors

key is to make overlapping fragments & then use probes or automated nucleotide sequencing of ends to find the overlaps

YAC & BAC

1st cloning vector

carries inserted fragments million base pairs (bp) long

carries inserts of 100,000 – 300,000 bp

Yeast Artificial Chromosome

Bacterial Artificial Chromosome

Physical Mapping

fragments from YAC & BAC put in order

each fragment cut into smaller pieces

which are then cloned in plasmids, ordered, & finally sequenced

DNA Sequencing

determination of nucleotide sequence of each small fragment & assembly of the partial sequences into the complete genome sequence

for human genome used sequence machines

sequencing of all 3 billion bps in haploid set of human chromosomes done at rate 1,000 bp/s

Human Genome Project

took 13 yrs $100 million

Sequencing an Entire Genome

Whole-Genome Shotgun Approach

essentially skips the linkage mapping & physical mapping stages & starts with sequencing of DNA fragments from randomly cut DNA

computers then assemble the resulting very large # of short sequences into a single continuous sequence

Shotgun Approach

Application of Systems Biology to Medicine

2007 – 2010 set out to find all the common mutations in 3 types of cancer (lung, ovarian, glioblastoma) by comparing gene sequences & patterns of gene expression in cancer cells compared to normal cells

Cancer Genes

# genes identified that had been suspect + genes that were not suspected

gives researchers point to develop new treatments aimed specifically @ these genes

10 more cancers then studied (most common/most lethal)

Microarray Chip

Genomes Vary in Size, # of Genes, & Gene Density

# of Genes

Prokaryotic cells < Eukaryotic cells Humans: expected 50,000 – 100,000

but have found < 30,000 How do we get by with not many

more genes than nematodes? # proteins we have > # genes vertebrates use alternative splicing of

RNA transcripts

Gene Density

# genes in given length of DNA eukaryotes generally have larger

genomes but fewer genes in given # of bps

humans have 100’s – 1000’s times more bps but only 5 – 15 times as many genes

Sooooo: gene density lower in humans than in bacteria

Noncoding DNA

includes most of eukaryotic DNA introns most is noncoding DNA between genes

1.5% of our genome codes for proteins, or is transcribed into rRNA or tRNA

Pseudogenes

former genes that have accumulated over a long time & no longer produce functional proteins

Repetitive DNA

sequences that are present in multiple copies in the genome

75% of this repetitive DNA (44% of entire genome) is made up of units called transposable elements & related sequences

Transposable Elements & Related Sequences

found in both prokaryotes & eukaryotes

stretches of DNA that can move from one location to another w/in the genome

transposition: process where 1 transposable element moves from 1 site to different target site by a type of recombination process

“Jumping” Genes

Transposons

Gene that is “jumping” never actually completely detach from the cell’s DNA

original and new strands brought together by enzymes & other proteins that bind to DNA

1st evidence came from studying genetics of Indian corn

Movement of Transposons & Retrotransposons

2 types of eukaryotic transposons:1. Transposons

move w/in genome by means of DNA intermediate

move & paste or cut & paste both require enzyme transposase

(encoded by transposon)

Retrotransposon

2nd type of eukaryotic transposable element

move by means of RNA intermediate that is a transcript of retrotransposon DNA

always leave copy @ original site during transposition

RNA intermediate is converted back to DNA by reverse transcriptase (enzyme encoded by retrotransposon)

Other Repeating DNA

probably arises due to mistakes made during DNA replication or recombination

~14% human DNA ~1/3 of this duplications of long

stretches of DNA segments copied from 1 chromosomal

location to another on same or different chromosome

Simple Sequence DNA

Contains many copies of tandemly repeated short sequences: ATTGCGATTGCGATTGCGATTGCG repeated units can be 2 – 500

nucleotides

Short Tandem Repeat (STR)

repeating units that are 2 to 5 nucleotides long

found on telomeres & centromeres (so may play structural role)

# of repeating units can vary w/in same genome and with different alleles

this diversity means STR’s can be used in preparing genetic profiles

Other Types of DNA

1.5% of genome: genes that code for proteins, rRNA, tRNA

include introns & regulatory sequences associated with genes total amt is 25% of the human genome

Multigene Families

<1/2 genes present in 1 copy multigene families: collections of 2

or more identical or very similar genes

some identical present in tandem, repeats code for an RNA or histone proteins

rRNA genes

repeated tandemly 100’s to 1000’s times in 1 to several clusters in genomes of multicellular eukaryotes

helps cells quickly make millions of ribosomes necessary for protein synthesis

Multigene Families of Nonidentical Genes

Globins: group of proteins that include the α and β polypeptide subunits of hgb

Chromosome 16 encodes for forms of α-globin

Chromosome 11, encodes for β-globin different forms are expressed @

different times in development allowing hgb to function effectively in changing environment of developing animal

Fetal-Globin

in fetal stage use this globin because it had higher affinity for O2 ensuring the efficient transfer of O2 from mother

Clues to Evolution

by looking at arrangement of genes in gene families get insight into evolution of genomes

genome w/4gene families in 4 species

Genome Evolution

“accidents” in cell division can lead to extra copies of all or parts of a chromosome which can then diverge if 1 set accumulates nucleotide sequence changes

Genome Evolution

compare chromosomal organization of genomes among species info about evolutionary relationships

w/in given species rearrangements of genes thought to contribute to emergence of new species

Globin Gene

1 common ancestral globin gene duplicated & diverged into α and β globin ancestral genes

subsequent duplication & random mutation present day globin genes

all genes along the way code for O2 -binding proteins

Globin Genes

some copies of the duplicated globin genes have diverged so much that their functions are now substantially different examples: lysozyme: enzyme that destroys

bacterial cell walls in mammals, found in sweat, tears, & saliva

α-lactalbumin: protein found in milk, contains all a.a.

Gene Evolution

rearrangement of exons w/in & between genes during evolution genes containing multiple copies of similar exons&/or several different exons derived from other genes

Gene Evolution

movement of transposable elements or recombination between copies of same element occasionally creates new sequence combinations that are beneficial to the organism

new combinations can alter function of genes or their patterns of expression & regulation

Comparing Genome Sequences

human & chimpanzee sequences show ~4% differences

most due to: insertions deletions

duplications

4%

FOXP2 Gene

gene that affects speech

human & chimp have nucleotide sequence variations

SNPs & CNVs

Single Nucleotide Polymorphisms Copy Number Variations variations of both w/in a species can

yield information about the evolution of that species

Evo-Devo Biologists

Evolutionary Developmental biologists have show that homeotic genes (any of the master regulatory genes that control placement & spatial organization of body parts in animals) & other genes associated with animal development contain a:

homeobox region has sequence that is highly

conserved among diverse species (animals, plants, yeast)

Homeobox Genes in Fruit Fly & Mouse

Hox Genes

genes or groups of genes that are responsible for the lay out of basic body forms

set up the head-to-tail organization are general purpose (work in many

animal phylums) small changes in them or the genes

that control them would lead to major source of evolutionary change

Changes in Expression of Hox Genes have changed over evolutionary time

Comparisons of Animal & Plant Development

last common ancestor of plants & animals probably a unicellular eukaryote (100s of millions of years ago)

morphogenesis in plants relies on differing planes of cell division & on selective cell enlargement

Comparing Development in Plants & Animals

development relies on a cascade of transcriptional regulators turning genes on/off

Plants do not use Hox genes, they have another group of genes (Mads-box)

can find Hox genes in plants & Mads-box genes in animals but in neither case do they have same major role in development