Genome-Scale CRISPR Screening Identifies Novel Human ...6 114 RESULTS 115 iCas9 system is a...
Transcript of Genome-Scale CRISPR Screening Identifies Novel Human ...6 114 RESULTS 115 iCas9 system is a...
-
1
Genome-Scale CRISPR Screening Identifies Novel Human Pluripotent Gene 1
Networks 2
3
Robert J. Ihry1, Max R. Salick1, Daniel J. Ho1, Marie Sondey1, Sravya Kommineni1, Steven 4
Paula2, Joe Raymond1, Elizabeth Frias2, Kathleen A. Worringer1, Carsten Russ2, John Reece-5
Hoyes2, Bob Altshuler1, Ranjit Randhawa1, Zinger Yang2, Gregory McAllister2, Gregory R. 6
Hoffman2, Ricardo Dolmetsch1, and Ajamete Kaykas1. 7
8 1Department of Neuroscience, 2Department of Chemical Biology and Therapeutics, Novartis 9
Institutes for Biomedical Research, Cambridge, MA 02139, USA 10
11
Corresponding author: Ajamete Kaykas ([email protected]) 12
13
ABSTRACT 14
15
Human pluripotent stem cells (hPSCs) generate a wide variety of disease-relevant cells that can 16
be used to improve the translation of preclinical research. Despite the potential of hPSCs, their 17
use for genetic screening has been limited because of technical challenges. We developed a 18
renewable Cas9/sgRNA-hPSC library where loss-of-function mutations can be induced at will. 19
Our inducible-mutant hPSC library can be used for an unlimited number of genome-wide 20
screens. We screened for novel genes involved in 3 of the fundamental properties of hPSCs: 21
Their ability to self-renew/survive, their capacity to differentiate into somatic cells, and their 22
inability to survive as single-cell clones. We identified a plethora of novel genes with unidentified 23
roles in hPSCs. These results are available as a resource for the community to increase the 24
understanding of both human development and genetics. In the future, our stem cell library 25
approach will be a powerful tool to identify disease-modifying genes. 26
27
VISUAL ABSTRACT 28
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
2
30 IN BRIEF 31
Ihry et al. develop a stable CRISPR/Cas9 genetic screening platform tailored for use in hPSCs32
that enables unbiased genome-scale genetic screening. The platform exhibits high performance33
at genome-scale and accurately detects the dropout of core essential genes. Furthermore,34
proof-of-concept screens exploited hPSC-specific phenotypes to identify regulators of fitness,35
survival after single-cell dissociation, and pluripotency. 36
HIGHLIGHTS 37
� A universal and scalable genetic platform in hPSCs for general use across all lineages 38
� Robust knockout efficiencies translate into high performance screening at genome-scale 39
� Identified stem cell-specific components of TP53 and OCT4 genetic networks in hPSCs 40
� Phenotypic screen identifies novel actin/myosin genes regulating membrane blebbing 41
� Identified novel gene sets regulating pluripotency and discovered the roles of PMAIP1 42
and PAWR in sensitivity to DNA damage and single-cell dissociation 43
2
s
ce
re,
,
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
3
INTRODUCTION 44
Human pluripotent stem cells (hPSCs) can be used to generate a wide variety of disease 45
relevant cell types and have the potential to improve the translation of preclinical research by 46
enhancing disease models. Despite the huge potential, genetic screening using hPSCs has 47
been limited by their expensive and tedious cell culture requirements (Chen et al., 2011), and 48
reduced genetic manipulation efficiencies (Ihry et al., 2018). Only a few shRNA screens have 49
been conducted in hPSCs (Chia et al., 2010; Zhang et al., 2013), however shRNAs have a high 50
level of off targets and do not cause a complete loss of function, which is difficult to interpret 51
(DasGupta et al., 2005; Echeverri et al., 2006; Kampmann et al., 2015; McDonald et al., 2017). 52
Currently, the CRISPR/Cas9 system is the genetic screening tool of choice because it can 53
efficiently cause loss-of-function alleles (Cong et al., 2013; Jinek et al., 2012; Mali et al., 2013). 54
Hundreds of genome-scale pooled CRISPR screens have been performed in immortalized 55
human cell lines (Hart et al., 2015; Meyers et al., 2017; Wang et al., 2015). However, in hPSCs 56
the CRISPR/Cas9 system has been primarily used for small-scale genome engineering (Merkle 57
et al., 2015). In genetically intact hPSCs the only genome-scale CRISPR screen to date used 58
methods developed for cancer cells, suffered from technical issues, had poor performance, and 59
identified few developmentally relevant genes (Hart et al., 2014; Shalem et al., 2014). We 60
addressed these technical issues by systematically tailoring the CRISPR/Cas9 system for 61
hPSCs (Ihry et al., 2018). We developed a doxycycline (dox) inducible Cas9 (iCas9) hPSC line 62
and stably infected it with a genome-scale sgRNA library. We banked and expanded the 63
CRISPR-infected hPSC library in the absence of editing (-dox), which enabled us to generate a 64
renewable stem cell pool with stable but inactive sgRNAs. This allowed us to conduct multiple 65
independent screens with the same cell library. 66
In the first screen, we identified genes that suppress or enhance hPSC fitness over long-67
term culture. While previous screens have generated gold standard gene lists of core essential 68
genes that reduce cell survival when mutated, little is known about the mutations that enhance 69
survival and proliferation. Unlike core essential genes, these enhancing mutations appear to be 70
cell type-specific and no consistent lists exist for this type of gene (Hart et al., 2014). In hPSCs 71
karyotypic analysis has detected recurrent copy number variations (CNVs) that confer a growth 72
advantage (Amps et al., 2011; Laurent et al., 2011); however, these studies lack gene level 73
resolution. Recently, next-generation sequencing of hundreds of hPSCs identified the 74
recurrence of dominant-negative TP53 mutations that can expand within a population of hPSCs 75
(Merkle et al., 2017). We mined our data for gene knockouts that enriched in culture and 76
identified many genes, including components of the TP53 pathway and other known tumor 77
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
4
suppressors. We validated the strongest hit, PMAIP1/NOXA, which appears to be a stem cell-78
specific gene conferring sensitivity to DNA damage downstream of TP53. 79
In the second screen, we identified genes required for single-cell cloning. hPSCs have a 80
poor survival rate after dissociation to single-cells, which is detrimental for genome engineering. 81
Multiple groups have extensively characterized death induced by single-cell cloning and have 82
demonstrated the process is similar to but distinct from anoikis and is triggered by a 83
ROCK/Myosin/Actin pathway (Chen et al., 2010; Ohgushi et al., 2010). To prevent death, 84
hPSCs are passaged as clumps or treated with ROCK inhibitors (Watanabe et al., 2007). By 85
subjecting our hPSC mutant library to single-cell dissociation without ROCK inhibitors, we 86
selected for mutations that survive single-cell cloning. sgRNAs for the ROCK and myosin 87
pathways were enriched in the surviving clones. The most enriched gene was the pro-apoptotic 88
regulator PAWR (Burikhanov et al., 2009). Validation studies confirmed a novel role for PAWR 89
as a component of the actin-cytoskeleton that induces membrane blebbing and cell death 90
caused by single-cell cloning. The additional novel genes identified here will further our 91
understanding about the sensitivity of hPSCs to single-cell cloning. 92
In the final screen, we utilized a FACS-based OCT4 assay to identify regulators of 93
pluripotency and differentiation. Pluripotency is a defining feature of hPSCs and it allows them 94
to differentiate into all three germ layers. OCT4/POU5F1, NANOG and SOX2 are critical 95
transcription factors that maintain pluripotency in vivo and in vitro (Chambers et al., 2007; Masui 96
et al., 2007; Nichols et al., 1998). OCT4 and SOX2 overexpression is commonly used to 97
reprogram somatic cells towards the pluripotent state (Takahashi and Yamanaka, 2006; 98
Takahashi et al., 2007; Yu et al., 2007). By isolating mutant cells with high or low OCT4 protein 99
expression we identified many genes involved in maintaining the pluripotent state along with 100
genes involved with induction of differentiation. Overall these lists of genes provide unique 101
insights into the genetic regulation of human development that could only be identified in normal 102
diploid cells that are not transformed or cancerous. 103
By using a doxycycline inducible Cas9 (iCas9) hPSC line stably infected with a genome-104
scale lentiCRISPR library, we were able to bank a CRISPR-hPSC library that was renewable 105
and enabled a high number of independent screens with the same starting library. This allows 106
direct comparison between screens and reduces screen to screen variability. We rigorously 107
tested the system and identified genes important for fitness, pluripotency, and single-cell cloning 108
of hPSCs. Herein we provide a resource with detailed methods and all available data including 109
many novel genes that are involved in hPSC biology. This resource will serve as a parts list of 110
genes that are functionally important for the human stem cell state. Furthermore, the gene sets 111
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
5
and methods will increase our systematic knowledge of human pluripotent stem cell biology and 112
will enable additional large-scale CRISPR screens in stem cells and their somatic derivatives. 113
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
6
RESULTS 114
iCas9 system is a self-renewing resource enabling successive genome-wide genetic 115
screens in hPSCs 116
We set out to develop a high-throughput CRISPR/Cas9 platform for hPSCs which would 117
enable successive rounds of screening from a stable library of lentiCRISPR-infected hPSCs 118
(Fig. 1A, S1). Generating a genome-scale lentiCRISPR hPSC library would enable both the 119
rigorous testing of CRISPR screen performance and the identification of cell type-specific 120
regulators of the pluripotent state. In our previous work, we developed an all-in-one doxycycline 121
(dox) inducible Cas9 (iCas9) transgene that was inactive in the absence of dox (Ihry et al., 122
2018). The tight control over Cas9 expression allowed us to transduce cells with lentiviruses 123
expressing sgRNAs (lentiCRISPRs) in the absence of dox without causing on-target indels. We 124
tested if it was possible to bank a genome-scale lentiCRISPR infected cell library (5 sgRNAs per 125
gene, 110,000 total sgRNAs) prior to Cas9 mutagenesis (- dox). After one freeze-thaw cycle, 126
NGS analysis revealed no bottlenecking of the library demonstrating the feasibility of banking a 127
large lentiCRISPR hPSC library for repeated screens (Fig. 1B). 128
Evaluating the performance of CRISPR screening in iCas9 hPSCs 129
Next, we performed a fitness screen to evaluate the global performance of the system 130
(Fig. 1C). We benchmarked the performance of the screen by utilizing annotated lists of core 131
essential genes. Core essential genes are required for the survival of all cells; the 132
corresponding CRISPR knockout causes the sgRNAs to be depleted (Hart et al., 2014, 2015). 133
Genome-scale CRISPR screening in hPSCs has been challenging (Hart et al., 2014; Shalem et 134
al., 2014). hPSCs have a strong DNA damage response (DDR) and Cas9-induced double 135
strand breaks (DSBs) cause a significant cell loss (Ihry et al., 2018). Failure to account for 136
Cas9-induced cell loss is problematic for pooled screening because it is critical to maintain 137
representation of each sgRNA-barcoded cell. Our previous work demonstrated a range of 138
Cas9-induced cells loss between 3 to 10-fold across many sgRNAs (Ihry et al., 2018). To 139
prevent bottlenecking of the sgRNA library we conducted the screen in hPSCs at an average of 140
1000 cells per sgRNA (a total of 110 million infected cells). By doing this we maintained about 4-141
fold more cells than a typical cancer screen (Hart et al., 2015). During the fitness screen, DNA 142
was sampled before and after dox exposure at days 0, 8, 14, and 18 (Fig. S1). To provide a 143
qualitative measurement of screen performance, we plotted the p-values calculated by the 144
redundant siRNA activity (RSA) test against Q1 based z-scores for a set of core essential and 145
non-essential genes (Hart et al., 2014; König et al., 2007). Before dox treatment the non-146
essential and core essential genes are randomly distributed within a tight cluster (Fig. 1D). After 147
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
7
18 days of Cas9 treatment the distribution spreads and the essential genes significantly dropout 148
while the non-essential genes remain constant (Fig. 1D, File S1-2). 149
To quantify performance, we employed the Bayesian Analysis of Gene EssentiaLity 150
(BAGEL) algorithm which calculates a Bayes factor for each gene by determining the probability 151
that the observed fold change for a given gene matches that of known essential genes (Hart 152
and Moffat, 2016).This generates a ranked list of Bayes factors for each gene, which can then 153
be used to quantify screen performance by precision versus recall analysis. In a high-154
performance screen, essential genes have high Bayes factor scores and the precision versus 155
recall curve gradually drops off as analysis of the ranked list is completed. In contrast, a poor 156
performing screen has a precision versus recall curve that rapidly drops off, indicating many 157
false positives (non-essential genes) with high Bayes factor scores. The sample without dox 158
exposure (untreated) has a randomly ranked Bayes factor list with non-essential and essential 159
genes interspersed and exhibits a poor precision versus recall curve (Fig. 1E). In the day 18 160
Cas9 (+dox) treated samples, essential genes and non-essential genes segregate from each 161
other and generates a high-performing precision versus recall curve that gradually drops off 162
(Fig. 1E, File S3). 163
After 18 days of Cas9 exposure, we identified 770 fitness genes at a 5% false discovery 164
rate based on of the precision calculation (Fig. 1F, File S4). Comparing the set of 770 hPSC 165
fitness genes to 1580 core essential genes from cancer lines revealed an overlap of 405 genes 166
(Fig. 1G) (Hart et al., 2015). The remaining 365 specifically dropped out in hPSCs. Both the 167
core and hPSC-specific essential genes are abundantly expressed in hPSCs, further supporting 168
that they are required to maintain hPSCs in culture (Fig. 1H). Our fitness screen in hPSCs 169
correctly identifies the dropout of core-essential genes with accuracy that is on par with CRISPR 170
screens conducted in cancer cell lines. This demonstrates that cancer cells and stem cells 171
share a common set of core essential genes that can be used to benchmark performance. By 172
properly accounting for cell loss caused by Cas9 activity, we have overcome a significant 173
technical barrier that has thwarted previous attempts at genome-scale screening in hPSCs (Hart 174
et al., 2014; Shalem et al., 2014). This demonstrates it is possible to conduct an effective 175
genome-scale CRISPR screen in hPSCs using the methods described here. 176
TP53 pathway mutations specifically enrich during CRISPR fitness screen in hPSCs 177
Curated lists of genes that enhance fitness during a CRISPR screen do not exist, 178
making it difficult to benchmark the enrichment results (Hart et. al., 2015). By comparing the top 179
~1000 depleted (RSA-down< -2.25, Files S2) and enriched (RSA-up < -2.25, File S5) genes we 180
observed that 31.8% (301 of 946) of the enriched genes were located on the X and Y 181
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
8
chromosomes (H1-hESCs XY, Fig. S3). In contrast, the depleted genes were evenly distributed 182
across all chromosomes. It became apparent that allosome targeting sgRNAs were behaving 183
similarly to non-targeting controls which enrich during a CRISPR screen in hPSCs (Ihry et al., 184
2018). We observed that sgRNAs causing a single DSB on the X chromosome are less toxic 185
relative to sgRNAs inducing 2 DSBs at the MAPT locus despite being able to efficiently induce 186
indels (Fig. S2). sgRNAs targeting genomic amplifications in cancer cell lines exhibit a strong 187
depletion irrespective of the gene targets (Aguirre et al., 2016; Meyers et al., 2017; Munoz et al., 188
2016). Unlike cancer cell lines, H1-hESCs with a normal diploid karyotype and are very 189
sensitive to DNA damage making the difference between 1 and 2 DSBs significant. After 190
recognizing that the enrichment of sgRNAs on the X/Y chromosomes was related to DSB 191
sensitivity and copy number differences in male H1-hESCs we focused on autosomal genes. In 192
the remaining list of 645 autosomal genes that were enriched (RSA-up -2.25) we identified 41 193
tumor suppressor genes (Zhao et al., 2016). 194
The second most enriched gene was TP53, which confirms the selective pressure 195
imposed by Cas9-induced DSBs in hPSCs during a CRISPR screen (Fig. 2A). Consistent with 196
this TP53 mutants are able to suppress cell loss induced by Cas9 activity (Ihry et al., 2018). 197
Throughout the 18-day screen, the representation of sgRNAs targeting TP53 (Chr. 17), the 198
checkpoint kinase, CHEK2 (Chr. 22), and the proapoptotic regulator, PMAIP1 (Chr. 18), 199
increased in a time-dependent manner (Fig. 2B). Database mining for associations with TP53 200
among the enriched genes identified 20 genes with direct connections to TP53 (Fig. 2C, File 201
S6). 19 of which are expressed in H1-hESC and are on autosomal chromosomes. Although 202
EDA2R is on the X chromosome, it was included because its mRNA increases in response to 203
DNA damage in hPSCs (Ihry et al., 2018). We hypothesized that these genes could include 204
additional regulators responsible for the extreme sensitivity to DNA damage in hPSCs. 205
PMAIP1 was the most enriched gene in the screen. PMAIP1 has been implicated in 206
TP53-dependent cell death and functions by sensitizing cells to apoptosis by antagonizing the 207
anti-apoptotic protein MCL1 at the mitochondria (Kim et al., 2006; Perciavalle et al., 2012; 208
Ploner et al., 2008). PMAIP1 is highly expressed in hPSCs and its expression marks the 209
pluripotent state (Mallon et al., 2013). We confirmed this by examining PMAIP1 expression in 2 210
iPSC and 2 hESC lines. Analysis of RNA-seq experiments confirmed that PMAIP1 was highly 211
expressed during the pluripotent state and drops during neuronal differentiation using the NGN2 212
transgene (Fig. 3A). Additionally, GTEx data revealed that PMAIP1 has a highly restricted 213
expression pattern and is not expressed in most tissues (GTEx Analysis Release V7). Although 214
it has been demonstrated that PMAIP1 expression is maintained by OCT4 in testicular germ cell 215
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
9
tumors (Gutekunst et al., 2013), no functional connection has been made in hPSCs. We tested 216
if PMAIP1 expression was maintained by the pluripotency network by differentiating cells or 217
knocking out OCT4. Under these conditions qPCR detected a significant decrease in PMAIP1 218
mRNA (Fig. 3B). In thymocytes, PMAIP1 mRNA is induced by TP53 (Khandanpour et al., 219
2013). We knocked out TP53 in hPSCs but did not detect a reduction in PMAIP1 mRNA (Fig 220
3B). hPSCs constitutively express high levels of PMAIP1, and DNA damage does not increase 221
PMAIP1 expression, further supporting PMAIP1 mRNA as pluripotency-dependent and TP53-222
independent (Ihry et al., 2018). 223
Prior work demonstrated that cancer cell lines have a reduced DNA damage response 224
relative to hPSCs (Ihry et al., 2018). Consistent with this we did not observe an enrichment of 225
PMAIP1 sgRNAs in 14 independent CRISPR screens conducted in cancer cell lines despite 226
using libraries containing the same PMAIP1-targeting sgRNAs (Fig. 3C). This suggested that 227
PMAIP1 is responsible for making hPSCs sensitive to DNA damage. To test the functional 228
consequences of PMAIP1 mutations, we knocked out PMAIP1 in the iCas9 cell line using 229
transient exposure to synthetic crRNAs (Fig. S3). We tested if PMAIP1 mutants were resistant 230
to DSB-induced death by using lentiCRISPRs to deliver a sgRNA targeting MAPT, a neuronal 231
gene not expressed in hPSCs. In the absence of Cas9 (-dox), both control and PMAIP1 mutant 232
iCas9 cells grow at a similar rate while expressing an sgRNA. In the presence of Cas9 (+dox) 233
and a sgRNA, control cells die while PMAIP1 mutants are able to survive despite efficient DSB 234
induction (Fig. 3D, S3, S4E). qPCR analysis of the TP53-target genes P21 and FAS detected 235
an elevated expression in PMAIP1 mutants compared to controls (Fig. 3E). Despite having an 236
active TP53, PMAIP1 mutants survive. This indicates PMAIP1 is downstream of TP53 activation 237
and is consistent with its known role as a sensitizer to apoptosis (Ploner et al., 2008). In hPSCs 238
cell death is the predominant response to DNA damage. Unlike PMAIP1 mutants, P21 mutants 239
(>80% indels) are unable to suppress DSB-induced toxicity (Fig. S4E), and P21 sgRNAs did not 240
enrich in H1-hESCs. In contrast, in a genome-scale screen in retinal pigment epithelial cells, 241
where Cas9 activity causes TP53-dependent cell cycle arrest rather than apoptosis, sgRNAs 242
targeting TP53 and P21/CDKN1A were enriched while PMAIP1 sgRNAs were not (File S5) 243
(Haapaniemi et al., 2017). Overall, these results indicate that PMAIP1 plays a role in the 244
sensitivity of hPSCs to DNA damage and highlights the ability of genome-scale CRISPR 245
screens to identify cell type-specific genes important for the fitness of pluripotent stem cells. 246
Genetic screen for suppressors of dissociation-induced death 247
We next tested our ability to identify phenotypic regulators of human developmental processes. 248
Human PSCs, unlike mouse PSCs, are very sensitive to dissociation and die in the absence of 249
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
10
ROCK-inhibitors (Ohgushi et al., 2010). During dissociation of hPSCs, Rho and ROCK become 250
activated. This leads to the phosphorylation of myosin, which causes membrane blebbing and 251
cell death. To promote survival, inhibitors that target ROCK (Y-27632/thiazovivn) or myosin 252
(blebbistatin) are used routinely during hPSC passaging (Chen et al., 2010; Watanabe et al., 253
2007). Very few cells survive dissociation in the absence of ROCK inhibitors. Importantly, this 254
phenotype is developmentally rooted. hPSCs are epiblast-like and cells that fail to incorporate 255
into the polarized epithelium of the epiblast undergo cell death in the embryo (Ohgushi et al., 256
2010). To gain a deeper understanding of the genes involved, we screened for suppressors of 257
dissociation-induced death. 258
During the day 14 passage of the fitness screen we plated an additional replicate of the 259
genome-scale mutant cell library in the absence of thiazovivin (Fig. 4A, S1). The majority of the 260
cells died during this process and the surviving cells were maintained for two weeks until large 261
colonies were visible, at which point DNA was isolated and sgRNAs sequences were recovered 262
by NGS. We identified 76 genes with 2 or more independent sgRNAs present in cells that 263
survived dissociation without thiazovivin (Fig. 4C and File S7). As expected, multiple sgRNAs 264
targeting ROCK1 and MYH9, the genetic targets of ROCK inhibitors and blebbistatin, were 265
recovered. Myosin is a hexameric motor protein that is comprised of 6 subunits with 3 subtypes. 266
The screen recovered 3 sgRNAs for MYH9, a myosin heavy chain, 5 sgRNAs for MYL6, a non-267
phosphorylated myosin light chain, and 2 sgRNAs for the ROCK target MYL9/MLC2, a 268
phosphorylated myosin light chain. There are many myosin proteins, but our screen identified 3 269
out of 5 of the most abundantly expressed in hPSCs (Fig. 4B). This reiterates the importance of 270
myosin activation in membrane blebbing and dissociation-induced death. A number of additional 271
genes have roles in the actin/myosin network or cytoskeleton, including DAPK3, PAWR, 272
OPHN1, FLII and KIF3A (Fig. 4D). Overall STRING-DB analysis detected a connected set of 273
genes with ties to the actin/myosin regulatory network (Fig. 4D). In general members of this 274
network did not enrich during the fitness screen suggesting they specifically regulate 275
dissociation-induced death and not fitness (Fig. 4E). 276
PAWR is required for dissociation-induced death 277
For follow-up studies, we focused on the strongest hit from the screen, the pro-apoptotic 278
regulator PAWR (Hebbar et al., 2012). PAWR has no known biological role in the early embryo 279
or during dissociation-induced death of hPSCs. The screen recovered all 5 sgRNAs targeting 280
PAWR in the genome-scale library and the barcode reads were highly abundant (Fig. 4C). 281
Unlike sgRNAs for the TP53 pathway that enrich throughout the CRISPR screen, PAWR and 282
MYL6 have no effect on fitness in the presence of thiazovivin (Fig. 4E). We repeated the results 283
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
11
using 3 independent lentiCRISPRs to knock out PAWR in iCas9 expressing H1-hESC cells. 284
PAWR mutants are able to survive without thiazovivin while control cells do not (Fig. S4). To 285
independently validate these results, we used CRISPR mediated interference (CRISPRi) to 286
knockdown the expression of PAWR mRNA without causing DNA damage or genetic mutations 287
(Qi et al., 2013). By using a H1-hESC line constitutively expressing dCas9 fused to a KRAB 288
domain and sgRNAs targeting PAWR promoter we also detected an increase in the survival of 289
dissociated cells in the absence of thiazovivin (Fig. S4). 290
To conduct detailed analysis of PAWR mutants we exposed cells to Cas9 RNPs 291
targeting PAWR and generated a knockout cell line with a normal karyotype (Fig. S4). The 292
suppression of dissociation-induced death is specific to PAWR mutants, as PMAIP1 mutants 293
are unable to survive passaging without thiazovivin (Fig. 5A-B). Conversely, PAWR mutants are 294
unable to survive DSB-induced toxicity, further demonstrating the specificity of the respective 295
phenotypes (Fig. S4E). We next examined how PAWR mutants survive by time-lapse 296
microscopy. After single cell dissociation, control cells without thiazovivin exhibit membrane 297
blebbing and subsequently die (Fig 5C). Conversely, PAWR mutants without thiazovivin have 298
greatly reduced blebbing and survive as single cells by extending cell projections, which 299
promote attachment and survival (Fig 5C). We further examined cytoskeletal organization using 300
phalloidin to stain filamentous (F-) ACTIN. The thiazovivin-treated cells have an increased 301
surface area, a fanned-out shape with actin stress fibers, and a large circular adhesion belt-like 302
structure (Fig. 5C). In the absence of thiazovivin, control cells have many small actin rings which 303
mark membrane blebs. PAWR mutants without thiazovivin exhibit reduced membrane blebbing 304
and small actin rings (Fig. 5C). 305
Molecularly, PAWR has dual roles as a transcriptional repressor that causes cell death 306
or as an actin binding protein that regulates contractility (Burikhanov et al., 2009; Johnstone et 307
al., 1996; Vetterkind and Morgan, 2009). Despite having abundant PAWR mRNA, PAWR 308
protein is post-trancriptionally regulated and induced by dissociation in hPSCs (Fig. S4-5). 309
Immunofluorescence did not detect PAWR protein in the nucleus; however, we did observe 310
localization of PAWR with F-ACTIN in both thiazovivin treated and untreated cells (Fig. 5D). 311
PAWR localized to adhesion belt-like structures in the presence of thiazovivin and to membrane 312
blebs in the untreated cells after dissociation. Additional hits from the screen, PRKCZ and 313
SCRIB, also localized to membrane blebs (Fig. S6). Both PRKCZ and SCRIB are expressed in 314
the early mouse embryo and exhibit a ROCK-dependent cell polarity (Kono et al., 2014). 315
Cumulatively, we have identified a novel role for PAWR in dissociation-induced death. PAWR 316
mutants survive dissociation without ROCK inhibitors because of a failure to initiate membrane 317
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
12
blebbing and downstream caspase activation (Fig S5) (Ohgushi et al., 2010). Furthermore, 318
PAWR is a known proapoptotic factor and we have demonstrated that PAWR protein is induced 319
upon dissociation and colocalizes with the ACTIN network that is responsible for initiating 320
membrane blebbing and subsequent cell death. 321
FACS-based screen for regulators of pluripotency 322
Although our fitness screen detected a significant hPSC-specific dropout of OCT4 other 323
critical regulators of pluripotency like NANOG did not affect fitness (Fig 1E, File S4). A genome 324
scale fitness screen in mouse ESCs had similar results and only reported the dropout of three 325
genes regulating blastocyst development (Koike-Yusa et al., 2014). Pluripotency and cellular 326
fitness of hPSCs may not be related and this indicates that some differentiated cell types may 327
not exhibit changes in fitness when cultured in the pluripotent media. To specifically identify 328
regulators of human pluripotency we conducted a FACS-based pooled screen using an OCT4 329
antibody. One year after conducting the first fitness screen we thawed a genome-scale CRISPR 330
cell library and expanded them prior to conducting the screen (Fig. S1). The cells were 331
mutagenized with Cas9 for 8 days prior to FACS to collect cells with high (OCT4HIGH) and low 332
(OCT4LOW) OCT4 expression (Fig. 6A). Log2(fold change) was calculated by comparing the 333
OCT4LOW group to the OCT4HIGH group. We plotted the p-values calculated by the RSA test 334
against Q1 and Q3 based z-scores for OCT4LOW and OCT4HIGH, respectively (Fig. 7B, File S8). 335
Importantly, we detected a significant enrichment of OCT4 and NANOG targeting sgRNAs in the 336
OCT4LOW group. We also detected an enrichment of TGFBR1/2 genes required to maintain the 337
culture of hPSCs and the chromatin regulators EP300 and SMARCA4/BRG1 which regulate 338
OCT4 expression and function in hPSCs (Chen et al., 2011; King and Klose, 2017; Singhal et 339
al., 2010; Wang et al., 2012). Using STRING-db we identified a core network of genes 340
connected to OCT4 in the OCT4LOW group (Fig. 6C). This highlights the ability of phenotypic 341
CRISPR screening to identify relevant gene networks. Additionally, the OCT4HIGH group 342
identified factors that promote differentiation such as HAND1, KDM5B, and EIF4G2, (File S8) 343
(Hough et al., 2006; Kidder et al., 2013; Yamanaka, 2000). Many of the genes in these lists 344
have published roles in regulating pluripotency, reprogramming or embryonic development, and 345
further investigation of the less studied genes will reveal novel insights into the human 346
pluripotent state (File S8-9). 347
Identification of hPSCs specific fitness and pluripotency gene networks 348
Extensive CRISPR screening in cancer cell lines has provided a wealth of knowledge 349
about their genetic dependencies. However, the static state of these cells has revealed less 350
about genes with developmental functions (Hart et al., 2015). To compare hPSC results to 351
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
13
cancer cell lines we conducted pairwise Pearson correlation coefficients using Bayes factors 352
distributions (cancer data from Hart et al., 2015). The analysis revealed that hPSCs formed a 353
distinct cluster (Fig. 7A) and is consistent with the partial overlap between core essential genes 354
in cancer and fitness genes in hPSCs (52% Fig. 1E). To focus on gene networks specific to 355
hPSCs we conducted bioinformatics analysis comparing 829 core essentials cancer genes 356
(essential for 5/5 cell lines, Hart et al., 2015) to hPSC-specific gene sets identified by our 357
screens. A total of 661 hPSC-specific genes were obtained from the fitness screen (365 358
depleted and 20 enriched p53 related genes), dissociation-induced death screen (76), and the 359
OCT4 FACS screen (212) (File S10). The gene lists were analyzed using the PANTHER 360
classification system (pantherdb.org). PANTHER pathway analysis identified a greater diversity 361
of 92 enriched pathways in hPSCs and only 38 in the cancer lines (Fig. 7B). In accordance with 362
this we also detected an increase in the number of genes with receptor and signal transducer 363
activity molecular functions (Fig. 7C). The hPSC-enriched pathways included several expected 364
regulators: FGF, TGF-Beta, and WNT (Fig. 7B). FGF2 and TGFβ are critical components of E8 365
media and are required to maintain pluripotency in vitro (Chen et al., 2011). WNT signaling 366
regulates both differentiation and pluripotency in ESCs (Sokol, 2011). Activation of EGF, PDGF, 367
and VEGF is also important for the maintenance of the pluripotent state in (Fig. 7B) (Brill et al., 368
2009). P53 and CCKR/Rho GTPases pathways, which regulate apoptosis and have critical roles 369
in determining the sensitivity of hPSCs to DNA damage and enzymatic dissociation, were also 370
enriched (Fig. 7B). Examination of the biological processes gene ontology revealed an increase 371
in the number of development and multicellular organism genes (Fig. 7C). Furthermore, sub-372
dividing the developmental process category revealed enrichment of genes regulating cell 373
death, differentiation and early developmental stages (Fig. 7C). Globally these results highlight 374
the identification of cell type-specific genes regulating different aspects of the pluripotent state. 375
By screening for regulators of 3 fundamental processes governing the culture of hPSCs we 376
have successfully identified known regulators in addition to a plethora of novel genes involved in 377
stem cell biology (Fig. 7D). These genes are a blueprint for human pluripotency and will serve 378
as a useful resource for the human development and stem cell communities. 379
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
14
DISSCUSSION 380
The use of hPSCs in large-scale functional genomics studies has been limited by 381
technical constraints. Prior to our study, it was unclear that genome-scale CRISPR screens 382
were possible in hPSCs as the first attempts had poor performance (Hart et al., 2014; Shalem et 383
al., 2014). We overcame this by building a high-performance 2-component CRISPR/CAS9 384
system for hPSCs. The performance, across many sgRNAs, made the platform amenable to 385
high-throughput screening. Using iCas9 in hPSCs it is possible to perturb hundreds of genes in 386
arrayed format or the entire genome in pooled format. The system is renewable and a pool of 387
stem cells with sgRNAs to the entire genome can be banked, distributed and utilized for 388
successive screens in hPSCs and their differentiated progeny. Beyond technical proficiency we 389
identified genes that regulate fundamental stem cell processes such as self-renewal, their 390
inherent sensitivity to DNA damage, single-cell cloning, pluripotency and differentiation. 391
First, we identified 770 genes required for the self-renewal of hPSC. A majority of these 392
genes have established roles in fitness while 365 of these genes are novel and specific to 393
hPSCs. This set of genes could be used to inform a systematic approach to improve the 394
consistency, robustness and user-friendliness of hPSC culture conditions. During the fitness 395
screen, we also determined that Cas9 activity imposes a selective pressure on DNA damage 396
sensitive hPSCs. This caused an enrichment of 20 genes that are connected to TP53. 397
Consistent with this, dominant negative TP53 mutations and deletions recurrently occur and 398
provide a selective advantage during the culture of hPSCs (Amir and Laurent, 2016; Merkle et 399
al., 2017). In addition to TP53, we identified a hPSC-specific role for PMAIP1 in determining the 400
extreme sensitivity of hPSCs to DNA damage. Like TP53, deletions of chromosome 18 401
spanning the PMAIP1 locus have been recurrently observed during hPSC culture (Amps et al., 402
2011) and suggest that PMAIP1 deletion may be responsible for enhanced survival of these 403
lines. These TP53-related genes have the potential to improve the efficiency or safety of 404
genome engineering through transient inhibition or by monitoring their spontaneous mutation 405
rate during hPSC culture (Ihry et al., 2018; Merkle et al., 2017). 406
Second, we identified 76 genes that enhance the survival of hPSCs during single-cell 407
dissociation. Collectively, the screen uncovered an Actin/Myosin network required for 408
membrane blebbing and cell death caused by dissociation. We identified a novel role for PAWR, 409
a pro-apoptotic regulator that is induced upon dissociation. PAWR is required for membrane 410
blebbing and subsequent death of dissociated hPSCs in the absence of ROCK inhibitors. 411
Importantly, the results are developmentally relevant, and we also identified SCRIB and PRKCZ 412
which are known regulators of cell polarity in the early mouse embryo (Kono et al., 2014). 413
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
15
PAWR has been shown to physically interact with PRKCZ and suggests a potential link between 414
cell polarity and dissociation-induced death (Díaz-Meco et al., 1996). These hits appear to be 415
related to the polarized epiblast-like state of primed hPSC and could explain why polarized 416
hPSCs are sensitive to dissociation whereas unpolarized naïve mESC are not (Takashima et 417
al., 2015). Lastly, this set of genes could enable focused approaches to improve the single-cell 418
cloning efficiencies of hPSCs and the culture of naïve hPSCs. 419
In the final screen, by subjecting our hPSC CRISPR library to FACS sorting on OCT4 420
protein, we identified 113 genes that are required to maintain pluripotency and 99 genes that 421
potentially regulate differentiation. Overall, the screen identified an entire network of genes 422
related to OCT4. 19 of these genes have previously indicated roles in pluripotency, embryo 423
development and reprogramming (File S9). Future studies on the novel genes in the list will 424
yield new insights about the genetic control of pluripotency and differentiation. These gene sets 425
could guide rational improvements to protocols for the maintenance, differentiation and 426
reprogramming of hPSCs. 427
Overall, the results highlight the ability of unbiased genome-scale screens to identify 428
critical and novel regulators of human pluripotent stem cell biology. Future investigation into the 429
genes provided here will be a step toward the genetic dissection of the human pluripotent state. 430
Herein we provide simple and scalable work flows that will lower the entry barrier for additional 431
labs to conduct large-scale CRISPR screens in hPSCs. The scalable and bankable platform 432
described here is a renewable resource that will allow for successive screens and the 433
distribution of CRISPR infected hPSC libraries. The platform could potentially be used to 434
improve the generation, culture and differentiation capacity of hPSCs. It can be applied to the 435
study of development and disease in wide variety of differentiated cell types. Established 436
protocols for neurons, astrocytes, cardiomyocytes, hepatocytes and beta-cells can be exploited 437
to dissect the genetic nature of development and homeostasis in disease relevant cell types. 438
This resource opens the door for the systematic genetic dissection of disease relevant human 439
cells in way that was only before possible in model organisms. 440
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
16
Figure 1: A self-renewing Dox-inducible CAS9/genome-wide sgRNA cell library enables 441
multiple high performance CRIPSR screens in human pluripotent stem cells (A) Diagram 442
depicting the iCas9 platform for genome-scale CRISPR screening in hPSCs. The iCas9 platform 443
consists of a dox-inducible Cas9 transgene knocked in the AAVS1 locus of H1-hESCs and 444
lentiviral delivery of constitutively expressed sgRNAs. iCas9 hPSCs were transduced (.5 MOI) 445
at scale. After a week of expansion and selection for lentiCRISPRs iCas9 hPSCs were either 446
banked or subjected to Cas9 mutagenesis for screening. (B) Correlation of normalized sgRNA 447
counts reveals that freeze/thaw expanded samples (-dox) have high correlation with the plasmid 448
library and the starting pool of infected iCas9 hPSCs at day 0 of the screen. Day 18 samples 449
have been exposed to dox (+Cas9). (C) Diagram depicting three categories of genes that enrich 450
(enhance), deplete (suppress) or remain constant during a fitness screen. (D) Scatter plot 451
depicting gene level results for core essential (pink) and non-essential genes (blue). Without 452
Cas9 treatment (-dox), cells expressing sgRNAs targeting core essential and non-essential 453
genes are interspersed and have an RSA > -2.75 (marked by dashed line). After 18 days of 454
exposure to Cas9 (+dox), sgRNAs targeting essential genes dropout to less than RSA -2.75. Y-455
axis is RSA value. X-axis marks the Z-score (Q1). Non-essential and core essential gene list 456
from Hart et. al., 2014. (E) Precision v. recall analysis of genome-scale CRISPR screening data 457
in H1-hESCs. Cas9 expressing cells (purple) exhibit a PR curve that gradually slopes off, 458
whereas cells without Cas9 (green) exhibit a PR curve that immediately decreases. (F) Fitness 459
gene calculation based on 5% FDR on y-axis. Each condition labeled on the x-axis. (G) Venn 460
diagram comparing 770 depleted genes in hPSCs to 1580 core essential genes identified by 461
screening cancer cell lines (Hart et. al., 2015). 405 of the hPSCs depleted genes overlap while 462
the remaining 365 are specifically depleted in pluripotent stem cells. (H) Genes that dropout in 463
CRISPR screen are abundantly expressed. Y-axis depicts the log2 transformation of average 464
TPM values from 20 independent RNA-seq experiments in H1-hESC. For each box blot the 465
median is depicted by white line flanked by a rectangle spanning Q1-Q3. X-axis depicts gene 466
categories. In blue are non-essential genes from Hart et al., 2014, in pink are 405 core-essential 467
genes, in purple are 365 stem cell-specific essential genes and in gray are the remaining 468
unannotated genes. 469
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
17
Figure 1: A renewable lentiCRISPR infected hPSCs library enables high performance 470
screeni471
472 473
17
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
18
Figure 2: TP53 pathway mutations enrich during CRISPR screen in hPSCs (A) Scatter plot 474
depicting gene level results for the genome-scale screen. After 18 days of exposure to Cas9 475
(+dox) sgRNAs targeting TP53 related genes enrich during the screen; PMAIP1 (NOXA) (RSA -476
10.6, Q3 3.7), TP53 (RSA -7.64, Q3 4), and CHEK2 (RSA -3.6, Q3 2.4). A total of 302 genes 477
have a RSA score < -3 (marked by dashed line). TP53 related genes with RSA scores
-
19
Figure 2: TP53 pathway mutations enrich during CRISPR screen in hPSCs 488
489
490 491
19
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
20
Figure 3: PMAIP1 confers sensitivity to DNA damage in hPSCs (A) PMAIP1 is highly 492
expressed in hESCs and iPSCs. Y-axis represents expression in Transcripts Per Kilobase 493
Million (TPM). H1-hESCs (n=1), H9-hESCs (n=3), 8402-iPSCs (n=3) and HDFn-iPSCs (n=4). X-494
axis represents days after induction of a doxycycline inducible NGN2 expression cassette. (B) 495
qPCR confirms PMAIP1 mRNA is dependent on the pluripotent state. Y-axis is relative 496
expression and each bar represents mean relative expression. X-axis is each condition. Control 497
= hPSCs in E8 media, +FBS = 3 days exposure to 10% FBS and DMEM, +NGN2 = 3 days 498
exposure to NGN2, OCT4 KO = mutant pool after 6 days exposure to iCas9 and sgRNA 499
targeting OCT4, PMAIP1-/- = complete knockout cell line, TP53-/- = complete knockout cell line. 500
n=3 independent mRNA samples per sgRNA, error bars +/- 1 std. dev. Unpaired two-tailed t-501
test, equal variances *p
-
21
Figure 3: PMAIP1 confers sensitivity to DNA damage in hPSCs 517
518 519
21
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
22
Figure 4: Genetic screen for suppressors of dissociation-induced death (A) Diagram 520
depicting screen shows the dissociation and replating of the genome-scale mutant cell library 521
without the thiazovivin (ROCK inhibitor). Most cells did not survive the treatment; however, at 522
the end of two weeks some large colonies were recovered for DNA isolation and NGS analysis. 523
(B) The screen recovered 3 out of 6 subunits of the hexameric MYOSIN motor protein that 524
regulates blebbing in hPSCs. Y-axis average TPM in H1-hESC. X-axis myosin genes expressed 525
>1 TPM in H1-hESCs. Myosin genes recovered by screen in pink. Genes that were not detected 526
by screen in blue. (C) Heat map depicting number of sgRNAs recovered on y-axis and each 527
gene on x-axis. Colors indicate the abundance of each sgRNA recovered. Pink marks greater 528
than 90 percentile and purple marks less than 10th percentile. (D) String-DB analysis highlights 529
ACTIN and MYOSIN gene network among mutations that allow cells to survive dissociation in 530
the absence of ROCK inhibitors. Hits from screen marked in green. (E) MYL6 and PAWR 531
specifically regulate survival after dissociation and do not enrich during CRISPR screen. Each 532
dot represents 5 independent sgRNAs per gene and NGS quantifies representation of 533
lentiCRISPRs infected cells. Samples were normalized to the day 0 population and y-axis 534
represents log2(fold change). Day 0 data shown is from freeze/thaw samples maintained at 535
2100x. X-axis plots each condition over time. Cas9 + samples were treated with dox to induce 536
Cas9 expression. 537
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
23
Figure 4: Genetic screen for suppressors of dissociation-induced death 538
539 540
23
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
24
Figure 5: PAWR is required for dissociation-induced death (A) PAWR mutants survive 541
single-cell dissociation in the absence of thiazovivin (ROCK inhibitor) treatment. Control cells 542
and PMAIP1 knockout do not survive without thiazovivin treatment. Bright-field images taken of 543
live iCas9 cells 4 days after dissociation. Scale bar = 800 uM (B) Quantification of survival in the 544
presence or absence of thiazovivin. Percent confluence was measured 4 days after replate in 545
control, PAWR knockout and PMAIP1 knockout cells. Bars represent mean from 3 independent 546
wells with 4 images per well. Error bars +/- 1 std. dev from 4 images per well from 3 547
independent wells. The dissociation induced survival of PAWR mutant hPSCs has been 548
replicated >3 times. (C) Time lapse microscopy of live cells during first 9 hours of replate. 549
Control and PAWR knockout hPSCs survive replating in the presence of thiazovivin by 550
extending cellular projections and forming an actin adhesion belt organized with stress fibers. 551
Phallodin stain at 3.5h in fixed cells. Control cells without thiazovivin have abundant membrane 552
blebbing and this is highlighted by the presence of small circular actin rings in phallodin stained 553
cells. PAWR mutants have reduced blebbing and an intermediate phallodin staining without 554
small actin rings. Scale bar = 50 uM (D) Immunofluorescence detects PAWR protein 555
colocalizing with F-ACTIN. Following dissociation PAWR protein colocalizes with F-ACTIN in the 556
presence of thiazovivin in adhesion belt like structures and in the absence of thiazovivin in 557
membrane blebs. In green PAWR protein. In magenta phallodin stained F-actin. In blue DAPI 558
stained nuclei. Scale bar = 50 uM 559
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
25
Figure 5: PAWR is required for dissociation-induced death 560
561
25
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
26
Figure 6: OCT4 FACS-based screen identifies pluripotency gene network (A) Diagram 562
depicting FACS-based CRISPR screen using an OCT4 specific antibody to sort OCT4 high- and 563
low-expressing cells. Cells were mutagenized with Cas9 for 8 days prior to FACS sorting, DNA 564
isolation and NGS was used to identify an enrichment of sgRNAs in the high and low OCT4 565
populations. (B) Scatter plot depict gene level results for genome-scale OCT4 FACS screen. 566
Green depict OCT4LOW and gold depicts OCT4HIGH enriched sgRNAs. Y-axis is a p-value 567
generated from RSA down/up analysis. X-axis marks the Z-score (Q1/Q3). (C) String-DB 568
analysis identifies a 20-gene network connected to OCT4 among gene sgRNAs that were enrich 569
in cells with low OCT4 protein. Genes with published roles in pluripotency, reprogramming and 570
embryo development are highlighted in green. 571
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
27
Figure 6: OCT4 FACS-based screen identifies pluripotency gene network572
573
27
rk
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
28
Figure 7: Identification of hPSC-specific essential gene networks (A) Heatmap of Pearson 574
correlation coefficients adapted from Hart et al., 2015 to include CRISPR screening data in H1-575
hESCs (B) PANTHER pathway analysis identified 92 enriched pathways in hPSCs. A subset of 576
15 hPSC-specific pathways are depicted. (C) Depiction of gene ontology categories including 577
biological processes, molecular functions and developmental processes that are specific to 578
hPSCs but not cancer cell lines. (D) Schematic of genes identified by CRISPR screening in 579
hPSCs and their putative functions. 770 fitness genes regulate the self-renewing potential of 580
hPSCs. 113 genes with low OCT4 protein are implicated in pluripotency, 99 genes with 581
increased OCT4 protein may promote differentiation. 20 genes are implicated in the toxic 582
response to DNA damage. 76 genes are implicated in the sensitivity of hPSCs to single-cell 583
dissociation. (B-D) Bioinformatic analysis of 829 core essentials cancer (white bars – Hart et. 584
al., 2015) and 653 hPSC-specific genes (green bars). Genes in multiple categories are shown in 585
blue. 586
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
29
Figure 7: Identification of hPSC-specific essential gene networks 587
588 589
29
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
30
ACKNOWLEDGEMENTS 590
We would like to thank R. Maher, J. Alford, S. An, and D. Shkoza for their support with sgRNA 591
cloning. We would like to thank F. Cong, W. Forrester and L. Murphy for access to PMAIP1 592
pooled screening results in cancer cell lines. We thank C. Ye for supporting indel analysis and 593
pooled CRISPR screening. 594
AUTHOR CONTRIBUTIONS 595
R.J.I. and A.K designed all experiments and wrote the manuscript. M.R.S, K.A.W and R.D 596
revised manuscript. R.J.I. conducted live cell imaging, immunofluorescence, qPCR and Western 597
blotting S.K. and K.A.W. generated Ngn2-inducible cell lines and differentiated them into Ngn2 598
neurons. M.S. helped with genome-scale hPSC culture, packaged lentiviral sgRNAs and 599
generated CRISPRi lines. E. F. provided lentiviral supernatants and prepped DNA samples for 600
NGS. J. R. sequenced CRISPR indels. B.A. generated Precision/Recall values using the 601
BAGEL algorithm. S.K. generated RNA expression data in hPSCs and NGN2 neurons and it 602
was analyzed by R.R. G.R.H., Z.Y., and G.M. helped design pooled screen and performed 603
analysis. J. R-H. generated sgRNA libraries. C.R. sequenced pooled fitness screen samples. 604
S.P. sorted OCT4 high and low expressing cells by FACS. D.J.H. sequenced OCT4 FACS 605
screen. 606
CONFLICTS OF INTEREST 607
All authors were employees of Novartis Institutes for Biomedical Research at the time of the 608
research. 609
610
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
31
SUPPORTING INFORMATION 611
612
Figure S1: Genome-scale screening in hPSCs Paradigm for genome-scale pooled screen in 613
hPSCs. (A) hPSCs were transduced with 110,000 lentiCRISPRs in 5-layer CellSTACKs. 614
Following expansion and hPSC CRISPR library banking cells were subjected to subsequent 615
screens depicted in B-D. (B) Fitness screen in hPSCs. Cells were exposed to Cas9 (+dox) for a 616
total of 12 days to ensure complete gene disruption. DNA samples were taken at 0, 8, 14 and 617
18 days after exposure to Cas9. (C) Positive selection screen for suppressor of dissociation-618
induced cell death. At the end of the fitness screen the genome-scale hPSCs mutant CRISPR 619
library was replated in the absence of ROCK inhibitors (- thiazovivin). After two weeks cells that 620
suppressed dissociation-induced death were collected for DNA isolation. (D) FACS-Based 621
CRISPR screen for regulators of OCT4 protein expression. hPSC CRISPR cell library was 622
thawed and exposed to Cas9 (+ dox) for 8 days before cell sorting to select for cells with high or 623
low expression of OCT4 protein. 624
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
32
Figure S1: Genome-scale screening in hPSCs 625
626 627
32
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
33
Figure S2: Enrichment of sgRNAs on X and Y chromosomes (A) Bar chart shows the 628
chromosomal distribution of the top 770 depleted (Files S3) and 946 enriched (RSA-up < -2.25, 629
File S6. (B) NGS quantification indels induced by sgRNAs targeting the X chromosome. Control 630
reads are represented by white bars, in-frame mutations by light blue bars and frameshift 631
mutations by dark blue bars. n=1 DNA sample per sgRNA and cell line. >20,000 sequencing 632
reads per sample. 633
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
34
Figure S2: Enrichment of sgRNAs on X and Y chromosomes 634
635 636
34
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
35
Figure S3: PMAIP1 knock out hPSCs (A) iCas9 H1-hESCs were treated with Cas9 RNPs 637
targeting PMAIP1. NGS analysis demonstrated that complete knockout of PMAIP1 was 638
achieved with a spectrum of frameshift indels disrupting PMAIP1. n=1 sample, 2627 sequencing 639
reads (B) PMAIP1 mutations suppress DSB induced toxicity. Whole well images from 24-well 640
plates during editing with MAPT sgRNA in H1-iCas9 control and PMAIP1 mutant backgrounds. 641
Confluency mask in green. (C) DNA isolated after 10 of doxycycline treatment shows that on-642
target MAPT editing efficiency is similar between control and PMAIP1 mutant pools. Control 643
reads are represented by white bars, in-frame mutations by light blue bars and frameshift 644
mutations by dark blue bars. n=1 day 0 samples, n= 2 day 10 samples, >20,000 sequencing 645
reads per sample. 646
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
36
Figure S3: PMAIP1 knock out hPSCs 647
648
36
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
37
Figure S4: PAWR is required for dissociation-induced death (A) iCas9 expressing H1-649
hESCs were infected with lentiCRISPRs targeting PAWR. PAWR mutant pools were created by 650
exposing cells to Cas9/dox for one week. After mutagenesis, control and mutant cells were 651
dissociated using accutase and replated plus or minus thiazovivin. Control cells die without 652
thiazovivin while PAWR mutants survive. Images were taken 4 days after dissociation. (B) H1-653
hESC constitutively expressing dCas9-KRAB were infected with CRISPRi sgRNAs targeting the 654
promoter of PAWR. 3 out of 4 sgRNAs (i1, i2, i3, i5) tested were able to survive a replate in the 655
absence of thiazovivin while controls died. Images were taken 6 days after dissociation. (C) 656
iCas9 H1-hESCs were treated with Cas9 RNPs targeting PAWR. NGS analysis demonstrated 657
that complete knockout of PAWR was achieved with a spectrum of frameshift indels disrupting 658
PAWR. n=1 samples, 2621 sequencing reads (D) Karyotype analysis revealed that PAWR 659
mutants retain a normal Karyotype. (E) PAWR mutants do not suppress DNA damage-induced 660
cell death. Live imaging of confluence in MAPT sgRNA expressing iCas9 cells +/- DSB 661
(+dox/Cas9) in control, PMAIP1-/- knockout cells, and PAWR-/- knockout cells. PAWR-/-, P21-/- 662
knockout and control hPSCs die upon DSB induction while PMAIP1-/- mutants survive. Black 663
lines indicate control, blue lines indicate PMAIP1-/- mutants, green lines indicate PAWR-/- 664
mutants, orange lines indicate P21-/- mutants. Solid lines are without dox and dashed lines are 665
cultured with Cas9 (+dox). Y-axis is percent confluency each point represents mean of 3 666
independent whole-well images. error bars +/- 1 std. X-axis time in days of treatment. (A) PAWR 667
is highly expressed in hESCs and iPSCs. Y-axis represents expression in Transcripts Per 668
Kilobase Million (TPM). H1-hESCs (n=1), H9-hESCs (n=3), 8402-iPSCs (n=3) and HDFn-iPSCs 669
(n=4). X-axis represents days after induction of a doxycycline inducible NGN2 expression 670
cassette. 671
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
38
Figure S4: PAWR is required for dissociation-induced death 672
673 674
38
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
39
Figure S5: PAWR is induced after dissociation and required for caspase activation (A) 675
Immunofluorescence using PAWR antibodies detects protein after dissociation but not in 676
confluent colonies. PAWR protein in green. DAPI stained nuclei in blue. Scale bar = 100 uM (B) 677
Immunofluorescence using PAWR antibodies detects protein after dissociation in controls but 678
not PAWR knockout cells. (C) In control cells western blot detects caspase activation 4 hours 679
after dissociation in the absence of thiazovivin. PAWR mutants do not exhibit caspase 680
activation. In green anti-rabbit Cleaved Caspase-3 (CC3, 17 and 19 kDa) antibodies. In red anti-681
mouse GAPDH (37 kDa) loading control. 682
683
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
40
Figure S5: PAWR is induced after dissociation and required for caspase activation684
685
40
n
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
41
Figure S6: PRKCZ and SCRIB proteins are expressed in dissociated hPSCs (A) 686
Immunofluorescence detects PRKCZ and SCRIB proteins localizing to membrane blebs in the 687
absence of thiazovivin. In the presence of thiazovivin PRKCZ and SCRIB demonstrate a nuclear 688
or perinuclear localization respectively. In green PRKCZ and SCRIB proteins. In blue DAPI 689
stained nuclei. White scale bar = 20 uM. 690
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
42
Figure S6: PRKCZ and SCRIB proteins are expressed in dissociated hPSCs 691
692
42
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
43
MATERIALS AND METHODS 693
Cell lines 694
H1-hESCs (WA01-NIHhESC-10-0043) and H9-hESCs (NIHhESC-10-0062) were obtained from 695
WiCell. 8402-iPSCs originated from GW08402 fibroblasts from the Coriell Institute and 696
reprogrammed as described by Sun et al., 2016(Sun et al., 2016). hDFN-iPSCs were generated 697
as described by Bidinosti et. al., 2016 (Bidinosti et al., 2016). hPSC lines were free of 698
Myoplasma and tested using the Mycoalert Detection kit (Lonza). SNP fingerprinting confirmed 699
the identify of hPSC lines used. Karyotyping was performed by Cell Line Genetics (Madison, 700
WI). 701
Genome Engineering 702
H1-hESCs expressing dox inducible (i) iCas9 were generated by Ihry et. al., 2018. Dox treated 703
H1-iCas9 cells were subjected to three successive rounds of RNAimax delivery of the two-704
component synthetic crRNA/tracrRNA (IDT) pairs targeting PMAIP1, PAWR and TP53 as 705
described by Ihry et al., 2018. PMAIP1, and PAWR were transfected with a single sgRNA while 706
TP53 was co-transfected with 3 crRNAs. CRISPR indel analysis detected effcient gene 707
disruption for all three genes and was performed as described by Ihry et. al., 2018. 708
PMAIP1 crRNA 3 TCGAGTGTGCTACTCAACTC 709
PAWR crRNA 5 CGAGCTCAACAACAACCTCC 710
TP53 crRNA 1 GAAGGGACAGAAGATGACAG 711
TP53 crRNA 2 GAAGGGACAGAAGATGACAG 712
TP53 crRNA 4 GAGCGCTGCTCAGATAGCGA 713
P21 crRNA 1 AATGGCGGGCTGCATCCAGG 714
P21 crRNA 4 TCCACTGGGCCGAAGAGGCGG 715
P21 crRNA 6 GGCGCCATGTCAGAACCGGC 716
Pooled Mutagenesis (CRISPR nuclease/interference) 717
H1-hESCs expressing a constitutive (c) Cas9-KRAB knocked-in to the AAVS1 locus were 718
generated as described by Ihry et., al., 2018. The following lentiCRISPR were used to transduce 719
iCas9 or cCas9-KRAB cells to generate mutant cell pools. 720
CRISPR nuclease 721
PAWR sgRNA 1 TTTGGGAATATGGCGACCGG 722
PAWR sgRNA 2 GGTGGCTACCGGACCAGCAG 723
PAWR sgRNA 5 CGAGCTCAACAACAACCTCC 724
MAPT sgRNA 1 GAAGTGATGGAAGATCACGC 725
ACSL4 sgRNA TGGTAGTGGACTCACTGCAC 726
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
44
ARSH sgRNA GCAGCACCGTGGCTACCGCA 727
BMX sgRNA ATGAAGAGAGCCGAAGTCAG 728
BTK sgRNA GGAATCTGTCTTTCTGGAGG 729
GABRA3 sgRNA AAGGACTGACCTCCAAGCCC 730
GK sgRNA TAGAAAGCTGGGGCCTTGGA 731
NRK sgRNA CGCCTTCCTATTTCAGGTAA 732
TLR7 sgRNA CAGTCTGTGAAAGGACGCTG 733
CRISPR interference 734
PAWR sgRNA 1 GGCGCGCTCGAGGACTCCAA 735
PAWR sgRNA 2 GTTGCAGGGTGGGGACCCGG 736
PAWR sgRNA 3 GCTGGCCGGTAGTGACTGGT 737
PAWR sgRNA 5 GGCTGCTGGCCGGTAGTGAC 738
Large-scale culture of hPSC 739
H1-hESCs with AAVS1 knock in of the iCas9 transgene were generated and cultured in TeSR-740
E8 media (STEMCELL TECH.-05940) on vitronectin (Gibco-A14700) coated plates as 741
described by Ihry et. al., 2018. Pilot studies with a sub-genome sgRNA library used a total of 40 742
individual T225 flasks and was cumbersome (Ihry et. al., 2017). Daily feeding and passaging in 743
which multiple flask needed to be pooled was time consuming and increased the risk for 744
contamination. To minimize the manipulation required during feeding and passaging we used 5-745
layer CellSTACKs. The vessels are large enough to contain an entire 55,000 sgRNA at roughly 746
1000x coverage per sgRNA at a seeding density of 21,000 cells/cm[2] (Seed 66 million cells for 747
~1200x). In practical terms only 4 to 8 5-layer CellSTACKs were growing at a given time during 748
the month-long genome-scale CRISPR screen (Fig. S1). Given the expense of E8 media 749
Penicillin-Streptomycin (pen/strep) at 100 U/mL was added as an additional insurance policy for 750
the first screen at scale. After running a lengthy genome-scale screen and becoming 751
experienced with large-scale hPSC culture it is possible to run future screens without pen/strep 752
(Fig. S2). 753
lentiCRISPR packaging 754
For a one-layer CellSTACK 42 million HEK293T (66,000 cells/cm2) were plated in 100 mL of 755
media (DMEM +10% FBS + 1x NEAA, no pen/strep). One day after seeding, cells were 756
transfected with single lentiCRISPR plasmids in 6-well plates or pooled lentiCRISPR plasmids in 757
CellSTACKs. For a one-layer CellSTACK 102 uL of room temp TransIT (Mirus MIR 2700) and 758
3680 uL Opti-MEM (Invitrogen 11058021) were mixed incubated in a glass bottle for 5 minutes 759
at room temp. 94.5 ug of Lentiviral Packaging Plasmid Mix (Cellecta CPCP-K2A) and 75.6 ug of 760
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
45
the lentiCRISPR plasmid library was added to the transfection mix and incubated for 15 minutes 761
at room temp. After incubation, the mix was added to 100 mL of fresh media and the cells were 762
fed. The next day the transfected cells received 100 ml fresh media. After 3 days of viral 763
production supernatants were filtered (.45uM corning 430516) and aliquoted in to 1ml tubes for 764
storage at -80 C. 765
Large-scale transduction of hPSC 766
We conducted a genome-scale CRISPR screen using a 110K sgRNA library (~5 sgRNAs per 767
gene, split into two 55K sgRNA sub-pools, DeJesus et al., 2016). We desired 1000x coverage of 768
each sgRNA to offset cell loss from double strand break (DSB)-induced toxicity (Ihry et. al., 769
2017). To screen a sufficient number of cells we infected hPSCs with lentiCRISPRs in 5-layer 770
CellSTACKs. Cells were infected at .5 MOI to ensure each cell was infected with no more than a 771
single sgRNA. After puromycin selection cells were expanded for one week without dox to be 772
pelleted for DNA, banked or screened (Fig. 1A, S1). 773
Pooled CRISPR screens rely on cells being efficiently transduced at less than or equal 774
to .5 MOI. We developed a reverse transfection method for hPSCs without polybrene that 775
resulted in an efficient transduction with low volume exposure to HEK293T lentiviral 776
supernatants. LentiCRISPR plasmids expressed a constitutive RFP and puromycin resistance 777
to mark and select for infected cells respectively. Viral titer of the two 55,000 sgRNA libraries 778
expressing RFP in 6-well plates determined that less than 25 uL in 1.5mL of media was required 779
for .5 MOI. These calculations scaled appropriately in 5-layer cell stacks with 500 mL of media 780
and approximately 50% of the cells were RFP positive in the absence of puromycin. 781
A genome-scale lentiCRISPR library targeting each gene 5 times has been split into 782
55,000 sub-pools (pool 1 and 2). To screen at 1000x per sgRNA, 264 million hPSCs are 783
infected in 4x 5-layer CellSTACKS (12,720 cm2, 21,000 cells/ cm2). Cells are infected at .5 MOI 784
to ensure only one sgRNA is expressed per cell (+sgRNA/puroR/RFP). After puromycin 785
selection cells are expanded until confluent (4-6 days). At this point 40 million cells (10 786
million/ml) can be banked in 5ml cryovials for use at a later date. 787
Banking lentiCRISPR infected hPSC library 788
One 5-layer cell stack was treated with 200 mL accutase that was evenly distributed 789
among layers. After incubation at 37 C for 10 minutes, accutase (Gibco-A1110501) was 790
neutralized with 200 mL E8 media. Cells were counted and pelleted to be resuspended at a 791
concentration of 10 million cells per ml in a solution of 40% Tet-free FBS (Seradigm #1500-500) 792
and 10% DMSO (Sigma D2650) and 50% E8 media. 4 ml aliquots were placed in 5 ml cryovials 793
and frozen in a Mr. Frosty (Thermo Scientific 5100-0050) at -80 C overnight before long-term 794
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
46
storage in liquid nitrogen. Thawing of cells banked in 5ml cryovials showed an average viability 795
around 85% for both lentiCRISPR pools. Viability was assayed using a Nexcelom Cellometer 796
Auto 2000 and AO/PI (Nexcelom CS2-0106) staining solution. 797
We tested the effect of freezing and thawing on the representation of the sgRNAs in the 798
library by thawing the cell library at either 700x (40 million cells per 55k sub-pool) or 2100x (120 799
million cells per 55k sub-pool) cells per sgRNA. Cells were thawed in a 37 C water bath and 800
transferred to a 50mL conical with E8 media and centrifuged at 300 g for 3 minutes. Pelleted 801
cells were resuspended in E8 media and replated at a density of 30 to 40*106 cells/cm2. 3 802
cryovials with 120 million cells was thawed and plated on a 5-layer cell stack (120,000,000 803
/55,000 = 2100x). 804
After thawing and feeding the cells for two days, DNA was isolated and analyzed by 805
NGS to measure the representation of each sgRNA in the pool. Each sample was compared to 806
the original lentiCRISPR plasmid library to generate a log2(fold change) value. Both day zero 807
and freeze/thaw samples had an over 87% alignment of sequencing reads and fewer than 25 808
missing barcodes per replicate. Calculating the log2(fold change) revealed no significant change 809
in the representation of sgRNAs before (day 0) or after one freeze/thaw cycle. Pearson 810
correlation analysis demonstrated there was a high correlation between the day zero samples 811
and the freeze/thaw samples (Fig. 1B). 812
OCT4 FACS-BASED screen 813
Cells were dissociated using accutase for 10 min at 37 C to create a single-cell suspension 814
which was strained using a 40-micron filter and was counted. After removing accutase, pelleted 815
cells were resuspended in a volume of 1 million cells/mL for the staining protocol. For each 816
replicate 55 million unsorted cells were frozen down prior to fixation. The remaining cells were 817
fixed in 4% PFA in PBS for 10 minutes at room temperature on a rocker. Cells were spun down 818
at 300 RCF for 3 min between each subsequent solution change. Cells were washed with .1% 819
Triton-X in PBS after fixation and blocked in 2% goat serum, .01% BSA and .1% triton X in PBS 820
for 1hr at room temperature. Conjugated (AF488) primary antibodies specific to OCT4 (CST 821
5177) were diluted in blocking solution (1:200) and incubated with cells on a rocker over night at 822
4 C. Prior to FACS analysis cells were resuspended in PBS at a concentration of 30 million 823
cells/mL. A total of 1.2 billion cells were sorted into OCT4low (50 million cells) and OCT4high (61 824
million cells) populations using an ARIA III (BD). 825
DNA isolation 826
For each replicate, 55 million cells (1000x) were pelleted and genomic DNA was isolated using 827
QIAamp DNA Blood Maxi Kit (Qiagen 51194) as directed by manufacturer. Isolating genomic 828
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv preprint
https://doi.org/10.1101/323436
-
47
DNA from 4% PFA fixed cells was performed by utilizing phenol chloroform extraction. Cells 829
were resuspended in 500ul TNES (10mM Tris-Cl ph 8.0, 100mM NaCL, 1mM EDTA, 1% SDS) 830
and incubated overnight at 65 C. After allowing the samples to cool, 10ul of RNase A (Qiagen 831
19101) and samples were incubated at 37 C for 30 minutes. Next, 10ul of proteinase K (Qiagen 832
19133) and incubated for 1 hour at 45 C. Add 500ul of PCIA (Phenol;Cholorform;Isoamyl 833
alcohol ph 8) (Thermo 17908) and vortex. Spin samples in a centrifuge at max speed for 2 834
minutes. Transfer the aqueous phase to 500ul of PCIA and vortex. Spin at max speed for 2 835
minutes. Transfer the aqueous phase to 450ul of chloroform and vortex. Spin at max speed for 836
2 minutes. Transfer aqueous phase to 40ul of 3M NaAcO ph 5.2. Add 1 ml of 100% ethanol, mix 837
and precipitate DNA for 1 hour on ice. Spin at max speed for 2 minutes. Decant and wash with 838
1ml 70% ethanol. Spin at max speed for 1 minutes. Decant and air dry the pellet. Resuspend in 839
50ul of nuclease free H20. 840
mRNA expression 841
qPCR and RNA-seq analysis were performed as described by Ihry et. al., 2018. Median TPM 842
values for H1-hESCs are available upon request. RNA-seq data for in 4 iPSC control lines 843
subjected to NGN2 differentiation is available upon request but is restricted to the expression for 844
PAWR and PMAIP1. 845
Assaying sensitivity to DNA damage 846
Control and mutant iCas9 H1-hESCs expressing a MAPT targeting sgRNA were monitored daily 847
post-media change using an IncuCyte zoom (Essen Biosciences). At the onset of the 848
experiment cells were plated at density of 10,500 to 21,000 cells/cm2 and cultured plus or minus 849
dox for the duration. Confluence was calculated using the processing analysis tool (IncuCyte 850
Zoom Software). 851
Assaying survival without ROCK inhibitor 852
Control and mutant iCas9 H1-hESCs were dissociated with accutase for 10 minutes. Flowmi 40-853
micron cell strainers (BEL-ART H13680-0040) were used to ensure a uniform single-cell 854
suspension prior to replating cells. Cells were plated at a density of 10,500 to 21,000 cells/cm2 855
plus or minus thiazovivin (ROCK inhibitor). Timelapse images were taken in 3 hr intervals using 856
IncuCyte zoom (Essen Biosciences). The confluence processing analysis tool (IncuCyte Zoom 857
Software) calculated confluency for each sample. 858
Immunofluorescence and Western Blotting 859
Immunofluorescence staining of fixed cells was performed as described by Ihry et. al., 2018. 860
Protein lysates were made by vortexing cell pellets in RIPA buffer (Thermo Scientific 89901) 861
supplemented with Halt protease inhibitor cocktail (Thermo Scientific 78430) and phosphatase 862
certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which was notthis version posted May 16, 2018. ; https://doi.org/10.1101/323436doi: bioRxiv prepr