Genetics NewsGenetics News F 1 completed last night P’s doing fine.
-
Upload
irma-sullivan -
Category
Documents
-
view
219 -
download
4
Transcript of Genetics NewsGenetics News F 1 completed last night P’s doing fine.
![Page 1: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/1.jpg)
Genetics News• F1 completed last night
• P’s doing fine
![Page 2: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/2.jpg)
Phenotype of F1
![Page 3: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/3.jpg)
Regulation of Gene ExpressionStrategy for next three weeks
• Regulation of gene expression (prokaryotes)
- The lac operon
How does environment affect expression?
What is the decision making machinery?
• Regulation of gene expression (eukaryotes)
• Development of an organism
![Page 4: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/4.jpg)
The phenomenonDiauxic growth
![Page 5: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/5.jpg)
The lac operon
![Page 6: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/6.jpg)
The lac operon
--------operator------- GAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATT CTTTCGCCCGTCACTCGCGTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGATACTGGTACTAA
--lacI-- --CAP site--- -35 -10 rbs lacZ -----promoter-----
--------operator-------CACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACT
-35 -10 -----promoter-----
![Page 7: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/7.jpg)
The lac operonSQ10: RNA polymerase binds to each gene separately?
DNA
RNA
PROTEIN
![Page 8: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/8.jpg)
The lac operonSQ10: Each gene encodes a different protein?
DNA
RNA
PROTEIN
![Page 9: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/9.jpg)
The lac operonSQ10: Each gene has its own start codon?
DNA
RNA
PROTEIN
![Page 10: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/10.jpg)
The lac operonSQ10: Ribosomes bind to each gene separately?
DNA
RNA
PROTEIN
![Page 11: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/11.jpg)
The lac operonSQ10: Each gene is replicated separately?
DNA
RNA
PROTEIN
![Page 12: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/12.jpg)
ß-galactosides
Lactose
IPTG
ONPG
PGal
![Page 13: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/13.jpg)
Properties of Galactosides
ß-galactosideSubstrate for
ß-galactosidase?Binds to
Lac repressor?Use
Glucosyl-ß-D-galactoside (lactose) Yes Yes Natural substrate
Phenyl-ß-D-galactoside (PGal) Yes No Selects for lacI-
ortho-nitrophenyl-ß-D-galactoside (ONPG) Yes ?Assay for
ß-galactosidase
Isopropyl-ß-D-thiogalactoside (IPTG) No Yes Induces lac operon
Quiz Q2: Which would increase ß-galactosidase activity?
![Page 14: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/14.jpg)
Enzyme Activity
Is it:
Potential: Machinery available to manufacture product?
Actuality: How many products made?
![Page 15: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/15.jpg)
Properties of Galactosides
ß-galactosideSubstrate for
ß-galactosidase?Binds to
Lac repressor?Use
Glucosyl-ß-D-galactoside (lactose) Yes Yes Natural substrate
Phenyl-ß-D-galactoside (PGal) Yes No Selects for lacI-
ortho-nitrophenyl-ß-D-galactoside (ONPG) Yes ?Assay for
ß-galactosidase
Isopropyl-ß-D-thiogalactoside (IPTG) No Yes Induces lac operon
Quiz Q2: Which would increase ß-galactosidase activity?
![Page 16: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/16.jpg)
The lac operonSQ13: Why do some galactosides only induce?
Why IPTG?
Why not Pgal?
![Page 17: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/17.jpg)
The lac operonSQ12: Phenotype of lacI mutant unable to bind allolactose?
![Page 18: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/18.jpg)
Study Question 6
Strain Sugar(s) added Growthwild type lactose
lacZ lactoselacY lactose
wild type PGalwild type PGal + IPTG
lacY lactose + IPTG
Will these strains grow?
![Page 19: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/19.jpg)
Study Question 6
Strain Sugar(s) added Growthwild type lactose
lacZ lactoselacY lactose
wild type PGalwild type PGal + IPTG
lacY lactose + IPTG
Will these strains grow?
SQ7: Why does growth on PGal alone select for lacI- mutants?
![Page 20: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/20.jpg)
Predict the Lac phenotype
Chromosome Plasmid Phenotype
I+ P+ O+ Z+ Y+ I+ P+ O+ Z+ Y+ Inducible, growth
I- P+ O+ Z+ Y+ I+ P+ O+ Z- Y+
I- P+ O- Z+ Y+ I+ P+ O+ Z- Y+
I- P- O+ Z+ Y+ I+ P+ O+ Z- Y+
![Page 21: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/21.jpg)
The lac operonSQ14: Explain diauxic growth in terms of the lac operon.
![Page 22: Genetics NewsGenetics News F 1 completed last night P’s doing fine.](https://reader036.fdocuments.us/reader036/viewer/2022062422/56649f385503460f94c54d30/html5/thumbnails/22.jpg)
The lac operonSQ14: Explain diauxic growth.