Pacific Northwest Fungi

Volume 1, Number 7, Pages 1-13Published June 6, 2006

Genetic Structure of Cantharellus formosus Populationsin a Second-Growth Temperate Rain Forest

of the Pacific Northwest

Regina S. Redman1,2, Judith Ranson3, and Rusty J. Rodriguez1,2,3

1Microbiology Department, Montana State University, Bozeman, MT; 2BiologyDepartment, University of Washington, Seattle, WA; 3U.S. Geological Survey, Seattle,WA

Redman, R. S., J. Ranson, and R. J. Rodriguez. 2006. Genetic structure of Cantharellus formususpopulations in a second-growth temperate rain forest of the Pacific Northwest. Pacific Northwest Fungi 1(7):1-13. DOI: 10.2509/pnwf.2006.001.007

Corresponding author: Regina S. Redman, redmanr@u.washington.edu

Accepted for publication June 2, 2006.

Copyright © 2006 Pacific Northwest Fungi Project. All rights reserved.

Abstract: Cantharellus formosus growing on the Olympic Peninsula of the PacificNorthwest was sampled from September – November 1995 for genetic analysis. A totalof ninety-six basidiomes from five clusters separated from one another by 3 - 25 meterswere genetically characterized by PCR analysis of 13 arbitrary loci and rDNAsequences. The number of basidiomes in each cluster varied from 15 to 25 and geneticanalysis delineated 15 genets among the clusters. Analysis of variance utilizing thirteenapPCR generated genetic molecular markers and PCR amplification of the ribosomalITS regions indicated that 81.41% of the genetic variation occurred between clusters and18.59% within clusters. Proximity of the basidiomes within a cluster was not an indicatorof genotypic similarity. The molecular profiles of each cluster were distinct and defined

2 Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13

as unique populations containing 2 - 6 genets. The monitoring and analysis of thisspecies through non-lethal sampling and future applications is discussed.

Key Words: Pacific golden chanterelle, ectomychorrhizal fungi, molecular analysis,PCR

Introduction: Every year, thousands oftons of basidiomes representing severalfungal species are commerciallyharvested from forests throughout theworld for human consumption. ThePacific golden chanterelle (Cantharellusformosus), is a popular commerciallyharvested ectomycorrhizal fungi fordomestic and foreign markets (Love etal., 1998). C. formosus occursfrequently throughout the PacificNorthwest and is often associated withspruce (Picea sitchensis), hemlock(Tsuga heterophylla) and Douglas fir(Pseudotsuga menziesii).Ectomycorrhizal symbiosis is a plant-fungal association that plays animportant role in the biology, ecologyand health of the forest ecosystems.Mutualistic benefits in the form of growthenhancement, water and nutrientacquisition, and protection from rootdisease have been reported throughsymbiotic interactions (Smith& Read1997).

In recent years, concerns for the healthand sustainability of forestectomycorrhizal fungal populationsexposed to frequent, heavy harvestingpractices have arisen. Incorporation offungal harvesting guidelines in thePacific Northwest forest managementplans has been suggested (Molina et al.,2001). These concerns do not appearto be unfounded. Earlier studies onharvesting practices of Cantharelluscibarius (Fr.) showed a decrease infruiting body abundance due to humanimpacts; e.g. walking and disrupting themycelia mats present in the forest floor(Egli & Ayer 1997). Management ofnatural ecosystems is complex andbaseline data must be established for

effective management guidelines to bedesigned. Foremost, a betterunderstanding of spatial and temporaldynamics of mushroom populationsinfluenced by harvesting must beestablished. In recent years, there havebeen several molecular genetic studiesof several ectomycorrhizal species(Gherbi et al., 1999; Huai et al., 2003)including the Pacific golden chanterelle(Dunham et al., 2003). However, therehave been no studies conducted inwhich a non-lethal sampling techniquewas incorporated. In so doing, ourstudies will allow us to revisit existingfungal populations in which individualbasidiomes have been analyzed and thegenet profiles (individuals possessingunique genotypes) established.Monitoring and comparing the genetprofiles will provide baseline data toassess the possible impacts on thestructure, health and sustainability offungal populations in the presence andabsence of harvesting. This informationwill allow resource managers to designmanagement strategies to ensureectomycorrhizal sustainability.

The goal of this study was to non-lethally genetically characterize C.formosus basidiomes within andbetween geographically distinct clustersin the absence of harvesting. This wasdetermined by the presence or absenceof polymorphic PCR markers, rDNA ITSrestriction enzyme digestions, and ITSsequence analysis. The distribution ofgenets prior to imposing treatments forstudying long term effects of harvestingon genotype expression is discussed.

Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13 3

Materials and Methods

Sample site and collection A mixedconiferous forest site of spruce andhemlock was identified on the OlympicPeninsula of Washington State thatsupported five spatially distinct clustersof C. formosus basidiomes and definedas “site 5”. The large, mature treeswere harvested approximately 55 yearsago and presently, site 5 consists ofsecond growth spruce and hemlocktrees. Five C. formosus clusters (Figure1 & 2A) were separated from oneanother by 3 to 25 meters, and a benchmark centrally established between andwithin the five clusters. Compassazimuth and distance measurements ofeach individual basidiome were mappedrelative to one another. Each clustercontained between 15 and 25basidiomes that were distributed over a0.5 to 5 meter area (Figure 1, A - E).Approximately 20 mg of tissue from thepileal context was harvested for DNAextraction from 96 basidiomes betweenSeptember and November of 1995(Figure 2B). Samples were placed inmicrocentrifuge tubes containing 500 ulof DNA preservation buffer (150 mMEDTA, 50 mM Tri-HCl pH 8.0).Samples were collected withoutdisplacement of the fruiting bodystructure and disruption of undergroundmycelia complex. Samples wereimmersed in DNA preservation bufferand stored at room temperature (RT) orprocessed for total DNA extraction andstored at –70C.

DNA isolation: Total DNA wasextracted from tissue samples immersedin DNA preservation buffer based on apreviously published protocol(Rodriguez 1993). Samples werehomogenized by hand with small pestlesand 0.1 volume of 20% (w/v) sarkosyladded, samples mixed and incubated at65 C for 30 min, and centrifuged 5 minat 14K rpm. The supernatant (S/N) wastransferred to a new tube containing 300

µl of a solution of 20% polyethyleneglycol (PEG, Mr 8000) and 2.5 M NaCl,mixed, and incubated 5 min at RT. Theprecipitated DNA was centrifuged for 5min at 14K rpm, the DNA pellet re-suspended in 200 µl of TE buffer (10mM Tris, 1 mM EDTA, pH 8.0). For theremoval of RNA, polyphosphates andprotein from samples, 100 µl of 7.5 Mammonium acetate was added, samplesmixed, placed on ice for 5 min, andcentrifuged for 5 min at 14K rpm. TheS/N was transferred to a new tubecontaining 300 µl of n-propanol, mixedgently, and centrifuged for 5 min at 14Krpm. The DNA pellet was re-suspendedin 200 µl TE buffer, NaCl to 0.1M and400 µl of 95% ethanol added, samplesmixed and centrifuged for 5 min at 14Krpm. The purified DNA pellet was re-suspended in 500 µl of TE buffer andplaced at –70C for long term storage.

PCR and electrophoresis: PCR’s(Saiki et al., 1985) were carried out in 20µL volumes containing 10 mM Tris-HCl(pH 9.0), 50 mM KCl, 2.5 mM MgCl2,0.2% Triton X-100, 200 µM each ofdATP, dCTP, dGTP, dTTP (Pharmacia),0.2 units Taq DNA polymerase, 500 ngof each oligonucleotide primer and 0.4to 400 ng of fungal DNA. Amplificationreactions were carried out inBarnstead/Thermolyne thermocyclers.Arbitrarily primed PCR (apPCR)involved amplification with singleprimers and 35 cycles of a temperatureregime consisting of denaturation at 93Cfor 15 seconds, primer annealing (Table1) for 1.5 min following a 30 s ramp from93C, and synthesis at 72C for 1.5 minfollowing a 1 min ramp from annealingtemperatures. Prior to the initiation ofthe cycles, the reactions were incubatedat 93C for 2 min. The temperatureregime was the same for dual primerPCR (dpPCR) except the ramp timeswere eliminated and two primers wereadded to each reaction. Electrophoresisof the amplified products was performedfor 1.5 hr at 12 to 16 V/cm in 2%

4 Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13

agarose and products visualized bystaining with ethidium bromide andvisualized using 305 nm UV light(Sambrook et al., 1989).

Generating marker-specific primersets for dpPCR: Five basidiomes fromfive clusters in site 5 (Figure 1, A-E)were analyzed by apPCR with 2 singleprimers. Polymorphic bands wereisolated, cloned, and sequenced usingstandard protocols (Sambrook et al.,1989) and marker-specific primer setswere generated based on sequencesnear the terminal regions of the clonedapPCR products (Ostberg & Rodriguez2002; Rodriguez et al., 2004). Theprimer sets were used for dpPCR usingthe conditions described above.Sequences of the dpPCR primers andthe annealing temperatures used foramplification are listed in Table 1. Eightprimer sets were derived frompolymorphic apPCR products whichamplified 13 genetic markers that wereused to analyze all 96 individualsrepresenting the 5 basidiome clusters(Table 2).

Ribosomal DNA analysis: The rDNAITS-1 region of C. formosus DNA wasamplified with primers p1233 and p1234(White et al., 1990) using conditionsdescribed above for dpPCR. Theamplified products were precipitatedwith 0.1M NaCl and 2 volumes of 95%ethanol, incubated at RT for 60 min, andcentrifuged at 14K rpm for 5 min. Theamplified ITS regions were re-suspended in 10 mM Tris buffer (pH 8.5)and analyzed by restriction enzymeanalysis using standard protocols(Sambrook et al., 1989). PCR productswere sequenced by Northwoods DNAInc. (http://www.nwdna.com).

Data Analyses: The genetic distancebetween all pairs of individuals wascalculated as a Euclidean metric usingthe AMOVA-PREP program(http://herb.bio.nau.edu/~miller). The

resulting distance matrix was subjectedto AMOVA analysis (Excoffier et al.,1992) using WINAMOVA(http://anthropologie.unige.ch/ftp/comp)and the following variance componentcalculated: within and betweenpopulations in site 5. GenotypicDiversity was calculated using anormalized Shannon’s diversity index(Goodwin et al., 1992):

[1] Hs = -Pi lnPilnN

Where Pi is the frequency of the ithmultilocus genotype and N is the samplesize. The values for Hs range from 0 to1 where 1 reflects a populationcomprising genetically uniqueindividuals and 0 indicates a clonalpopulation (Table 2).

Results and DiscussionSampling site identification andstrategy: Site 5, was specificallychosen to determine the geneticstructure of C. formosus due to thepresence of a large number ofbasidiomes (a total of 96 sampledthroughout the season) in five spatiallydistinct clusters, with each clustercontaining 15-25 basidiomes (Figure 1 &2A). This site presented an ideal settingbecause: 1) spatially distinct clustersmay aid in the identification of geneticpolymorphisms; 2) several differentharvesting regimes could be imposedamong the five clusters; and 3) the largenumber of basidiomes per cluster wouldlend fidelity to our statistical analysis.To perform this study it was necessaryto: 1) design a non-lethal samplingtechnique, 2) use PCR analysis to verifyspecies, 3) develop high fidelity,population discriminating markers forgenetic structure analysis, and 4)address concerns regarding thepresence of contaminants in originalsamples collected.

Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13 5

Sample collection: A non-lethal,efficient, and inexpensive samplingtechnique was developed for theeffective long-term storage of tissuesamples. The estimated costs for thesample storage and processing wasless than $1 per sample and over 100samples easily processed within a fewhours. Due to the high EDTA and Trisbuffer content, the preservation bufferwas effective for the long term storageof fungal tissue at either 4C or RT.Samples stored in such a manner for10+ years were processed and nosignificant degradation of DNA observed(data not shown). As such, thispreservation buffer allows one toinexpensively collect a large number ofsamples from numerous seasons whichcan then, at some later date, beprocessed and analyzed at leisure,without fear of sample ruin. In addition,a minimal amount of tissue(approximately 20 mg) was taken frombasidiomes to avoid genetic concernsabout basidiome removal (Figure 2B). Itwas possible to collected sampleswithout displacing the fruiting bodystructures and careful footing within site5 minimized the disruption of theunderground mycelial complex(personal observations). Tissuesamples were collected near the outerrim of the pileal context resulting in atell-tale triangular-shaped mark on thebasidiome. In so doing, previouslysampled basidiomes were easilyidentified and sampling of only the newlyemerged basidiomes throughout theseason (September – November) waspossible. We chose to sample only firm,fresh basidiomes to decrease thechance of sampling tissuescontaminated with microorganisms(bacteria and/or fungal).

Species Identification: The rDNA ITS-1&2 regions of all 96 basidiome sampleswere analyzed by PCR/RFLP analysisand sequenced from 10 individuals fromeach cluster to confirm their identity as

C. formosus (data not shown). Todetermine if cluster specific differencescould be identified in the ITS-1 region,PCR amplified products were treatedwith restriction enzymes having 4 basepair (bp) recognition sequences (Cfo1,Csp61, Hae111, Hsp9211, and Msp1).The amplified products wereapproximately 1200 bp in length asanticipated (Feibelman et al., 1994) andwere digested by Csp61 and Hsp9211but not by the other three enzymes(data not shown). Although there wasno indication of cluster specific digestionpatterns with these enzymes, two ITSproducts (approx. 1000 bp and 1100 bp)were amplified from all of individuals incluster A and a single ITS product wasamplified from all of the individualsrepresenting clusters B - E (data notshown). To increase the resolution ofanalyses, the ITS-1 region of fourindividuals representing each of theclusters (B - E) that produced singlerDNA products by PCR amplificationwas sequenced. Although minordifferences were observed between theindividuals, there was one small regionof the ITS sequence that waspolymorphic between clusters.Approximately 500 bp from primer 1233(Table 1), there was a series ofadenosines that varied in number from 7- 13 between the five clusters. The fourindividuals representing clusters B - Ehad 10, 8, 7, and 13 adenosines,respectively, indicating cluster-specificdifferences in number of adenosines.The length of time required for suchcluster specific polymorphisms to beacquired is hard to determine.However, these results do indicate thatthe 5 clusters represent uniquepopulations. In the remainder of thetext, the term cluster and population willbe used inter-changeably.

Population analysis: Single primerPCR was performed on all 96basidiomes to identify polymorphicmarkers that could be used to discern

6 Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13

genets within and between populations.Two simple sequence repeat (ssr)primers identified several polymorphicand monomorphic markers (data notshown). The polymorphic markers wereisolated and sequenced to designmarker-specific primers for dpPCR(Table 1). The seven generated dpPCRprimer sets either amplified singleproducts (cf31, cf34), multiplepolymorphic products (cf28, cf30, cf33),or both monomorphic and polymorphicmarkers (cf13, cf36). The amplifiedregions were designated ssr-loci sincedpPCR primer sets were derived fromssr primers p89 & p135 (Table 1).

Analyses of 13 ssr loci and the rDNAITS regions revealed that the fiveclusters in site 5 represented distinctpolymorphic populations. Each clustercontained 2 to 6 genotypes and a totalof 15 unique genets delineated amongthe five clusters (Table 2). In addition toidentifying the clusters as distinctpopulations, several of the markerswere polymorphic among individualswithin a population. In fact, all fivepopulations showed polymorphicdifferences among the individuals withone or more markers indicating thateach population were comprised withmultiple individuals. There appeared tobe no obvious spatial relationshipsbetween polymorphic individuals withina population. Only two genotypes(genotype 2 and 4) were sharedbetween two clusters (A and C) ,however, rDNA analysis indicated thatthese populations were geneticallydistinct. Although there were individualswithin each population that had identicalgenotypes, there appeared to be little tono correlation between proximity ofindividuals with clonality (Figure 1). Asummary of genotype diversity anddistribution is presented in Table 2 andFigure 1, respectively. All of thepopulations represented uniquegenotypes although the composition anddistribution frequency varied

significantly. The highest Hs (0.51) wasobserved in Population A whichcomprised 6 genotypes and the lowestHs (0.05) was found in population Dwhich was dominated by a singlegenotype (Table 2). Several markersanalyzed were population-specific eitherby their absence or presence in all ofthe individuals from a cluster, and someintra-population monomorphic markershad population-specific patterns (Table2). The uniqueness of each populationwas also confirmed by AMOVA whichindicated that 81.41% of the observedgenetic variation was attributed to inter-population differences and 18.59% ofthe variation occurred withinpopulations. Random permutation testsindicated that the variance componentswere significant (P < 0.001; Table 3).Collectively, the genotype distributionpatterns and AMOVA results suggestthat individuals within populations aremore closely related than individualsbetween populations.

Addressing contamination concerns:It was important to ensure that thegenetic markers used in these studiesrepresented C. formosus genomes andnot other fungal or bacterialresidents/parasites of basidiome tissues(Danell et al., 1993). We addressedthese concerns by: 1) performingdpPCR on all C. formosus samples witheubacterial-specific rDNA PCR primers(p208 and p209, Table 1; DeLong,1992). Bacterial DNA was detected inless than 5% of the samples and therewas no correlation between thepresence of bacterial DNA and specificC. formosus genotype patterns and; 2)NCBI blast analysis of monomorphicand polymorphic marker sequencesrevealed no similarity to any bacterial(including several Pseudomonads) orother fungal genomes .

Our genetic analysis showed unique +/-polymorphisms occurring within each ofthese five C. formosus populations.

Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13 7

This baseline data allows us to infer onaspects of life histories, dispersal, andestablishment of these populations. Forinstance, these populations may havestarted from one or more clonalindividuals and the level ofpolymorphism detected are a result ofthe accumulation of mutations over timesince establishment. If so, this wouldimply that population D represents arecent introduction at this site and thatthe other populations were establishedat different times with population Abeing the oldest. It is also possible thatC. formosus may mutate at relativelyhigh rates in response to certainenvironmental conditions. This wouldindicate that population D had notexperienced conditions conducive tomutation. The other populations mayreflect either the magnitude of mutationinducing conditions, the number ofmutation events, or a combination of thetwo over time. Alternatively, thepopulations may have been establishedby groups of related individuals thatwere genetically polymorphic and hadlittle to no genetic exchange withadjacent populations.

The information from this singlesampling season study has allowed usto better define the genetic basis of site5, C. formosus populations in theOlympic Peninsula. To betterunderstand the dispersal, establishment,and impacts of various harvestingregimes on the health and maintenanceof these fungal populations, a long-termstudy was designed. Since individualclusters represent distinct geneticpopulations, it is important to determinepotential impacts of commercialharvesting practices and environmentalconditions on the health andsustainability of C. formosuspopulations.

Acknowledgements: We would like tothank the Olympic National Park and theWashington Department of NaturalResources for allowing us to establish

field sites for these studies. Specialthanks to David Clifton for assistance infield sampling. This research wassupported by funding from the BiologicalResources Division of the U.S.Geological Survey, Seattle, Washington.

ReferencesDanell, E., Alstroem, S., andTernstroem, A. 1993. Pseudomonasfluorescens in association with fruitbodies of the ectomycorrhizalmushroom Cantharellus cibarius.Mycological Research97, 1148-1152.

DeLong, E. F. 1992. Archaea in coastalmarine environments. Proceedings ofthe National Academy of Science 89,5685-5689.

Dunham, S. M., Kretzer, A., andPfrender, M.E. 2003. Characterization ofPacific golden chanterelle (Cantharellusformosus) genet size using co-dominantmicrosatellite markers. MolecularEcology 12, 1607-1618.

Egli, S., Ayer, F., 1997. Is it possible toimprove the production of ediblemushrooms in forest? The example ofthe mycologic reserve of Chanéaz inSwitzerland. - rev. for. France. 235-243.

Excoffier, L., Smouse, P. E., andQuattro, J. M. 1992. Analysis ofmolecular variance inferred from metricdistances among DNA haplotypes:application to human mitochondrial DNArestriction data. Genetics 131, 479-91.

Feibelman, T., Bayman, P., and Cibula,W. G. 1994. Length variation in theinternaltranscribed spacer of ribosomal DNA inchanterelles. Mycological Research 98,614-618.

Gherbi, H., Delaruelle, C., Selosse, M.A., and Martin, F. 1999. High geneticdiversity in a population of the

8 Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13

ectomycorrhizal basidiomycete Laccariaamethystina in a 150-year-old beechforest. Molecular Ecology 8, 2003-2013.

Goodwin, S. B., Spielman, L. J.,Matuszak, J. M., Bergeron, S. N., andFry, W. E. 1992.Clonal diversity and geneticdifferentiation of Phytophthora infestanspopulations in Northern and centralMexico. Phytopathology 82, 955-961.

Huai, W-X., Guo, L-D., and He, W.,2003. Genetic diversity of anectomycorrhizal fungus Tricholomaterreum in a Larix principis-rupprechtiistand assessed using random amplifiedpolymorphic DNA. Mycorrhiza 13, 265-270.

Love, T., Jones, E., and Liegel, L. 1998.Valuing the temperate rainforest: Wildmushrooming on the Olympic PeninsulaBiosphere Reserve. AMBIO 9, 16-25.

Molina, R., Pilz, D., and Smith, J. 2001.Conservation and management of forestfungi in the Pacific Northwest UnitedStates: An integrated ecosystemapproach. In Fungal Observation (edsMoore, D., Nauta, M., and Rotheror, M),Cambridge University Press,Cambridge.

Ostberg, C., and Rodriguez. R. J. 2002.Species specific molecular markersdifferentiate Oncorhynchus mykiss(steelhead and rainbow trout) fromOncorhynchus clarki clarki (coastalcutthroat trout) and identify hybridizationbetween the species. Molecular EcologyNotes 2, 197- 202.

Rodriguez, R. J. 1993. Polyphosphatepresent in DNA preparations from fungalspecies of Colletotrichum inhibitsrestriction endonucleases and otherenzymes. Analytical Biochemistry 209,291–297.

Rodriguez, R.J., Cullen, D., Kurtzman,C., Khachatourians, G., and Hegedus,D. 2004.Molecular methods for discriminatingtaxa, monitoring species, and assessingfungal diversity. In Biodiversity if Fungi:Inventory and Monitoring Methods, (edsMueller, G. M., G. F. Bills, and M.S.Foster), Elsevier Academic Press,Oxford, U.K. pp 77-102.

Saiki, R. K., Scharf, S., Faloona, F.,Mullis, K. B., Horn, G. T., Erlich, H. A.,and Arnheim, N. 1985. Enzymaticamplification of beta-globin genomicsequences and restriction site analysisfor diagnosis of sickle cell anemia.Science 230, 1350-4.

Sambrook, J., Fritsch, E. F., andManiatis, T. 1989. Molecular Cloning: ALaboratory Manual, 2nd Edition (ColdSprings Harbor, New York: Cold SpringsHarbor Laboratory).

Smith, S.E., and Read, D. J. 1997.Mycorrhizal symbiosis. AcademicPress, New York.

White, T.J., Bruns, T., Lee, S., andTaylor, J. 1990. Amplification and directsequencing of fungal ribosomal RNAgenes for phylogenetics. In PCRProtocols: A guide to Methods andApplications, M.A. Innis, D.H. Gelfald,J.J. Sninsky and T.J. White, eds. (SanDiego: Academic Press, INC), pp.315-322.

Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13 9

Table 1. Primers and annealing temperatures. aprimers with the same number wereused as forward (f) and reverse (r) primers in dpPCR, p89 and p135 were used forapPCR, and cf33 produced different products at the indicated temperatures. cf primerswere derived from polymorphic products amplified with p89 and p135. bdirection ofnucleotides.

Primera Sequence Annealing (°C)(5’>3’)b

p89 tggtggtggtggtgg 56p135 ctgctgctgctgagct 56p208(27f) agagtttgatcctggctcag 64p209(1492r) ggttaccttgttacgactt 64p1233(ITS1) tccgtaggtgaacctgcgg 54p1234(ITS2) gctgcgttcttcatcgatgc 54cf13f caatgatggggaaagcgtag 64cf13r gtaaactgggatcatgggac 64cf14f tccaacgatgggtactcttg 64cf14r gcgaaatgaagatcgttccc 64cf28f aaccacccaactcttcttgg 62cf28r ccatctgcgcacatctctaa 62cf30f ccatccgcattcatactcta 60cf30r acgaaagctgagaagcactg 60cf31f atcaagggcagttaccaagg 66cf31r ttggcccacttttggacatga 66cf33f aagtcctgcaggtctctgat 50/68cf33r cgtctctaacacattgggtg 50/68cf34f ggggactttcagagcacatt 64cf34r catcaagggcagttaccaag 64cf36f tcaatccgtgtggcttcaag 56cf36r acaagcaggttctggatgcg 56

10 Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13

Table 2. Site 5 genotype composition of 96 C. formosus basidiomes from five populations (A-E) using 13 PCR gnerated markers. Genotypes were based on the presence (1) or absence (0)of 13 dpPCR markers. Ninety-six basidiomes from 5 populations (A-E) were analyzed andfifteen genets identified. The number of basidiomes falling into each of the genet profiles (1-15)are summarized on the right. Basidiomes were categorized as the total number of individuals ofeach genotype profile (genets 1-15) from each population (A-E). Genotype compositionnumbers in large bold font represent marker profiles that are unique to a cluster and defined aspopulation discriminating markers. The genotype diversity (see text) for each population isindicated on the lower right in bold.

Genotype Composition

PCR primers cf13

cf13

cf28

cf28

cf28

cf30

cf30

cf31

cf33

cf33

cf34

cf36

cf36

Marker sizesin base pairs 14

00 700

375

625

650

400

120

0

980

400

800

105

0

550

800

Marker # 1 2 3 4 5 6 7 8 9 10 11 12 13

#Individuals/Genotype/Population

Genets A B C D E

1 1 1 0 1 1 1 0 1 1 1 1 1 1 = 52 1 1 0 1 1 1 0 1 0 1 1 1 1 = 6 53 0 1 0 1 1 1 0 1 1 1 1 1 0 = 1

4 1 1 0 1 1 1 0 1 0 1 1 1 0 = 6 135 1 1 0 1 1 1 0 1 1 1 1 1 0 = 16 1 1 0 1 1 1 0 1 0 1 0 1 0 = 1

7 1 1 1 1 1 1 0 1 1 0 1 1 0 = 11

8 1 1 1 1 1 1 0 1 0 0 1 1 0 = 4

9 1 1 0 1 1 1 1 1 0 1 1 1 0 = 1

10 0 1 0 1 1 1 0 0 0 0 1 1 0 = 1

11 0 1 0 1 1 1 0 1 0 1 1 1 0 = 1

12 1 1 0 0 0 1 0 1 0 1 1 1 1 = 1

13 1 1 0 0 0 1 0 1 0 1 1 1 0 = 24

14 1 1 0 0 1 0 1 1 1 0 1 1 0 = 6

15 1 1 0 0 1 0 1 1 0 0 1 1 0 = 9

Genotype Diversity (Hs) = 0.51 0.28 0.31 0.05 0.25

Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13 11

Table 3. Analysis of molecular variance (AMOVA) for five populations of C. formosus. df= degrees of freedom, SSD = sum of squared deviation, MSD = mean squareddeviation, P = probability after 1000 random permutations

Source of variation df SSD MSD VarianceComponent

%TotalVariance

P

Among populations 4 109.45 27.36 1.42 81.41 <0.001Within populations 91 29.51 0.32 0.32 18.59 <0.001

12 Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13

Figure 1. Spatial distribution patterns between 5 clusters of C. formosus population insite 5 and individual basidiomes within each cluster (A-E). Fifteen unique genets areindicated by different symbols. The relationship between clusters and individuals withinclusters is based on compass azimuth and distance in meters (m) with the darkhorizontal line drawn in each circle representing: Site 5 = 5 m; clusters A-D = 1 m; andcluster E = 0.25 m.

Redman et al. 2006. Genetic structure of Cantharellus formosus populations. Pacific Northwest Fungi 1(7):1-13 13

Figure 2A. Representative photo of a C. formosus population in site 5.

Figure 2B: Illustration of a representative basidiome left with a ‘tell-tale”triangular-shaped (indicated by the arrow) marking after non-lethal sampling.