Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and...

17
Genetic modifications within Genetic modifications within TLR4 TLR4 and and TLR9 TLR9 genes contribute into genes contribute into congenital toxoplasmosis and congenital toxoplasmosis and cytomegaly development cytomegaly development Wioletta Wujcicka Wioletta Wujcicka 1 1 , Jan Wilczyński , Jan Wilczyński 1,2 1,2 , Dorota , Dorota Nowakowska Nowakowska 1,2 1,2 1 Department of Fetal-Maternal Medicine and Gynecology, Polish Department of Fetal-Maternal Medicine and Gynecology, Polish Mother's Memorial Hospital Research Institute, Lodz, Poland; Mother's Memorial Hospital Research Institute, Lodz, Poland; 2 Department of Fetal-Maternal Medicine and Gynecology, III Department of Fetal-Maternal Medicine and Gynecology, III rd rd Chair of Chair of Gynecology and Obstetrics, Medical University of Lodz Gynecology and Obstetrics, Medical University of Lodz 3rd International Conference on Clinical 3rd International Conference on Clinical Microbiology and Microbial Genomics Microbiology and Microbial Genomics Valencia, Spain Valencia, Spain September 24 September 24 th th - - 26 26 th th 2014 2014

Transcript of Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and...

Page 1: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Genetic modifications within Genetic modifications within TLR4TLR4 and and TLR9TLR9 genes genes contribute into congenital toxoplasmosis and contribute into congenital toxoplasmosis and

cytomegaly developmentcytomegaly development

Wioletta WujcickaWioletta Wujcicka11, Jan Wilczyński, Jan Wilczyński1,21,2, Dorota Nowakowska, Dorota Nowakowska1,21,2

11 Department of Fetal-Maternal Medicine and Gynecology, Polish Mother's Memorial Department of Fetal-Maternal Medicine and Gynecology, Polish Mother's Memorial Hospital Research Institute, Lodz, Poland; Hospital Research Institute, Lodz, Poland; 22 Department of Fetal-Maternal Medicine and Department of Fetal-Maternal Medicine and Gynecology, IIIGynecology, IIIrdrd Chair of Gynecology and Obstetrics, Medical University of Lodz Chair of Gynecology and Obstetrics, Medical University of Lodz

3rd International Conference on Clinical Microbiology 3rd International Conference on Clinical Microbiology and Microbial Genomicsand Microbial GenomicsValencia, SpainValencia, Spain September 24 September 24thth-26-26thth 2014 2014

Page 2: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

T. gondiiT. gondii and HCMV infections within pregnancy and HCMV infections within pregnancy

CCommon cause of intrauterine infectionsommon cause of intrauterine infections

T. gondii T. gondii seroprevalence between 4% and 100% with seroprevalence between 4% and 100% with values over 60% in Central and values over 60% in Central and South America,South America, Africa and Asia Africa and Asia

HCMV prevalence between 40% and 100% dependent on the continents and countriesHCMV prevalence between 40% and 100% dependent on the continents and countries

Pappas G. (2009) Int J Parasitol. 39: 1385-1394

http

://scienceray.co

m/b

iolo

gy/th

e-parasite-to

xop

lasma-g

on

dii/

Page 3: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Role of TLRs in immune responseRole of TLRs in immune response

Transduction of signals from PAMPs to the cell interior, activation of these cells and the first line of host defense against pathogens

Important molecules activating and inducing both innate and adaptive immune response

Mis

ch E

A an

d H

awn

TR. (

2008

) Clin

Sci

. 114

(5):3

47-6

0

Ho J et al. (2004) Tannaffos. 3(11):7-14

Page 4: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Contribution of TLR2, TLR4 and TLR9 Contribution of TLR2, TLR4 and TLR9 in the immunity against in the immunity against T. gondiiT. gondii

Wujcicka W et al. (2013) Eur J Clin Microbiol Infect Dis. 32(4): 503-511

Page 5: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

TLRs activity in the immune response TLRs activity in the immune response against HCMV against HCMV

Wujcicka W et al. (2014) Pathog Dis. Dis. 70(1):3-1670(1):3-16

Page 6: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Aims of study:Aims of study:

DDeterminetermination ofation of a distribution of genotypes at a distribution of genotypes at TLR4TLR4 and and TLR9TLR9 polymorphic polymorphic sites in fetuses and newborns congenitally infected with sites in fetuses and newborns congenitally infected with T. gondiiT. gondii

Comparison ofComparison of the genotypic profiles at the genotypic profiles at TLRTLR SNPs between the offsprings SNPs between the offsprings with congenital toxoplasmosis and cytomegalywith congenital toxoplasmosis and cytomegaly

Page 7: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Materials and Methods: Collection of clinical Materials and Methods: Collection of clinical specimens from fetuses and newbornsspecimens from fetuses and newborns

Eighteen (18)Eighteen (18) fetuses and newborns with congenital fetuses and newborns with congenital toxoplasmosis and 41 control cases without toxoplasmosis and 41 control cases without T. gondiiT. gondii intrauterine infectionintrauterine infection

Samples collected Samples collected retrospectively (15 retrospectively (15 T. gondiiT. gondii infected infected cases and 23 controls) cases and 23 controls) and and prospectively (three prospectively (three T. gondiiT. gondii infected cases and 18 controls)infected cases and 18 controls)

Fifteen (Fifteen (1515)) fetuses and newborns with fetuses and newborns with HCMV HCMV infection infection and 18 control cases of HCMV-seronegative statusand 18 control cases of HCMV-seronegative status

http

://pro

top

las

mix

.wo

rdp

res

s.c

om

/tag

/tox

op

las

ma

-go

nd

ii/

Page 8: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Classification of clinical specimens for Classification of clinical specimens for molecular studiesmolecular studies

Serological screeningSerological screening::

Screening for Screening for T. gondiiT. gondii IgG and IgM IgG and IgM antibodies as well as IgG avidity performed antibodies as well as IgG avidity performed with an enzyme-linked fluorescent assay with an enzyme-linked fluorescent assay (ELFA) (Vidas Toxo IgG II; IgM; or IgG (ELFA) (Vidas Toxo IgG II; IgM; or IgG Avidity, bioMérieux, France)Avidity, bioMérieux, France)

HCMV screening with HCMV screening with Eti-Cytok G-Plus and Eti-Cytok G-Plus and Eti-Cytok M-Reverse Plus tests Eti-Cytok M-Reverse Plus tests (Diasorin/Biomedica, Italy) (Diasorin/Biomedica, Italy) used used between between 2000 and 2001, VIDAS CMV IgG and IgM tests 2000 and 2001, VIDAS CMV IgG and IgM tests (bioMérieux, France) between 2001 and 2006, (bioMérieux, France) between 2001 and 2006, anti-CMV IgG and IgM tests anti-CMV IgG and IgM tests (Diasorin/Biomedica, Italy) between 2006 and (Diasorin/Biomedica, Italy) between 2006 and 2011 years and ELFA assays from 2012 year2011 years and ELFA assays from 2012 year

Clinical symptoms observed in pregnant Clinical symptoms observed in pregnant women and their fetuseswomen and their fetuses::

Flu-like symptoms in mothersFlu-like symptoms in mothers

UUltrasound markers in fetusesltrasound markers in fetuses with with toxoplasmosis:toxoplasmosis:

hydrocephalus, chorioretinitis, cerebralhydrocephalus, chorioretinitis, cerebral calcification and strokecalcification and stroke, as well as , as well as microcephaly, hepatosplenomegaly, fetal microcephaly, hepatosplenomegaly, fetal hydrops and IUGR hydrops and IUGR

UUltrasound markers in fetusesltrasound markers in fetuses with with cytomegaly: cytomegaly:

ventriculomegaly, hydrocephalus and fetalventriculomegaly, hydrocephalus and fetalhydropshydrops as well as IUGR, ascites, as well as IUGR, ascites, pericardial effusion, cardiomegaly and pericardial effusion, cardiomegaly and the the presence of hyperechogenic foci in different presence of hyperechogenic foci in different organs likeorgans likethe fetal brain, liver and pancreasthe fetal brain, liver and pancreas

Page 9: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Detection and quantification of Detection and quantification of T. gondiiT. gondii and and HCMV DNAHCMV DNA

LocusGene Sequences of primers and probe (5' →3’) GenBank Annealing

temperature (oC)PCR product

(bp)

AF 179871B1

CAAGCAGCGTATTGTCGAGTAGATGCGTCTCTTTCATTCCCACATTTT

6-FAM- CAGAAAGGAACTGCATCCGTT-NFQ

AF 179871 60 83

Amplification of HCMV Amplification of HCMV UL55UL55 gene fragments of 150 bp using primers and probes of gene fragments of 150 bp using primers and probes of the following sequences: the following sequences: 5’-GAGGACAACGAAATCCTGTTGGGCA-3’, 5’-GAGGACAACGAAATCCTGTTGGGCA-3’,

5’-TCGACGGTGGAGATACTGCTGAGG-3’, and5’-TCGACGGTGGAGATACTGCTGAGG-3’, and 5’-6-FAM-CAATCATGCGTTTGAAGAGGTAGTCCA-TAMRA-3’5’-6-FAM-CAATCATGCGTTTGAAGAGGTAGTCCA-TAMRA-3’

Page 10: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Genotyping of SNPs located at Genotyping of SNPs located at TLR4TLR4 and and TLR9TLR9 genesgenes

Sequencing of randomly selected PCR products for distinct genotypes at Sequencing of randomly selected PCR products for distinct genotypes at TLR4TLR4 896 A>G, 896 A>G, TLR4TLR4 1196 C>T and 1196 C>T and TLR9TLR9 1635 G>A SNPs 1635 G>A SNPs

GeneGene SNP nameSNP name Primer sequences (5'-3')Primer sequences (5'-3')Annealing Annealing

temperature temperature

[[ooC]C]

Amplicon Amplicon

length length

(bps)(bps)

Restriction Restriction

enzymeenzymeProfile (bps)Profile (bps)

TLR4TLR4 896 A>G896 A>G ExternalExternal For: AAAACTTGTATTCAAGGTCTGGCFor: AAAACTTGTATTCAAGGTCTGGC5252 355355

NcoINcoI AA: 188AA: 188

AG: 188, 168, 20AG: 188, 168, 20

GG: 168, 20GG: 168, 20

(rs4986790)(rs4986790) Rev: TGTTGGAAGTGAAAGTAAGCCTRev: TGTTGGAAGTGAAAGTAAGCCT

InternalInternal For: AGCATACTTAGACTACTACCTCCATGFor: AGCATACTTAGACTACTACCTCCATG6161 188188

      Rev: AGAAGATTTGAGTTTCAATGTGGGRev: AGAAGATTTGAGTTTCAATGTGGG

1196 C>T1196 C>T ExternalExternal For: AGTTGATCTACCAAGCCTTGAGTFor: AGTTGATCTACCAAGCCTTGAGT5252 510510

HinfIHinfI CC: 407CC: 407

CT: 407, 378, 29CT: 407, 378, 29

TT: 378, 29TT: 378, 29

(rs4986791)(rs4986791) Rev: GGAAACGTATCCAATGAAAAGARev: GGAAACGTATCCAATGAAAAGA

InternalInternal For: GGTTGCTGTTCTCAAAGTGATTTTGGGAGAAFor: GGTTGCTGTTCTCAAAGTGATTTTGGGAGAA5959 407407

         Rev: ACCTGAAGACTGGAGAGTGAGTTAAATGCTRev: ACCTGAAGACTGGAGAGTGAGTTAAATGCT

TLR9TLR9 1635 G>A1635 G>A ExternalExternal For: GTCAATGGCTCCCAGTTCCFor: GTCAATGGCTCCCAGTTCC5252 292292

BstUIBstUI GG: 135, 42GG: 135, 42

GA: 177, 135, 42GA: 177, 135, 42

AA: 177AA: 177

(rs352140)(rs352140) Rev: CATTGCCGCTGAAGTCCARev: CATTGCCGCTGAAGTCCA

InternalInternal For: AAGCTGGACCTCTACCACGAFor: AAGCTGGACCTCTACCACGA5959 177177

         Rev: TTGGCTGTGGATGTTGTTRev: TTGGCTGTGGATGTTGTT

Page 11: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Agarose gel electrophoresis of PCR-RFLP products for profiling of genotypes at Agarose gel electrophoresis of PCR-RFLP products for profiling of genotypes at TLR4TLR4 896 A>G SNP ( 896 A>G SNP (AA), ), TLR4TLR4 1196 C>T SNP ( 1196 C>T SNP (BB) and ) and TLR9TLR9 1635 G>A SNP ( 1635 G>A SNP (CC))

Results: Products of multiplex nested PCR-RFLP Results: Products of multiplex nested PCR-RFLP analysis of analysis of TLR4TLR4 and and TLR9TLR9 SNPs SNPs

Page 12: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Chromatograms for DNA fragments encompassing Chromatograms for DNA fragments encompassing TLR4TLR4 896 A>G SNP ( 896 A>G SNP (A, BA, B), ), TLR4TLR4 1196 1196 C>T SNP (C>T SNP (C, DC, D) and ) and TLR9TLR9 1635 G>A SNP ( 1635 G>A SNP (E-GE-G))

Sequencing of the selected amplicons for Sequencing of the selected amplicons for TLR4TLR4 and and TLR9TLR9 SNPs SNPs

Page 13: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Relationship between Relationship between TLRTLR polymorphisms and polymorphisms and congenital toxoplasmosis congenital toxoplasmosis

Gene polymorphismGene polymorphism Genetic modelGenetic model GenotypeGenotype

Genotype frequencies; n (%)Genotype frequencies; n (%)aa

ORORbb (95% CI) (95% CI)cc PP-value-valuedd

Infected casesInfected casesSeronegative Seronegative

controlscontrols

TLR4TLR4 896 A>G 896 A>G

------

AAAA 17 (94.4%)17 (94.4%) 19 (95%)19 (95%) 1.001.00

0.940.94AGAG 1 (5.6%)1 (5.6%) 1 (5%)1 (5%) 1.12 (0.06-19.28)1.12 (0.06-19.28)

TLR4TLR4 1196 C>T 1196 C>T

------

CCCC 17 (94.4%)17 (94.4%) 18 (90%)18 (90%) 1.001.00

0.610.61CTCT 1 (5.6%)1 (5.6%) 2 (10%)2 (10%) 0.53 (0.04-6.39)0.53 (0.04-6.39)

TLR9TLR9 1635 1635 G>AG>A

CodominantCodominant

AAAA 3 (16.7%)3 (16.7%) 8 (40%)8 (40%) 1.001.00

0.2300.230

GAGA 11 (61.1%)11 (61.1%) 10 (50%)10 (50%) 2.93 (0.60-14.23)2.93 (0.60-14.23)

GGGG 4 (22.2%)4 (22.2%) 2 (10%)2 (10%) 5.33 (0.62-45.99)5.33 (0.62-45.99)

DominantDominant

AAAA 3 (16.7%)3 (16.7%) 8 (40%)8 (40%) 1.001.00

0.1100.110GA-GGGA-GG 15 (83.3%)15 (83.3%) 12 (60%)12 (60%) 3.33 (0.72-15.37)3.33 (0.72-15.37)

RecessiveRecessive

AA-GAAA-GA 14 (77.8%)14 (77.8%) 18 (90%)18 (90%) 1.001.00

0.3000.300GGGG 4 (22.2%)4 (22.2%) 2 (10%)2 (10%) 2.57 (0.41-16.12)2.57 (0.41-16.12)

OverdominantOverdominant

AA-GGAA-GG 7 (38.9%)7 (38.9%) 10 (50%)10 (50%) 1.001.00

0.4900.490GAGA 11 (61.1%)11 (61.1%) 10 (50%)10 (50%) 1.57 (0.43-5.71)1.57 (0.43-5.71)

Log-additiveLog-additive ------ ------ ------ 2.40 (0.83-6.95)2.40 (0.83-6.95) 0.0900.090

aa n, number of tested fetuses and newborns; n, number of tested fetuses and newborns; bb OR, odds ratio; OR, odds ratio; cc 95% CI, confidence interval; 95% CI, confidence interval; dd logistic regression logistic regression model;model; P P≤0.050 is considered as significant≤0.050 is considered as significant

Page 14: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Frequencies of alleles at Frequencies of alleles at TLR4TLR4 and and TLR9TLR9 SNPs SNPs

Gene polymorphismGene polymorphismNo.No.aa of carriers with of carriers with TLRTLR alleles (%) alleles (%)

PP-value-valuebbCongenital Congenital

toxoplasmosistoxoplasmosisSeronegative Seronegative

controlcontrol

TLR4TLR4 896 A>G 896 A>G

AllelesAlleles AA 35 (97.2)35 (97.2) 39 (97.5)39 (97.5)0.9400.940

GG 1 (2.8)1 (2.8) 1 (2.5)1 (2.5)

TLR4TLR4 1196 C>T 1196 C>T

AllelesAlleles CC 35 (97.2)35 (97.2) 38 (95.0)38 (95.0)0.6190.619

TT 1 (2.8)1 (2.8) 2 (5.0)2 (5.0)

TLR9TLR9 1635 1635 G>AG>A

AllelesAlleles GG 19 (52.8%)19 (52.8%) 14 (35.0%)14 (35.0%)0.1180.118

   AA 17 (47.2%)17 (47.2%) 26 (65.0%)26 (65.0%)

aa No., number; No., number; bb Pearson's Chi-squared test; P ≤ 0.050 is considered as significant Pearson's Chi-squared test; P ≤ 0.050 is considered as significant

Page 15: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Genotypic profiles at Genotypic profiles at TLR4TLR4 and and TLR9TLR9 SNPs in SNPs in congenital toxoplasmosis and cytomegalycongenital toxoplasmosis and cytomegaly

Significantly less frequent GC Significantly less frequent GC haplotype at haplotype at TLR4TLR4 SNPs in congenital SNPs in congenital toxoplasmosis than in cytomegaly (toxoplasmosis than in cytomegaly (PP≤0.0001)≤0.0001)

GC haplotype at GC haplotype at TLR4TLR4 SNPs and multiple GCG genotypes at SNPs and multiple GCG genotypes at TLR4TLR4 and and TLR9TLR9 SNPs significantly more frequent in SNPs significantly more frequent in congenitally congenitally infected than infected than control cases (control cases (PP≤0.0001)≤0.0001)

Page 16: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

ConclusionsConclusions

Genetic modifications within Genetic modifications within TLR4TLR4 and and TLR9TLR9 genes might genes might contribute to congenital toxoplasmosis and cytomegalycontribute to congenital toxoplasmosis and cytomegaly

Page 17: Genetic modifications within TLR4 and TLR9 genes contribute into congenital toxoplasmosis and cytomegaly development Wioletta Wujcicka 1, Jan Wilczyński.

Thank You for Your attention!Thank You for Your attention!