Genetic Manipulation: from sequence to gene functionlesaux/621/ewExternalFiles/JU Lecture...
Transcript of Genetic Manipulation: from sequence to gene functionlesaux/621/ewExternalFiles/JU Lecture...
Genetic Manipulation: from sequence to gene function
and beyond
Johann UrschitzInstitute for Biogenesis Research
University of Hawai’i at Manoa
Institute for Biogenesis Research
§ Sperm structure and function
§ Mammalian cloning
§ Transgenesis
§ Gene Editing
Transgenesis
• Passive transgenesis: DNA repair mechanism of oocyte inserts transgene. Rare event.
• Active transgenesis: Enzymes produced by the vector insert the transgene enzymatically into the host genome.
Definitions
Passive transgenesis - relies on oocyte DNA repair mechanism
First Effective Transgenesis Method
Pronuclear microinjection
(Gordon et,al,. 1980)
• Harvest embryos from mice
• Inject DNA into pronuclei
• Transfer embryos to surrogate mothers
• Analyze pups
• Breed
Linear transgene
Pronuclear microinjection
• Integration occurs at a frequency of between 10-30% of cells in which the transgene DNA is delivered to the nucleus.
• Integration occurs at one or, rarely, a few chromosomal sites per nucleus by Non Homologous Recombination.
Main features of randomly integrated exogenous DNA
Problems with PNI
Concatamer formation
• Integrated DNA very often in the form of a concatamer(multicopy array).
• The vast majority of arrays consist of head-to-tail associations.
Increases likelihood of transgene silencing
Concatamer formation
Problems with PNI(And other passive TG methods)
Chimerism
Chimeric a mutation in Cetn1 gene.
ICSI Transgenesis (invented at IBR)
Passive transgenesis-relies on oocyte DNA repair mechanism
Linear transgene is also integrated randomly
+
Preparations for ICSI
In order for ICSI to succeed sperm must be prepared:
Stop the movement of sperm, and make them “sticky” to allow the adhesion of transgene DNA
+
Sperm heads treated with
Tissues beneath plasma membrane are basic in charge (protamines)
Therefore (+ in charge)
This oneA) Fresh, B) Triton X-100, C) Freeze-thawing, D) Freeze-drying
Chromosome Spreads of Oocytes Injected with CTL and F/T
Spermatozoa
Problems with ICSI
Southern blot
Concatamer formation
Lentivirus Mediated Transgenesis(Lois et,al,. 2002)
Paw
Heart
Kidneys
Face
Brain
Liver
Active transgenesis: relies on viral insertion enzymes
• During Lentiviral transgenesis
• 73% of embryos do not make it to term
• However, of the 27% surviving embryos
80% are transgenic
Therefore 23% of oocytes injected
Lentiviral Summary
Efficiencies of Current Types of Transgenesis
Pronuclear Microinjection (passive tg) ~0.1 to 3.4%
ICSI Transgenesis (passive tg) ~2.0 to 4.6%Advantage over pronuclear is the insertion of large transgenes
Lentiviral (active tg) ~23.0%Small transgene size, 9.5kb maximum
Percent of embryos or oocytes injected resulting in transgenic pups
Transposon-mediated trangenesis
• Eukaryotic Transposable Elements (TEs) are ubiquitous and widespread mobile genetic elements (MGEs)
• Approximately 45% of the human genome consists of MGE• Major players in genome evolution and in species
diversification
Active Transgenesis
Class I elements include retrotransposons: copied via an RNA intermediate and inserted elsewhere through enzymes such as integrase.Examples: LINEs and SINEs
Class II elements (transposons): cut from their original location by transposases and then inserted into a new location (cut and paste)
Transposons
Effects of TEs on host genome• Little or no impact on gene function.
• Deleterious effect on host genome results in disease.
• Sixty five diseases caused by TE insertions have been documented
• Retrotransposons are currently still active and would cause reproduction of inserted genes
• Three percent of the human genome consists of DNA transposons which used a cut-and-paste mechanism for mobilization within the genome.
• DNA transposons were active in primate evolution, but they do not currently have mobile activity in the human genome.
Effects of TEs on host genome
TRE TRE
Cut and
Paste
Transposase
Class II transposons
Transposition
ATGCAGCTAGATTAATCTTTTCTTAC
Transposition
ATGCAGCTAGATTAATCTTTTCTTAC
Transposition
ATGCAGCTAGATTAATCTTTTCTTAC
Transgene integration
Helper-independent self inactivating pmGENIE-3 vector
TTAA TTAA
piggyBac inserts into TTAAregions in host cell DNA
AA TT
AA TT
piggyBac transposase leaves no footprint when excised from the site of insertion
AA AATT TTTRE TRE
• te-Pronuclear microinjection (active tg) ~ 50%
• Pronuclear microinjection (passive tg) ~0.1 to 5.0%
Embryos injected/Transgenic animals
Efficiencies of pronuclear and te-pronuclear microinjection
DBD-directed transposition to CCR5
TALE
TALE recognition seq
TTAA
PB
5'TRE
CMV
GIN
3'TRE
CCR5
Transposase fusions
DBD
6
A Revolutionary Genetic Tool
Cre-lox system
Natural part of P1 bacteriophage viral life cycle
Viral DNA injected into bacteria, circularized using Cre-lox, and replicated for development of new viruses
Cre
Cre-Lox System
A Simple, Two Component System Cre recombinase
Site-specific enzyme, catalyzes recombination between two LoxP sites
loxP site 34 base pair DNA sequence
Location and orientation determines recombination result: o Deletion o Inversion o Translocation
Reviewed in: Nagy A. 2000. Genesis 26(2):99-109. PMID:10686599
ATAACTTCGTATA-NNNTANNN-TATACGAAGTTAT
Abundant possibilities for genome manipulation!
Cre
9
Cre-Lox System
Mechanism: Cre-lox Deletion Floxed target gene
Knockout allele
X
GeneX
LoxP
GeneX
LoxP LoxP GeneX
LoxP
Cre excision
10
Cre-Lox System
Tissue-Specific Knockout Breeding
JAX® Mice |
13
Alb cre
GeneX loxP loxP
GeneX
Cre-lox mouse: Heterozygous for knockout (1st generation)
Alb cre
GeneX
GeneX
Liver-specific Cre B6.Cg-Tg(Alb-cre)21Mgn/J 003574
x Homozygous floxed
GeneX loxP loxP
GeneX loxP loxP
Cre-Lox System
x Homozygous floxed
GeneX loxP loxP
GeneX loxP loxP
Tissue-Specific Knockout Breeding
15
25% homozygous for knockout (2nd generation)
Alb cre
GeneX loxP loxP
GeneX loxP loxP
Alb cre
GeneX loxP loxP
GeneX
Hemizygous Alb-cre Heterozygous floxed
Cre-Lox System
Endonucleases-based gene editing
• Introduce double/single stranded breaks at specific sequences
• Offer much more control over the integration site than viral vectors
• Utilize endogenous eukaryotic DSB repair mechanism:– Non-Homologous End-Joining (NHEJ)– Homology Directed Repair (HDR)
genomic DNA 5’3’
3’5’
DSB repair mechanisms
Non-Homologous End-Joining (NHEJ) Homology Directed Repair (HDR) efficient but error prone high-fidelity repairin dividing and non-dividing cells only in dividing cells
NHEJ HDR
Non-Homologous End-Joining (NHEJ)
Homology Directed Repair (HDR)
Zinc finger nucleases• Consists of an array (3-6) of zink finger proteins and
FokI nuclease• Zinc fingers common in eukaryotes – for trx regulation• Highly specific DNA binding (each Zf recognizes 3bp
sequence)• FokI dimerizes and cuts DNA upon binding of 2 ZFN
monomers• Difficult to engineer – architecture dependent • Off-target mutagenesis (10%)
Adapted from: LaFountaine et al.: Delivery and therapeutic applications of gene editing technologies
Transcription activator-like effector nucleases
• Largely similar in composition (33-35aa) except for positions 12 and 13
• 1:1 binding affinity: each TALE has specific domains for either A,C,T or G
• Consists of tandem arrays of TALE proteins and FokInuclease
• TALENs are easier to design and fewer constraints on site selection
• TALENs are large (>3kb) compared to ZFNs (1kb) • Off-target mutagenesis, but less than ZFNs
Adapted from: LaFountaine et al.: Delivery and therapeutic applications of gene editing technologies
CRISPR/Cas9• Clustered regularly interspaced short
palindromic repeat• Part of the bacterial defense system• consists two components: • a guide RNA (gRNA or sgRNA): a
short RNA composed of a scaffold sequence necessary for Cas-binding and a target-specific ∼20 nucleotide spacer that specifies the genomic target
• Cas protein introduces double strand break 3-4 nucleotides upstream of PAM
CRISPR/Cas9• The CRISPR array and the
tracrRNA are transcribed into a long pre-crRNA and tracrRNA.
• These two RNAs hybridize via complementary sequences and are processed to shorter forms by Cas9 and RNase III.
• Cas9 protein and the gRNA form a ribonucleoprotein complex through interactions between the gRNA scaffold and surface-exposed positively-charged grooves on Cas9.
CRISPR/Cas9
• gRNA recognizes and hybridizes to target site
• Cas9 undergoes a conformational change upon gRNA binding -> shift from inactive, non-DNA binding conformation into an active DNA-binding conformation
• Cas binds to PAM
CRISPR/Cas9• Once the Cas9-gRNA complex
binds, the seed sequence anneals to the target. Next, non-seed will anneal
• Cas9 will only cleave if the gRNA spacer sequence shares sufficient homology with target
• Cas9 contains two domains, HNH and RuvC, which cleave, respectively, the com-plementary and non-complementary strands
• Creates blunt ends 3-4 ntupstream of PAM
PAM Sequence• The PAM sequence is essential for target
binding, but the exact sequence depends on Cas used
NHEJ by Cas• The most active repair mechanism
• Most often gives rise to small indels that result in deletions, insertions, or frameshift mutations leading to premature stop codons
• The ideal end result is a loss-of-function mutation within the targeted gene.
• Randomness of NHEJ-mediated repair has important practical implications, because a population of cells expressing Cas9 and a gRNA will result in a diverse array of mutations
HDR by Cas• DNA repair template must be delivered
with gRNA(s) and Cas. • Must contain additional homologous
sequence (homology arms) • Repair template may be a ss oligo, ds
oligo, or a plasmid.
• Low efficiency (<10%)• However: efficiency of Cas9 cleavage is
relatively high but efficiency of HDR is relatively low
• ->large portion of DSBs will be repaired via NHEJ. ->the resulting population of cells will contain some combination of wild-type alleles, NHEJ-repaired alleles, and/or t desired HDR-edited allele.
CRISPR/Cas9
• a D10A mutant of SpCas9, retains one nuclease domain and generates a DNA nick rather than a DSB.
• two nickases targeting opposite DNA strands are required to generate a DSB within the target DNA
• dramatically increases target specificity
Adapted from: LaFountaine et al.: Delivery and therapeutic applications of gene editing
Cas9 nickase
High fidelity Cas9
• eSpCas9(1.1) contains alanine substitutions that weaken the interactions between Cas9 and the non-target DNA strand, preventing strand separation
• SpCas9-HF1 lowers off-target editing through alanine substitutions that disrupt Cas9's interactions with the DNA phosphate backbone.
• HypaCas9, contains mutations in the REC3 domain that increase Cas9 proofreading and target discrimination.
CRISPR/Cas9 genome editing can result in unwanted changes at non-target sites
Dead Cas9• RuvC and HNH nuclease domains can be rendered inactive
by point mutations (D10A and H840A in SpCas9)
• resulting dead Cas9 (dCas9) molecule that cannot cleave target DNA
• retains the ability to bind to target DNA based on the gRNA targeting sequence
flexible tool for genome manipulation
Dead Cas9
• dCas9 fused directly to a single transcriptional activator (V64 of KRAB)
• epitope-tagged dCas9 and antibody-activator effector proteins (e.g. SunTag)
• fusion to several different activation domains
• additional RNA-binding helper activators
Activation or Repression of Target Genes
Reversible manipulation
Dead Cas9
• Fusion to epigenetic modifiers like p300 and TET1
Advantage: persistence and inheritance epigenetic marks may be more frequently inherited by daughter cells.
Epigenetic Modifications
Other CRISPR/Cas9 Applications
• DNA base editors: fuse Cas9 to a cytidine deaminase like APOBEC1
• RNA base editors: converts adenosine to inosine (inosine is functionally equivalent to guanosine ->A->G)
• forward genetic screening
• …..
CRISPR/Cas9
• Nickase (Cas9D10A)• dCas9• CRISPRi• CRISPRa• CRISPR-Cpf1
Adapted from: LaFountaine et al.: Delivery and therapeutic applications of gene editing
Gene therapy
Gene therapy
Transgene Delivery Strategies• Ex vivo• In vivo• Viral• Non-viral
https://www.ncbi.nlm.nih.gov/
Viral delivery
Viruses are gene delivery machines• Viral vectors Commonly used in clinical trials:
– Adenoviral vectors (large cargo, no integration)
– Retroviral vectors (poor titer, integration into promoters)
– Adeno-associated virus (AAV) vectors (infect dividing and non-dividing cells, small cargo)
– Lentiviral vectors (integrate preferentially into introns of transcriptionally active genes in dividing and non-dividing cells
Summary virus-based approaches• High transduction efficiency• Natural mechanism for nuclear import of
genes• Immune response• Loss of transgene expression• Complications in its construction and
production• Random integration may cause insertional
mutagenesis • Limited cargo capacity
Non-viral vectors
• Do not elicit immune response and are less cytotoxic
• Large cargo size (100+kb)• Ease of synthesis and quality control• Can be modified to improve nuclear
import, endosomal escape and target specificity
• Limited in vivo transfection efficiency
• Endonucleases
• Transposases
Non-viral vectors
Maternal Nutritional Imbalance
• Maternal obesity• Fetal growth restriction and IUGR• Effects on fetal development• Effects on long-term health of the offspring • Underlying molecular mechanisms
Placenta• Important for health of mother and fetus during pregnancy
• But also lifelong health of both
• Unique agent of human symbiosis
• Interface between the fetal and maternal circulation
• Key function: supply nutrients to the fetus
• Other functions: fetal renal, respiratory, hepatic, endocrine and immune system
The Placenta
ExtravillousSpace
MVM(maternal)
Amino Acids
BM(fetal)
Fatty AcidsGlucose
GLUTs
LATs
FATPsFABPs
SNATs
Fetal Capillary
Syncytium
Transfer of glucose, amino acids and fatty acids• microvillous membrane (MVM)• basal plasma membrane (BM) of synctytiotrophoblast
Chorionic villi
IntervillousSpace:Filled with maternal blood
Synctytiotrophoblast
Source: Gaccioli and Lager (2016). Placental Nutrient Transport and Intrauterine Growth Restriction.
Options For Intervention
Blood flowNutrient concentration gradient
Placental consumption Transporters or receptors
Maternal-fetal flux
Questions
• Can we modulate placental nutrient transport in vivo?
• Will the modulation attenuate abnormal fetal growth and the subsequent development of metabolic syndrome in the offspring?
Maternal Overweight & ObesityObesity USA: 40% of Adults, even higher in NHPI and Native Alaskans
Consequences of Maternal Overweight & Obesity
• increased risk of GDM and preeclampsia• associations with abnormal intrauterine growth• development of adult obesity and metabolic syndrome
Maternal Obesity
Fetal-Neonatal Obesity
Childhood Obesity
Adult Obesity
• no fetal gluconeogenesis: maternal circulation is only source for fetoplacental glucose
• transporter-mediated facilitated diffusion down the maternal – fetal plasma concentration gradient
• GLUT 1 is the predominant isoforms expressed in the human term placenta
• Glut1 in the placenta has been shown to be upregulated in maternal obesity
Glucose
Current Options For In Vivo Gene Modulation Of The Placenta
• Whole-body gene manipulations - transgenic mice via PNI or ICSI
• Placenta-specific gene manipulations via Cre-lox P
• Lentiviral transduction of blastocysts
Plasmid Design
• piggyBac-based vector (hypmGENIE3)
• Docycycline (Dox) inducible Transgene Expression
• CYP19I.1: Promoter for trophoblast specific gene expression
• Luciferase reporter gene
• Glut1 knockdown via shRNAmir
Glut1 KD Cassette CYP19I.15’TRE 3’TREpB pB cont.
transposon
TRE3G---GL3---shRNAmir---CYP19I.1---rtTA3
Trophoblast-specific KDLu
cife
rase
leve
ls
0100000200000300000400000500000600000
Cyp -501
Cyp -795
NTCADA - 501 CYP -795 CYP NTC
Cyp19-GL3 expression, NTC level set to 0.
N=33T3BeWo
00.20.40.60.8
11.2
328
331
403
405
719 M Sc
NTCmR
NA
leve
ls
normalized to b-actin, level of M = 1
* *
shRNAmir constructs match Glut1 transcript 100% at the Specificity-Defining Region
Glut1 protein knockdown Clone 403
Glut1& b(Ac+n&
M& SC&SI& SI& SC&M&
M=mock transfection, Sc=transfection with scrambled shRNA
BeWo
BeWo
NIH 3T3
Dox - Dox + Dox - Dox +
Sonoporation or UTMD is the use of ultrasound and ultrasound contrast agent to modifying the permeability of the cell membrane for the transfer of DNA
• Microbubbles (MB) are positively charged, gas-filled lipid shells
• Coupled electrostatically to negatively charged pDNA
Sonoporation
• Ultrasound close to MB resonance frequency introduces MB oscillation and cavitation
• Induces microjets, fluid streams, and shock waves,
• Produce localized plasma membrane pores and generates prolonged intercellular gaps
Source:: Delalande et al. 2013 Sonoporation: Mechanistic insights and ongoing challenges for gene transfer
Sonoporation
Sonoporation
• Mice were injected with microbubble/pDNA solution
• US was applied along one side of uterine horn
• At 24h, luciferase expression was visualized by IVIS
• Mice with positive Luc signal were sacrificed, dissected and imaged again
US + + + + -
Mb/pDNA/Dox
Dox-induced Transgene Expression
Uterine hornIVIS luminescence assay
GL3+/Dox+/24h
Glut1 KD mouse
Heart, liver & kidney
ovaryuterine horn
heartliver
kidneys
Dox-induce Transgene Expression
US/Mb/pDNA/Dox+ US/Mb/pDNA/Dox+
Reduction of Glut1 (preliminary)After 24h: overall ~ 20% • basal membrane ~ 40% • microvillous membrane ~ 10%
Conclusion
• We developed an alternative approach for in vivo gene modulation in the placenta
• Has the potential to be used in humans• Achieved placenta specific expression of the transgene• Placenta specific knock-down of Glut1
• Next steps will include:– Complete evaluation of:
• Transgene expression distribution• Extent of Glut1 KD
– Move to model of maternal obesity
Acknowledgements
University of HawaiiMarlee ElstonHaide RazavyKainalu MathewsLance Nunes
Stefan MoisyadiSteve Ward
Funding: NIGMS 5P20GM103457
University of ColoradoFredrick RosarioThomas Jansson
The End
shRNAmir
• shRNA expressed from a miR-30 context.
• Allows for pol II promoter usage
• Processing via endogenous miRNA biosynthetic pathway
• U6 promoter: sequences immediately upstream of U6 are critical for precise TX initiation (starts precisely at first A/G within −1 to +2).
mir-30 loopmir-30 context
Graphs from Thermo Scientific