Genetic Isolates in Human Populations.understanding of the genetic structure of human populations;...

72
Genetic Isolates in Human Populations. How and why studying them?

Transcript of Genetic Isolates in Human Populations.understanding of the genetic structure of human populations;...

Page 1: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Genetic Isolates in Human Populations.How and why studying them?

Page 2: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Identifying signatures of genetic isolation is more challenging in humans than in other animal species.

Page 3: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Evolutive tree of X chromosome (Kaessmann et al. 2001).

Genetic diversity at molecular level is smaller among humans than in other primates

Page 4: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping genes for rare monogenic disorders and complex diseases.genetic isolation in humans is often hypothesized to be associated with cultural diversity;

Importance of genetically human isolates

Page 5: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Very important in

Anthropology

PopulationGenetics

MedicalGenetics

peopling events, past migrations, demographic behavior, and cultural and linguistic features

identifying the factors that account for genome variation (e.g., assortativemating, genetic drift, bottleneck effect)

Monogenetic diseases, complex diseases

Page 6: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

What is a genetic isolate?

Genetic isolates are subpopulations derived from a small number of founders that have been isolated, resulting from geographical and/or cultural barriers, for many generations with a very restricted genetic exchange with other subpopulations

Page 7: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Characteristics of isolated population

Characteristics of isolated population:

limited number (10-100) of founders.

Isolation because cultural or geographic barriers

homogeneity of the shared environmental factors

Access genealogical records

reduced phenotypic and genetic heterogeneity

limited number of recombination events in the DNA (increase LD)

Page 8: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Isolated populations, such as Finnish, Old Order Amish, Jewish, Sardinian, have proved to be invaluable resources for mapping genes involved in rare diseases that show a Mendelian recessive mode of inheritance

Page 9: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

The plant and animal biodiversity found on Italian territory is among the richest in the Mediterranean basin and in Europe as a whole.

Number of mammals species

Number of endemic mammals species

Page 10: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Tundra alpina

Zona arida mediterranea

Page 11: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Does the great variety observed in Italy for plants and animals hold for human

populations?

Page 12: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping
Page 13: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping
Page 14: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Linguistic minorities in Italy

At present, 12 ethno-linguistic minorities are officially recognized and safeguarded by the Italian legislation: Albanian, Catalan, Croatian, French, Franco-provençal, Friulian, German, Greek, Ladin, Occitan, Slovene and Sardinian .Other minorities are recognized only by Regional legislation (Tabarkino, Veneto, Piemontese)

Page 15: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

PROGETTI DI INTERESSE NAZIONALE (PRIN)

Isolating the isolates: analisi dei fattori geografici e culturali della variabilità genetica umana

PRIN 2007

La Biodiversità umana in Italia: patterns microevolutiviPRIN 2009

Page 16: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Prof. Davide Pettener Prof. Giovanni Destro Bisol

Prof. Giuseppe VonaProf.ssa Carla Calò

Prof. Giorgio PaoliDr. Sergio Tofanelli

Università di Cagliari Università di Pisa

Page 17: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Y Chromosome Y mtDNA

Uniparental markers

Page 18: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

HVRI and HVRII

>Ind1TATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGC

Page 19: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Y-STRs

Page 20: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping
Page 21: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

•Born and resident for at least3 generations (grandparentsrule)

•Founder surnames

Sampling

Page 22: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

57 populations

10 populations under geolinguistic isolation

16 populations under geographicisolation

3 popolations under linguisticisolation

28 open populations

Page 23: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

• Italian and European open population

Page 24: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping
Page 25: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Linguistic, geographic and genetic isolation in Italian populations

Lower values of HD for isolated populations, particolarly for Sappada, Ogliastra

Lower values of HD for isolated populations, particularly for Luserna, Timau and Sappada

Page 26: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Higher values of Fst for isolated populations,Particularly significative for Sappada, Vallepietra and Sauris

Higher values of Fst for isolated populations,Particularly for Luserna, Timau and Sappada

Linguistic, geographic and genetic isolation in Italian populations

Page 27: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Italian isolates analysed through mtDNA

Page 28: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Italian isolates analysed through Y-STRs

Page 29: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

AMOVA (within group) y

Italy without isolates 0.38%

Europe withoutisolates

0.33%

Italy with isolates 1.89%

Europe with isolates 1.52%

AMOVA (within group) mtDNA

Italy without isolates 3.19%

Europe withoutisolates

6.89%

Italy with isolates 8.95%

Europe with isolates 10.60%

Page 30: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

AMOVA (within group)

Italiani senza isolati 0.38%

Europei senza isolati 0.33%

Italiani con isolati 1.89%

Europei con isolati 1.52%

AMOVA (within group)

Italiani senza isolati 3.19%

Europei senza isolati 6.89%

Italiani con isolati 8.95%

Europei con isolati 10.60%

Page 31: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

• Strong genetic variability in Italy, greater than Europe, particularly for mtDNA

• Italian human genetic variability shows a pattern similar to what was observed forplants and mammalians

Conclusion

•In Italy numerous populations with evident sign of genetic isolation are present

• These signs are more frequent in populations under geographic and linguisticisolation

Page 32: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Case study: The Arbereshe: between Italy and the Balkans

One of the most numerous linguistic minorities in Italy50 comunities with around 100,000 individuals

Arbereshe from Calabria30 comunities with ~ 60000 individuals

Arbereshe from Sicily3 comunities with ~ 15000 individuals

Language: Arbereshe (albanian)Religion: orthodox christianOrigin: south Albania (Toskeria)Arrive in Italy: 1400-1500 A.D.

Page 33: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

The Arbereshe are one of the largest linguistic minorities settled in Italy. They originated from migratory waves from Albania between the end of the 15th and beginning of the 16th century in response to the invasion of the Balkans by the Ottoman Empire.

Page 34: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Signes of isolation

ReligionLanguageSurname analysis

Arbereshe populations are clearly distinguishable from their Italian neighboursArbereshe groups showed considerably higher maritalisonymy levels than in Italians (0.080 vs 0.050). All these lines of evidence suggest that Arbereshe are a groupof populations that have undergone cultural isolation

Page 35: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Haplotype diversity

Calabrian ArbreshY chromosome: 0.976mtDNA: 0.995

Sicilian ArberesheY chromosome: 0.979mtDNA: 0.992

very close to those of Italian neighbour populations of Cosenza (0.994 and 1.000) and Trapani-Enna (0.985 and 0.999).

Page 36: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping
Page 37: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Cromosoma Y mtDNA

Admixture analysis

Case study: The Arbereshe: between Italy and the Balkans

Page 38: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Italian isolates: the case Sardinia

Page 39: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Sardinia: an oulierClassical genetic markers: 40 alleles

(Piazza et al., 1988)

Dendrogram with 26 European

popolations88 alleles

(Cavalli-Sforza et al., 1994)

Page 40: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Genetic tree buildwith 13 classicalgenetic markers(Memmì et al., 1998)

Page 41: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping
Page 42: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping
Page 43: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Distribution of M26 mutation in Y chromosome (aplotgroup I2a)

Page 44: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Percentage of Y haplogroupsconsidered of Neolithicand Paleolithic origin

Paleolithic61%

Neolithic35%

others4%

Page 45: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

• Sassarese• Gallurese• Nord-ovest Logudoro• Est Logudoro• Sud Logudoro – Planargia• Goceano (alta valle del Tirso)• Circondario di Bitti• Nuorese• Baronia di Orosei-Siniscola• Monti Ferru• Fonni – Barbagia di Ollolai• Nord Campidano di Oristano• Media valle del Tirso• Barbagia di Belvi• Ogliastra• Sud Campidano di Oristano• Tregenta – Parteolla• Transizione tra Gerrei e Tregenta• Sarrabus• Sulcis – Iglesiente• Campidano di Cagliari• Alghero• Carloforte

Linguistic areas

Page 46: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Genetic structure :Internal diversity

Geneticboundariesobtainedusing 12 classicalgeneticmarkers

Page 47: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

L’Ogliastra

Page 48: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

In blackOgliastra,

In redTrexenta and Sulcis

Page 49: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping
Page 50: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping
Page 51: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Carloforte: Geo/linguistic isolate

Benetutti: geographic isolation

Isolates in Sardinia

Page 52: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Both the isolates show a decrese of internal variability both for mtDNA and Ychromosome

Cromosoma Y mtDNA

Probable different admixture: males from Carloforte with females from Tunisia

Isolates in Sardinia

Page 53: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Desulo

2435 abitanti

Page 54: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Isolates in Sardinia

Page 55: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Isolates in Sardinia

Page 56: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

1850

1910

1950

Oggi

Asuai

Ovolaccio

Asuai

AsuaiAsuai

IssiriaIssiria

Issiria

OvolaccioOvolaccio

Ovolaccio

Issiria

Ovolaccio

Asuai

Desulo

Page 57: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Desulo

Page 58: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Analysis of a Genetic Isolate: The Case of Carloforte (Italy)

Page 59: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Case study: Carloforte

Page 60: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

History of Carloforte

Genova/Pegli

Tabarka

Is.San Pietro

1738

1542

Page 61: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Tabarchino, which is part of the Ligurian group of Romance dialects

Language

Page 62: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Matrimonial behaviour: endogamy, consanguinity

Page 63: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Surnames analysis

Page 64: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Surnames analysis

Page 65: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

SAR

CARLOFORTE

ITA

(Vona et al., 1996)

Genetic analysis: classical markers

Page 66: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Genetic analysis: Y-chromosome haplogroups

Page 67: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Genetic analysis: mtDNA HVRI

Page 68: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Genetic analysis: mtDNA HVRI

Founder-surnames sampling isnot affected by recent gene flow and is therefore a signature of the ancestral population, whereas the grandparents’ criterion is a signature of the presentpopulation

Page 69: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

In Carloforte: frequent a genetic form of high myopia, very rare in the rest of the island, but it

presents the lowest frequency (0.5‰)of Multiple sclerosis in Sardinia, while Sulcis (the region nearest to Carloforte) present the highest

incidence in Sardinia (2‰)

Medical analysis

Page 70: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Lingua diversa = diversità genetica?

Alghero

Page 71: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Only a multidisciplinaryapproach allows the knowledge of all those

parameters, which isessential to understand the present genetic structure

of the population

Page 72: Genetic Isolates in Human Populations.understanding of the genetic structure of human populations; studies of human genetic isolates have proven to be extremely useful for mapping

Multidisciplinary approach in determining the features of a genetic isolate

Geneticisolate

Language

Matrimonialbehaviour

Surnames

Genetics

Medicalanalysis