Journal of Medical Virology 78:631–637 (2006)

Genetic Heterogeneity of G and F Protein GenesFrom Argentinean HumanMetapneumovirus Strains

Monica Galiano,1 Alfonsina Trento,2 Lorena Ver,2 Guadalupe Carballal,1 and Cristina Videla1*1Laboratorio de Virologıa Clınica, Centro de Educacion Medica e Investigaciones Clınicas,CEMIC, Hospital Universitario, Buenos Aires, Argentina2Unidad de Biologıa Viral, Centro Nacional de Microbiologıa, Instituto de Salud Carlos III,Majadahonda, Madrid, Spain

Human metapneumovirus (hMPV) is a newlyidentified paramixovirus, associated with respira-tory illnesses in all age groups. Two geneticgroups of hMPV have been described. Thenucleotide sequences of the G and F genes from11 Argentinean hMPV strains (1998–2003) weredetermined by RT-PCR and direct sequencing.Phylogenetic analysis showed that hMPV strainsclustered into twomain genetic lineages, A and B.Strains clustered into A group were split into twosublineages, A1 and A2. All strains belonging togroup B clustered with representative strainsfrom sublineage B1. No Argentinean strainsbelonged to sublineage B2. F sequences showedhigh percentage identities at nucleotide andamino acid levels. In contrast, G sequencesshowed high diversity between A and B groups.Most changes observed in the deduced G proteinsequence were amino acid substitutions in theextracellular domain, and changes in stop codonusage leading to different lengths in the Gproteins. High content of serine and threonineresidues were also shown, suggesting that thisprotein would be highly glycosylated. The poten-tial sites forN- andO-glycosylation seem tohaveadifferent conservation pattern between the twomain groups. This is the first report on the geneticvariability of the G and F protein genes of hMPVstrains in South America. Two main geneticgroupsandat least threesubgroupswere revealedamong Argentinean hMPV strains. The F proteinseems to be highly conserved, whereas the Gprotein showed extensive diversity betweengroups A and B. J. Med. Virol. 78:631–637,2006. � 2006Wiley-Liss, Inc.

KEY WORDS: genetic variability of hMPV;Argentina; human metapneu-movirus

INTRODUCTION

Human metapneumovirus (hMPV) is a newly identi-fied paramixovirus [Van Den Hoogen et al., 2001] andit is the sole human-infecting member of the genusMetapneumovirus of the subfamily Pneumovirinae ofthe family Paramyxoviridae, together with avian pneu-movirus (APV). hMPV shares with APV subtype Cthe closest relationship regarding sequence identityand gene constellation [Van Den Hoogen et al., 2002].In addition, hMPV is related genetically to humanrespiratory syncytial virus (hRSV) and also presentssimilar epidemiologic characteristics: (i) it has beenassociatedwith respiratory illnesses in children, adults,and immunocompromised patients, ranging from upperrespiratory tract infections and flu-like illness to severebronchiolitis and pneumonia [Boivin et al., 2002; Falseyet al., 2002;Pelletier et al., 2002;Esper et al., 2003]; (ii) itseems to have a worldwide distribution, with epidemicsoccurringmostly inwinter and early spring [Jartti et al.,2002;Galiano et al., 2004;Mullins et al., 2004]; (iii) therewould be some evidence of that this virus may causerepeated infections through life [Pelletier et al., 2002;Ebihara et al., 2003]; (iv) two genetic groups of hMPVhave been described and the greatest differencesbetween them are located in the G protein [Peret et al.,2004; Van Den Hoogen et al., 2004].

The two major antigenic determinants of hRSV arethe surface glycoproteins F and G [Hall et al., 1991]. Fmediates fusion of viral and cellmembranes andGbinds

Grant sponsor: Fundacion ‘‘A. J. Roemmers’’.

*Correspondence to: Cristina Videla, Laboratorio de VirologıaClınica, CEMIC, Galvan 4102 (C1431FWO) Buenos Aires, Argen-tina. E-mail: cvidela@cemic.edu.ar

Accepted 23 January 2006

DOI 10.1002/jmv.20586

Published online in Wiley InterScience(www.interscience.wiley.com)

� 2006 WILEY-LISS, INC.

the virus to the cell receptor. F is a highly conservedprotein, whereas G is the most variable gene product,exhibiting a sequence identity at the amino acid level ofonly 53% between groups A andB [Johnson et al., 1987].Given the similarities between hRSV and hMPV, we

analyzed theFandGgene sequences of 11hMPVstrainsisolated from respiratory samples obtained from chil-dren less than 5 years old in Argentina, from 1998 to2003. The aims of this studywere to evaluate the geneticdiversity of our strains, to classify them into the twomain genetic lineages already described for hMPV, andto compare the features of the two deduced F and Gproteins with those found previously in both hMPV andhRSV.

MATERIALS AND METHODS

Samples, RT-PCR Assays, and Sequencing

All hMPV strains included herein were obtainedfrom children less than 5 years old with acute lowerrespiratory illness, most of them admitted to CEMICUniversity Hospital, Buenos Aires, Argentina, duringthe 1998–2003 period. Strains were isolated in LLC-MK2 cells as described previously [Galiano et al., 2004].Viral RNA was extracted from cell cultures using

the QIAamp Viral RNA Mini kit (Qiagen, QiagenGmbh, Hilden, Germany). RT-PCR was performedusing MMLV reverse transcriptase and Taq DNApolymerase (Promega, Madison, WI).Primers used for the complete F ORF were Fm1-18

(CATCTTGAATTCATGTCTTGGAAAGTGGTG) andFm1620-1601 (CGACTGAAGCTTCTAATTATGTGG-TATGAAGC). Primers for the complete ORF of the Ggene have been described previously [Van Den Hoogenet al., 2004].For the F gene, cDNAwas synthesized at 428C during

60minwith primer Fm1-18 and 10 ml of RNA.Analiquotof 5 ml of cDNA was used for PCR assay with primersFm1-18 and Fm1620-1601, with the following cyclingconditions: 948C for 1min, 468C for 1min, 728C for 2minduring 35 cycles.For the G gene, cDNAwas obtained using 5 ml of RNA

with forward primer at 428C for 60 min, and then PCRwas performed with an aliquot of 5 ml of cDNA. Cyclingconditions were the same as previously described [VanDen Hoogen et al., 2004].Both strains of amplified DNA were sequenced

directly, using primers mentioned above, plus primersFm494� (50-AGCTCYCTCACTGCAGTKG-30), Fm475þ(50-GCCACTGCAGTGAGAGAGC-30), and Fm1077þ(50-CCATGCAAAGTCAGCAC AGG-30) in order toobtain the complete sequence of the F gene. Sequencingwas carried out with the big-dye terminator sequencingkit (Applied Biosystems, USA).

Phylogenetic Analysis

Nucleotide sequences were edited using EditSeq fromDNAstar package and Bioedit software, version 5.0.9[Hall, 1999]. Alignments were performedwith Clustal X

version 1.81 [Thompson et al., 1997]. Phylogeneticanalysis was carried out under distance criterion, withneighbor-joining as algorithm, through MEGA version2.1 software [Kumar et al., 2001]. Bootstrap valueswereobtained with 1,000 replicates.

Potential N- and O-glycosylation sites in the deducedamino acid sequences were predicted using NetNGlycversion 1.0 (Gupta et al., in preparation) and NetOGlycversion 3.1 [Julenius et al., 2005]. Transmembraneregions were predicted using TMHMMprogram [Kroghet al., 2001].

Sequences are available at GenBank under accessionnumbers DQ362937–DQ362947 for the F sequences,and DQ362948–DQ362958 for the G sequences.

RESULTS

Nucleotide sequences of the complete G ORF andnucleotides 1 to 1,590 for theF genewere determined for11 hMPV strains isolated in Argentina between 1998and 2003. In order to classify our strains into geneticlineages and sublineages thatwere previously describedfor hMPV, representative strains from which completeG and F sequences were available were added to thetrees [Biacchesi et al., 2003; Van Den Hoogen et al.,2004]. Phylogenetic analysis showed that Argentineanstrains clustered into two main genetic lineages, A andB. Moreover, strains clustered into A group were splitinto two sublineages, A1 and A2. All group B strainsclustered with representative strains from sublineageB1. No Argentinean strains belonged to sublineage B2(Fig. 1).

Table I shows the nucleotide and amino acid percen-tage identities of the different lineages found amongthe Argentinean strains, regarding F and G genesand proteins. Comparison of the F sequences showedhighpercentage identities at nucleotide level andhigherpercentage identities at amino acid level (Table I). Lesssimilarity was observed between sublineages from thetwo main groups A and B, ranging from 83.6% to 84.8%at nucleotide level, and from 94.6% to 95.5% at aminoacid level.

In contrast, sequence identities of the complete GORFs were rather different between A and B groups,ranging from 52.2% to 57.8% at nucleotide level andfrom 29.9% to 32.9% at amino acid level.

Although Argentinean strains belonging to B1 sub-group were isolated from respiratory samples collectedin 1999, 2000, and 2002, their F and G sequences wereidentical among them and also to the prototype strainNL/1/99, except strain Arg/1/00, which is describedbelow in greater detail.

The deduced amino acid alignment of F sequences isshown in Figure 2. Fourteen cysteine residues werefound along the F protein sequences; all were conservedin all isolates. The cleavage peptide sequencewasRQSRand was also conserved among all the isolates. Threepotential N-glycosylation sites conserved in all isolateswere identified among the hMPV F proteins, located atpositions 57, 172, and 353.

J. Med. Virol. DOI 10.1002/jmv

632 Galiano et al.

Figure 3a shows the deduced amino acid sequences ofthe G protein from hMPV strains. Since the diversity ofthe sequences was greater than that observed in the Fprotein, the G sequences were separated in groups inorder to facilitate the analysis. The most conservedregions were those corresponding to the intracellularand transmembrane domains. Most changes wereamino acid substitutions that were located mainly inthe extracellular domain, and different usage of stopcodons, except for strain Arg/1/00, which also showed aframe-shift deletion.

Changes in usage of stop codonswere observed amongstrains from different sublineage, which caused differ-ent lengths in their deducedG proteins. Strains fromA1used the stop codonUAAand exhibitedGproteins of 236residues of length, whereas A2 and B1 strains used thestop codon UAG and showed proteins of 219 and 224amino acids of length, respectively.

All the G proteins also exhibited a high content ofserine (S) and threonine (T) residues. Strains fromgroupA showed amean of 32.4% (S¼15.8%, T¼16.6%), while

strains from group B had a mean of 29.5% (S¼ 8.3%,T¼ 21.2%). Between 49 and 72 serine and threonineresidues were identified as potential acceptor of O-glycosylation among all strains (G-scores >0.5, NetO-Glyc v. 3.1). All predicted O-glycosylation sites werelocated after amino acid 66, in the ectodomain of theprotein.

Between four and five potential N-glycosylation siteswere found along the G proteins from the differentsubgroups. Site located at position 30 was conservedamong all the isolates. The rest of potential N-glycosyla-tion sites were conserved only in strains from the samesubgroup: sites 58 and 233 for subgroup A1, site 52 forA2, and site 101 for B1. Sites 169, 181, and 188 wereconserved among strains from subgroup B1 except forArg/1/00, which showed drastic amino acid changes atthose positions.

G proteins were also rich in proline residues, rangingfrom 6.7% for group B to 8.6% for group A. Only onecysteine residue was conserved among all isolates andwas located at position 27 in the intracellular domain.

J. Med. Virol. DOI 10.1002/jmv

Fig. 1. Phylogenetic analysis of the complete F gene (A) andGgene (B) of 11 hMPVArgentinean strains.Trees were built under distance criterion, using neighbor-joining algorithm through MEGA 2.1 program.Bootstrap proportions were calculated with 1,000 replicates and are displayed in italics at the internalbranches of the trees.Only bootstraps values>70%are displayed. For theArgentinean (Arg) and prototypestrains from theNetherlands (NL), the two last numbers in the isolate name indicate the year inwhich thestrain was collected. For the Canadian prototype strains (CAN), the year of collection is indicated by thefirst two numbers in the isolate name.

TABLE I. Sequence Identity Percentages Among Argentinean hMPV Strains, at Nucleotide (nt) and Amino Acid (aa) Levels

A1 A2 B1 B2

Subgroups nt aa nt aa nt aa nt aa

F ORFA1 98.4–100 99.8–100 94.4–94.6 98.2–98.4 83.9–84.2 94.6 84.1–84.8 95.1–95.3A2 100 100 83.6 94.6 84.2–84.6 95.5B1 100 100 94.0–94.2 98.4B2 98.5 99.6

G ORFA1 95.0–100 91.5–100 74.9–76.0 60.0–61.3 52.2–53.0 29.9–30.7 55.6–57.8 30.8–32.9A2 100 100 56.0 32.8 54.1–54.2 31.7–32.6B1 100 100 75.9–76.2 64.7–65.1B2 94.0 90.2

Values are ranges of identity among strains within each subgroup and between different subgroups. Strain Arg/1/00 was excluded because of itsframe-shift in the G ORF. Since no Argentinean strains clustered into B2 sublineage, sequence identities were compared with the two prototypestrains from B2, NL/1/94, and CAN98-75.

Genetic Variability of hMPV 633

Another cysteine residue was found at position 65,which was conserved in all group B isolates.Strain Arg/1/00 from subgroup B1 displayed a dele-

tion of one adenosine (A) within a run of six A at

nucleotides 476–481, which caused a frame-shift thatrendered adeducedGprotein of 242 aminoacid of lengthwith significant changes between amino acid 161 and itsC-terminal end. This G protein exhibited drastic amino

J. Med. Virol. DOI 10.1002/jmv

Fig. 2. Predicted amino acid sequences of the hMPVF protein of 11 strains isolated in Argentina (aminoacids 10 to 530). Prototype strain NL/1/00 is displayed as consensus. Identical amino acids are representedwith periods. The three hydrophobic domains are shown in italics in boldface type, and the cleavage site isboxed. Conserved cysteine residues are marked with asterisks, and potential N-glycosylation sites areunderlined.

634 Galiano et al.

acid changes and also loss of potential N-glycosylationsites that were observed in other isolates from B1subgroup after amino acid 161. This strain also showedless potential acceptor for O-linked sugars in its alteredfinal portion of the G protein (Fig. 3b). Nucleotidesequences from this G protein were confirmed by

repeated virus culture, RNA isolation, RT-PCR, andsequencing.

DISCUSSION

This is the first study on the genetic diversity of hMPVstrains isolated in Argentina. Due to the resemblance

J. Med. Virol. DOI 10.1002/jmv

Fig. 3. a: Deduced amino acid sequences of the G protein of 11ArgentineanhMPVstrains. Sequences are split in the twomain geneticgroups, A and B. Subgroups are indicated with brackets. Prototypestrains NL/1/00 and NL/1/99 are displayed as consensus sequences forgroups A and B, respectively. Periods indicate identical amino acid anddashes correspond to gaps. The transmembrane region is shown initalics in boldface type. Cysteine residues are marked with asterisks.

Potential N-glycosylation sites are underlined. Potential O-glycosyla-tion sites are marked with !. Only group-conserved O-glycosylationsites are shown; amino acids 161 to 242 from strain Arg/1/00 were notconsidered. b: Comparison of potential O-glycosylation sites located inthe final portion of theGprotein (fromamino acid 161 to theC-terminalend) from strains NL/1/99 (marked with !) and Arg/1/00 (!).

Genetic Variability of hMPV 635

between hMPV and hRSV, the F and G protein geneshave been chosen for this analysis because they arethe twomajor targets for the neutralizing and protectiveantigenic response in hRSV [Hall et al., 1991]. Inaddition, hMPV F gene has been described previouslyin worldwide studies and allowed us to classify ourhMPV isolates in the context of genetic lineagesdescribed previously [Bastien et al., 2003; Boivin et al.,2004]. Recent studies have shown that the G protein isthe most variable gene product among hMPV isolates[Peret et al., 2004; Van Den Hoogen et al., 2004], as it isthe G protein of hRSV [Johnson et al., 1987].Argentinean strains clustered with representative

strains from subgroups A1, A2, and B1. None of thestrains belonged to B2. However, we cannot rule outthe presence of B2 strains during this period as we haveanalyzed a small number of hMPV strains.The high nucleotide and amino acid identity levels

found in the F gene confirm that the hMPVFprotein is awell conserved protein. Fourteen cysteine residueswerelocated along the F protein of all hMPV isolates, incomparison with 15 described in hRSV [Collins, 1991].Ten out of 14 cysteine residues are spaced closely aroundthe middle of the putative F1 subunit and they areprobably involved in folding of the F monomer, as hasbeen suggested for hRSV [Lopez et al., 1998].In contrast, sequence identities of the G gene showed

extensive nucleotide (52.2–57.8%) and amino acid(29.9–32.9%) variability between the two major hMPVgroups. Similar diversity levels have been reported inprevious studies: 52–58% and 50–57% at the nucleo-tide, and 31–35% and 30–37% at the amino acidlevels [Peret et al., 2004; Van Den Hoogen et al., 2004].The variability observed in the deduced amino acidsequences of the hMPV G protein was even higher thanthe 53% reported between different hRSV groups[Johnson et al., 1987] and it was also higher than thediversity at nucleotide level. This can be related to thehigh proportion of nucleotide changes resulting inamino acid changes, suggesting a selective advantageto G protein changes. As it was suggested for hRSV, apossible advantage would be an escape from the hostimmune response [Cane et al., 1991; Garcia et al., 1994;Melero et al., 1997; Coggins et al., 1998].Despite the little homology among the G proteins

of hRSV, PVM, and APV, they have similaroverall amino acid content with a high proportion ofserine, threonine, andproline residues [Ling et al., 1992;Randhawa et al., 1995]. The G protein of hMPV showsa proportion of serine and threonine residues similarto its hRSV counterpart (29.5–32.4% vs. 33–35.5%,respectively).The main type of changes observed in the hMPV G

proteins was similar to those described for hRSV[Melero et al., 1997] and changes were based onnucleotide changes that led to (a) amino acid substitu-tions, particularly at the C-terminal end of the protein,and (b) different usage of stop codons, which determineddifferent lengths in the G protein of strains fromdifferent subgroups. A frame-shift deletion of a single

A in a run of six A in one strain was also found, whichresulted in a longer G protein of 242 residues withdrastic changes in the last 81 residues from its C-terminal end, including loss of potential N- and O-glycosylation sites. Previous reports have describedsingle insertions or deletions leading to changes inthe ORF of hMPV G proteins [Van Den Hoogen et al.,2004]. Frame-shift mutations occurring in hRSV escapemutants due to deletions or insertions of A in clustersof A [Garcia-Barreno et al., 1990] and also in naturalisolates [Sullender et al., 1991] have been reported,though infrequently. These runs of A0s in the G geneof hRSV have been found to be prone to frequentpolymerase errors, particularly involving addition ordeletion of A [Cane et al., 1993].

Different usage of stop codons observed in the Gprotein of our hMPV strains has been described in otherstudies [Bastien et al., 2004; Ishiguro et al., 2004; Peretet al., 2004].We have also noted that different lengths ofthe G protein were observed in strains belonging todifferent subgroups. Further research will be needed todetermine whether this may or may not be a lineage-specific feature, as suggested for hRSV [Peret et al.,1998; Martinez et al., 1999]. Changes in the stop codonsof the G protein of hRSV have been associated with theemergence of new evolutive lineages [Garcia et al.,1994].

Between 4 and 5 potential N-glycosylation sites and49–72 potential O-glycosylation sites were identified intheGprotein of ourhMPVstrains.However, only 28and35 of the latter were conserved among strains of groupsA and B, respectively. Only site at position 30 wasconserved in all isolates as acceptor for N-linked sugars,although its localization in the intracellular domainmakesunlikely itsuse.Bastienet al. [2004]have showedthat the hMPV G protein is highly glycosylated andthere would be different usage of potential O-glycosyla-tion sites between strains of the main two groups. Thisfeature might also contribute to the antigenic diversityof the G protein, either masking certain epitopes orhelping to antibody recognition, as suggested for hRSV[Palomo et al., 2000].

In summary, genes encoding F and G proteins ofhMPV strains isolated in Argentinawere characterized.Although the number of hMPV strains investigated inthis study is small, useful information on the geneticvariability of hMPV is provided. Further studies areneeded to determine the effect of these features on theantigenic properties of the G protein. Serologic studieswill be required to evaluate the contribution of the Gprotein antigenicity and its antigenic variability to thespecific immune response.

ACKNOWLEDGMENTS

Wethank toDr. JoseA.Melero forhelpful discussions;Carmen Ricarte, Beatriz Ebekian, and Cristina Juarezfor their technical assistance; and Valeria Melia forhelping with English language. We also thank Funda-cion ‘‘Rene Baron’’ and Unidad Academa, Instituto de

J. Med. Virol. DOI 10.1002/jmv

636 Galiano et al.

Investigacıon del Instituto Universitario CEMIC fortheir support.

REFERENCES

BastienN,NormandS,TaylorT,WardD,PeretTC,BoivinG,AndersonLJ, Li Y. 2003. Sequence analysis of the N, P, M and F genes ofCanadian human metapneumovirus strains. Virus Res 93:51–62.

Bastien N, Liu L, Ward D, Taylor T, Li Y. 2004. Genetic variability ofthe G glycoprotein gene of human metapneumovirus. J ClinMicrobiol 42:3532–3537.

Biacchesi S, Skiadopoulos MH, Boivin G, Hanson CT, Murphy BR,Collins PL, Buchholz UJ. 2003. Genetic diversity between humanmetapneumovirus subgroups. Virology 315:1–9.

Boivin G, Abed Y, Pelletier G, Ruel L, Moisan D, Cote S, Peret TC,Erdman DD, Anderson LJ. 2002. Virological features and clinicalmanifestations associated with human metapneumovirus: A newparamyxovirus responsible for acute respiratory-tract infections inall age groups. J Infect Dis 186:1330–1334.

Boivin G, Mackay I, Sloots TP, Madhi S, Freymuth F, Wolf D, Shemer-Avni Y, Ludewick H, Gray GC, LeBlanc E. 2004. Global geneticdiversity of human metapneumovirus fusion gene. Emerg InfectDis 10:1154–1157.

Cane PA, Matthews DA, Pringle CR. 1991. Identification of variabledomains of the attachment (G) protein of subgroup A respiratorysyncytial viruses. J Gen Virol 72:2091–2096.

CanePA,MatthewsDA, Pringle CR. 1993. Frequent polymerase errorsobserved in a restricted area of clones derived from the attachment(G) protein gene of respiratory syncytial virus. J Virol 67:1090–1093.

Coggins WB, Lefkowitz EJ, Sullender WM. 1998. Genetic variabilityamong group A and group B respiratory syncytial viruses in achildren’s hospital. J Clin Microbiol 36:3552–3557.

Collins PL. 1991. Themolecular biology of human respiratory syncytialvirus (RSV) of the genus Pneumovirus. In: Kingsbury DW, editor.The paramyxoviruses. NewYork: Plenum Publishing. pp 103–162.

Ebihara T, Endo R, Kikuta H, Ishiguro N, Yoshioka M, Ma X,Kobayashi K. 2003. Seroprevalence of human metapneumovirusin Japan. J Med Virol 70:281–283.

Esper F, Boucher D, Weibel C, Martinello RA, Kahn JS. 2003. Humanmetapneumovirus infection in the United States: Clinical manifes-tations associated with a newly emerging respiratory infection inchildren. Pediatrics 111:1407–1410.

Falsey AR, Formica MA, Walsh EE. 2002. Diagnosis of respiratorysyncytial virus infection: Comparison of reverse transcription-PCRtoviral cultureandserology inadultswith respiratory illness. JClinMicrobiol 40:817–820.

GalianoM, Videla C, Puch SS,Martinez A, EchavarriaM, Carballal G.2004. Evidence of human metapneumovirus in children in Argen-tina. J Med Virol 72:299–303.

GarciaO,MartinM,Dopazo J, Arbiza J, Frabasile S, Russi J,HortalM,Perez-Brena P, Martinez I, Garcia-Barreno B, Melero JA. 1994.Evolutionary pattern of human respiratory syncytial virus (sub-group A): Cocirculating lineages and correlation of geneticand antigenic changes in the G glycoprotein. J Virol 68:5448–5459.

Garcia-Barreno B, Portela A, Delgado T, Lopez JA, Melero JA. 1990.Frame shift mutations as a novel mechanism for the generation ofneutralization resistant mutants of human respiratory syncytialvirus. EMBO J 9:4181–4187.

GuptaR, JungE, Brunak S. 2004. Prediction ofN-glycosylation sites inhuman proteins. NetNGlyc 1.0 http://www.cbs.dtu.dk/services/NetNGlyc/

Hall TA. 1999. BioEdit: A user-friendly biological sequence alignmenteditor and analysis. Department of Microbiology, North CarolineState University.

Hall CB, Walsh EE, Long CE, Schnabel KC. 1991. Immunity to andfrequency of reinfection with respiratory syncytial virus. J InfectDis 163:693–698.

IshiguroN,EbiharaT,EndoR,MaX,KikutaH, IshikoH,KobayashiK.2004.High genetic diversity of the attachment (G) protein of humanmetapneumovirus. J Clin Microbiol 42:3406–3414.

Jartti T, van denHB, Garofalo RP, Osterhaus AD, RuuskanenO. 2002.Metapneumovirus and acute wheezing in children. Lancet 360:1393–1394.

Johnson PR, Spriggs MK, Olmsted RA, Collins PL. 1987. The Gglycoprotein of human respiratory syncytial viruses of subgroups Aand B: Extensive sequence divergence between antigenicallyrelated proteins. Proc Natl Acad Sci USA 84:5625–5629.

Julenius K, Molgaard A, Gupta R, Brunak S. 2005. Prediction,conservation analysis, and structural characterization of mamma-lian mucin-type O-glycosylation sites. Glycobiology 15:153–164.

Krogh A, Larsson B, von Heijne G, Sonnhammer EL. 2001. Predictingtransmembrane protein topology with a hidden Markov model:Application to complete genomes. J Mol Biol 305:567–580.

Kumar S, Tamura K, Jakobsen IB, Nei M. 2001. MEGA2: Molecularevolutionary genetics analysis software. Bioinformatics 17:1244–1245.

Ling R, Easton AJ, Pringle CR. 1992. Sequence analysis of the 22K, SHand G genes of turkey rhinotracheitis virus and their intergenicregions reveals a gene order different from that of other pneumo-viruses. J Gen Virol 73:1709–1715.

Lopez JA, Bustos R, Orvell C, Berois M, Arbiza J, Garcia-Barreno B,Melero JA. 1998. Antigenic structure of human respiratorysyncytial virus fusion glycoprotein. J Virol 72:6922–6928.

Martinez I, Valdes O, Delfraro A, Arbiza J, Russi J, Melero JA. 1999.Evolutionary pattern of the G glycoprotein of human respiratorysyncytial viruses from antigenic group B: The use of alternativetermination codons and lineage diversification. J Gen Virol 80:125–130.

Melero JA, Garcia-Barreno B, Martinez I, Pringle CR, Cane PA. 1997.Antigenic structure, evolution and immunobiology of humanrespiratory syncytial virus attachment (G) protein. J Gen Virol78:2411–2418.

Mullins JA, Erdman DD, Weinberg GA, Edwards K, Hall CB, WalkerFJ, Iwane M, Anderson LJ. 2004. Human metapneumovirusinfection among children hospitalized with acute respiratoryillness. Emerg Infect Dis 10:700–705.

Palomo C, Cane PA, Meler JA. 2000. Evaluation of the antibodyspecificities of human convalescent-phase sera against the attach-ment (G) protein of human respiratory syncytial virus. Influence ofstrain variation and carbohydrate side chains. J Med Virol 60:468–474.

Pelletier G, Dery P, Abed Y, Boivin G. 2002. Respiratory tractreinfections by the new human Metapneumovirus in an immuno-compromised child. Emerg Infect Dis 8:976–978.

Peret TC, Hall CB, Schnabel KC, Golub JA, Anderson LJ. 1998.Circulation patterns of genetically distinct group A and B strains ofhuman respiratory syncytial virus in a community. J Gen Virol 79:2221–2229.

Peret TC, AbedY, Anderson LJ, ErdmanDD,BoivinG. 2004. Sequencepolymorphism of the predicted human metapneumovirus Gglycoprotein. J Gen Virol 85:679–686.

Randhawa JS, Chambers P, Pringle CR, Easton AJ. 1995. Nucleotidesequences of the genes encoding the putative attachment glycopro-tein (G) of mouse and tissue culture-passaged strains of pneumoniavirus of mice. Virology 207:240–245.

Sullender WM, Mufson MA, Anderson LJ, Wertz GW. 1991. Geneticdiversity of the attachment protein of subgroup B respiratorysyncytial viruses. J Virol 65:5425–5434.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG.1997. The CLUSTAL_X windows interface: Flexible strategies formultiple sequence alignment aided by quality analysis tools.Nucleic Acids Res 25:4876–4882.

Van Den Hoogen BG, de Jong JC, Groen J, Kuiken T, de Groot R,Fouchier RA, Osterhaus AD. 2001. A newly discovered humanpneumovirus isolated from young children with respiratory tractdisease. Nat Med 7:719–724.

Van Den Hoogen BG, Bestebroer TM, Osterhaus AD, Fouchier RA.2002. Analysis of the genomic sequence of a human metapneumo-virus. Virology 295:119–132.

Van Den Hoogen BG, Herfst S, Sprong L, Cane PA, Forleo-Neto E, deSwart RL,OsterhausAD,FouchierRA. 2004. Antigenic and geneticvariability of human metapneumoviruses. Emerg Infect Dis 10:658–666.

J. Med. Virol. DOI 10.1002/jmv

Genetic Variability of hMPV 637