Genetic Factors Influencing BCG Vaccine Properties · Genetic Factors Influencing BCG Vaccine...
Transcript of Genetic Factors Influencing BCG Vaccine Properties · Genetic Factors Influencing BCG Vaccine...
Genetic Factors Influencing BCG Vaccine Properties
by
Andrea Leung
A thesis submitted in conformity with the requirements for the degree of Master’s of Science
Graduate Department of Molecular Genetics University of Toronto
© Copyright by Andrea Leung 2010
ii
Genetic Factors Influencing BCG Vaccine Properties
Andrea Leung
Master‟s of Science
Graduate Department of Molecular Genetics
University of Toronto
2010
Abstract
Tuberculosis is a re-emerging global health problem. Bacille Calmette-Guerin (BCG), the
available vaccine against the disease, is only effective short term and is associated with adverse
reactions clinically. The development of new effective vaccines will require an understanding of
virulence, immunogenic factors and the beneficial immune responses induced in the human host.
My thesis investigates phoP and whiB3, two genes associated with virulence and
immunogenicity in Mycobacterium tuberculosis. Study of PhoP in a natural phoP mutant, BCG-
Prague, and in the clinically safe BCG-Japan, shows that over-expression of PhoP increases the
immunogenicity of these vaccine strains. In addition, I found that WhiB3 impacts carbon
metabolism in BCG-Birkhaug and BCG-Sweden, although the effect of this on virulence in vivo
is still unclear. The characterization of genes involved in virulence and immunogenicity allows
us to develop novel approaches for improving the efficacy of BCG, which has important
implications for future TB vaccine development.
iii
Acknowledgments
First and foremost, thank you to my supervisor Jun for his guidance and patience throughout the
years. He always managed to find the positive side to every situation. Thank you to my
supervisory committee members, Dr. Barbara Funnell and Dr. Jeremy Mogridge, whose sound
advice and assistance on my project is extremely appreciated. Thank you to my family, for their
constant love and encouragement throughout the years. To my 4th
floor family, thank you for the
laughs, inappropriate lunch room conversations, and much needed distractions. I am grateful for
the endless support both on and off the bench. I am especially indebted to my lab members
Vanessa Tran and Blair Gordon, who have been there from the very beginning. They were
always there to help in times of need (and great frustration) and served as a constant source of
knowledge and advice. Lastly, to those I hold close to my heart, thank you for coming along on
this adventure with me. There were many surprises over the past few years and your support
through it all has made all the difference.
iv
Table of Contents
ABSTRACT…………………………………………………………………………………….. ii
ACKNOWLEDGEMENTS…………………………………………………………………….. iii
TABLE OF CONTENTS……………………………………………………………………….. iv
LIST OF TABLES…………………………………………………………………………….... vi
LIST OF FIGURES…………………………………………………………………………….. vii
LIST OF ABBREVIATIONS…………………………………………………………………. viii
CHAPTER 1 – GENERAL INTRODUCTION…………………………………….………….. 1
1.1 The impact of Tuberculosis on human health……………………..……………………. 1
1.2 Brief introduction of Mycobacterium bovis BCG and mechanisms of attenuation…...... 2
1.3 Variations in BCG clinical properties…………………………………………………... 3
1.3.1 Variation in BCG protective efficacy…………………………………………... 3
1.3.2 Variation in BCG immunogenicity and safety…………………………………. 4
1.3.3 Genetic polymorphisms in BCG……………………………………………….. 5
1.4 Factors that may impact BCG vaccine properties……………………………………… 5
1.4.1 PDIM/PGL and BCG safety……………………………………………………. 8
1.4.2 phoP-phoR polymorphisms…………………………………………………….. 8
1.4.3 whiB3 polymorphisms……………………………………………………….… 13
1.5 Current vaccine development strategies: rBCG and subunit vaccines……………….... 16
1.6 Significance and rationale……………………………………………………………… 18
1.6.1 The role of PhoP in BCG immunogenicity…………………………………….. 19
1.6.2 The impact of WhiB3 on virulence…………………………………………….. 20
CHAPTER 2 – MATERIALS AND METHODS……………………………………………… 21
2.1 Bacterial strains, plasmids and growth conditions……………………………………... 21
2.2 Cloning of recombinant BCG………………………………………………………….. 21
2.3 Microarray analysis of Prague pME and Prague pME-PhoP……………………….….. 22
2.4 IFNγ production in mice……………………………………………………………..… 26
v
2.5 Virulence studies in mice……………………………………………………………… 30
2.6 2-D lipid analysis of PDIMs and PGLs………………………………………………... 31
2.7 Lipid analysis for PATs, DATs, and SLs…………………………………………...…. 32
2.8 qRT-PCR of phoP in IS6110 strains…………………………………………………... 33
2.9 WhiB3 plate assays……………………………………………………………………. 35
CHAPTER 3 – RESULTS: ROLE OF PHOP IN IMMUNOGENICITY……………………. 36
3.1 PhoP regulates genes associated with BCG immunogenicity………………………… 37
3.2 Recombinant BCG-Prague expressing PhoP induces an elevated
immune response……………………………………………………………………… 44
3.3 Recombinant BCG-Japan over-expressing PhoP induces an increased
immune response……………………………………………………………………… 46
3.4 Over-expression of PhoP induces higher levels of IFNγ-producing CD4+ T cells
in recombinant BCG-Japan…………………………………………………………… 49
3.5 The expression of PhoPR does not increase BCG-Prague and
BCG-Japan virulence…………………………………………………………………. 52
3.6 PhoP has no effect on PDIM and PGL synthesis……………………………………... 54
3.7 PhoP has no effect on DAT, PAT, and SL production in BCG………………………. 57
3.8 phoP expression is upregulated in BCG strains containing IS6110………………..… 60
Discussion…………………………………………………………………………………….. 63
CHAPTER 4 – RESULTS: IMPACT OF WHIB3 ON BCG METABOLISM AND
RESIDUAL VIRULENCE……………………………………………...…... 66
4.1 Carbon metabolism is affected in BCG whiB3 mutants……………………………… 67
4.2 Virulence is not affected in BCG whiB3 mutants…………………....………………. 70
Discussion…………………………………………………….………………………...……. 72
CHAPTER 5 - GENERAL DISCUSSION AND FUTURE DIRECTIONS………...…….... 74
REFERENCES………………………………………………………………………….……. 80
vi
List of Tables
Table 1. Comparison of Prague pME and Prague pME-phoP by microarray.
vii
List of Figures
Figure 1. Updated genealogy of BCG vaccine strains.
Figure 2. Schematic diagram of the PhoP frameshift mutation in BCG-Prague.
Figure 3. IS6110 insertion into the phoP promoter in BCG-Japan, -Russia, and –Moreau.
Figure 4. Schematic diagram of the whiB3 deletion in BCG-Birkaug and BCG-Sweden.
Figure 5. The effect of phoP on BCG-Prague IFNγ production in stimulated mouse
spleenocytes.
Figure 6. The effect of phoP on BCG-Japan IFNγ production in stimulated mouse spleenocytes.
Figure 7. The effect of phoP on IFNγ-producing CD4+ and CD8
+ T cells in the spleen.
Figure 8. The effect of phoP on BCG-Prague and BCG-Japan virulence.
Figure 9. PDIM and PGL lipids in BCG-Prague and BCG-Japan bacterial strains by two-
dimensional thin layer chromatography.
Figure 10. Comparison of DATs, PATs, and SLs in BCG-Prague bacterial strains by thin layer
chromatography.
Figure 11. Expression levels of phoP in BCG strains containing IS6110.
Figure 12. The effect of whiB3 on carbon metabolism in BCG-Birkhaug and BCG-Sweden.
Figure 13. Effect of whiB3 on virulence in BCG-Birkhaug and BCG-Sweden.
viii
List of Abbreviations
aa – amino acid
bp – base pair
BCG – Bacille Calmette Guérin
DAT – diacyltrehalose
ELISA – enzyme-linked immunosorbant assay
FACS – fluorescence activated cell sorting
HIV – Human Immunodeficiency Virus
ICS – intracellular cytokine staining
IFNγ – interferon gamma
i.v. – intravenous
M. tb – Mycobacterium tuberculosis
PAT – polyacyltrehalose
PDIM – phthiocerol dimycocerosates
PGL – phenolic glycolipids
PPD – purified protein derivative
RD1 – Region of Difference 1
s.c. – subcutaneous
SL – sulfolipid
TB – Tuberculosis
TLC – thin layer chromatography
WHO – World Health Organization
WT – wildtype
1
Chapter 1
General Introduction
1.1 The impact of Tuberculosis on human health
One third of the world‟s population is infected with Mycobacterium tuberculosis (M. tb), the
causative agent of Tuberculosis (TB) disease. Annually, M. tb infects 10 million new people and
causes approximately 2 million deaths worldwide (9). These numbers justify its place in the top
three global health problems, along with Human Immunodeficiency Virus (HIV) and malaria.
Although TB is considered to be an old disease, it has re-emerged since the 1990s due to two
main compounding factors: co-infection with HIV and the appearance of drug-resistant strains of
M. tb. Not only do HIV-positive individuals have an increased susceptibility to M. tb infection,
the two diseases synergize and exacerbate the effects of each other (61). In addition, the long
course of antibiotics required for TB treatment foster patient non-compliance and increases the
number of antibiotic-resistant strains. Both multi-drug resistant TB (MDR-TB) and extensively
drug resistant TB (XDR-TB) are major challenges in current efforts to control TB since they are
unresponsive to drug therapies (10). It is evident that chemotherapy is only a temporary solution
and a more effective method of combating TB is through prevention with an effective vaccine.
1.2 Brief introduction of Mycobacterium bovis BCG and
mechanisms of attenuation
Bacille Calmette-Guérin (BCG) is currently the only available vaccine against TB (9). It is the
most extensively used vaccine with over 3 billion people immunized worldwide since its
2
inception and over 100 million doses administered annually since its inclusion in the World
Health Organization (WHO) Expanded Program on Immunization in 1974 (8). This attenuated
live vaccine was derived from a virulent strain of Mycobacterium bovis (M. bovis) in 1921, after
13 years of in vitro serial passaging by Albert Calmette and Camille Guérin. From 1924, vaccine
strains were distributed to various countries for use in national vaccination programs. Due to
lack of refrigeration at that time, BCG stocks were maintained by continued serial culturing
every few weeks. However, each production laboratory developed independent propagation
techniques for the vaccine, which allowed for a second phase of BCG attenuation. It was not
until the WHO introduced the „seed lot‟ system to initiate lyophilization of the strains in 1966
that the process of in vitro evolution stopped (WHO Expert Committee on Biological
Standardization, 1966). With over 1000 passages from the original 1921 BCG strain, dozens of
different sub-strains emerged that possessed both common and unique mutations (15). This was
observed as early as the 1950s, when numerous vaccine producers noted the appearance of the
sub-strains, each with distinct morphological, biochemical and immunogenic properties (49-52)
(see Section 1.3 for details).
The molecular mechanisms behind BCG attenuation remain unclear. However, it has been
shown that the Region of Difference 1 (RD1) genomic region plays a critical role. RD1 is
essential for M. tb virulence (101) and is present in virulent M. tb and M. bovis strains but is
absent in all BCG strains (15). However, this deletion only partially accounts for the attenuation
of BCG since complementation of RD1 alone does not restore virulence to wildtype (WT) M. tb
levels (15, 101). Furthermore, deletion of RD1 from M. tb does not attenuate the strain to the
same degree as BCG (110). RD1 encodes a Type VII secretion system, ESX-1 (70, 122), which
secretes early secretory antigenic 6 kDa (ESAT-6 (EsxA)) protein and culture filtrate protein 10
kDa (CFP-10 (EsxB)), both well-known antigens belonging to the ESAT-6 family (23, 59).
3
ESAT-6/CFP10 play a role in virulence by modulating macrophage infection (23, 59) and host
immune response (121), highlighting the important roles of these proteins in M. tb survival and
virulence in the host.
In addition to ESX-1, M. tb has four other Type VII secretion systems, one of which, ESX-5, has
also shown to be important for virulence in M. marinum, a close relative to M. tb that causes TB-
like disease in fish and amphibians (3, 4). Similar to ESX-1, ESX-5 secretes virulence-
associated proteins, including members of the ESAT-6 family.
1.3 Variations in BCG clinical properties
1.3.1 Variation in BCG protective efficacy
Clinical and case studies have reported a wide range of efficacy rates for BCG. While it has
shown protective efficacy (>80%) against severe disseminated forms of TB in childhood, such as
meningitis and miliary TB, it has limited effect against adult pulmonary TB, with efficacy
varying from 0-80% (22, 33, 127). Another shortcoming of BCG is its ineffectiveness in those
with previous mycobacteria exposure including environmental mycobacteria; established latent
M. tb infection; or prior BCG vaccination. Previous mycobacteria exposure results in cross-
reactive immune responses that prevent BCG from establishing persistence and having a
protective effect (34, 45). BCG is therefore given at infancy to minimize the likelihood of cross-
immune priming. However, since BCG provides immunity for a maximum of 10 to 20 years,
adults lack effective protection (37, 73, 123). This loss of protection coincides with the increase
in TB incidences seen in 25 to 35 year olds in Africa (10).
4
1.3.2 Variation in BCG immunogenicity and safety
BCG sub-strains also exhibit variable immunogenicity. The immunogenicity and potency of TB
vaccines has been traditionally measured by tuberculin sensitivity produced by delayed type
hypersensitivity to M. tb tuberculin, also known as purified protein derivative (PPD) (94). The
size of the PPD-induced skin induration was indicative of the strength of a BCG-induced
immune response and was used as a method for strain selection in national vaccination programs.
The variation in BCG immunogenicity is exemplified in two studies comparing twelve BCG
strains in guinea pigs and children, which showed that BCG-Prague consistently exhibited
significantly lower tuberculin sensitivity (81, 130). Its weak immunogenicity was also supported
by a later study which compared five BCG strains in BALB/C mice and identified BCG-Prague
as one of the lowest immune response inducers (82).
Variation in BCG safety has also been demonstrated in vaccination programs worldwide (51, 52,
81, 88). Common adverse reactions to BCG in infants include suppurative lymphadenitis
(inflammation of the lymph node) and osteitis (inflammation of the bone). Of the BCG strains
that have been widely used, BCG-Pasteur, -Russia, -Sweden, and -Danish are tightly associated
with vaccine complications whereas BCG-Japan, -Moreau, and -Glaxo are the least likely to
induce adverse reactions (88). Examination of national immunization programs strengthens the
link between specific BCG strains and reported complications. For example, the use of BCG-
Sweden was associated with high numbers of osteitis cases in Finland. However, in 1978, BCG-
Glaxo replaced BCG-Sweden and the cases of osteitis concomitantly dropped. Interestingly,
BCG-Danish replaced BCG-Glaxo in 2002, and the incidence of lymphadentitis increased.
Although this data is correlative, it suggests that there are true biological differences between the
strains that affect safety and immunogenicity.
5
1.3.3 Genetic polymorphisms in BCG
The heterogeneity of BCG strains has been confirmed by recent molecular and genomic studies
(14, 15, 24, 58). Comparative genomic analyses of BCG strains have uncovered extensive
genetic polymorphisms including both deletions and duplications. These studies revealed lesions
common to all BCG sub-strains and genomic differences exclusive to a particular sub-strain,
showing that each BCG is genetically unique (14, 15). A molecular genealogy based on these
studies has been established, which is in general agreement with the historical records of BCG
dissemination. Some of the biochemical differences among BCG strains observed in early
studies have now been confirmed and explained at the molecular level. However, the impact of
the genetic and biochemical differences on BCG clinical properties such as safety,
immunogenicity, and protective efficacy have not been established until recent studies from our
laboratory (see Section 1.4 for details).
1.4 Factors that may impact BCG vaccine properties
Historically, the insufficient protection and variation in BCG safety have been attributed to
differences in vaccine manufacturing and administration, discrepancies in trial methods,
geographic variations among M. tb strains, genetic and nutritional differences in trial
populations, and exposure to environmental mycobacteria (13, 19, 36, 45, 54, 128). These
hypotheses may not be mutually exclusive and may all contribute to the varying efficacy of
BCG. However, recent studies from our laboratory show that these variations may be the result
of genetic and molecular differences among the sub-strains. In particular, we found that specific
molecular differences among the BCG sub-strains may have an effect on vaccine safety (30, 31).
6
In addition, our collaborators in China examined 13 different sub-strains of BCG by high
resolution comparative genomic analysis. Subsequent data analysis and follow up experiments
performed by myself and Vanessa Tran in our lab identified genetic polymorphisms in several
well-established virulence genes of M. tb (Figure 1) (86), which likely have a major impact on
the clinical properties of BCG including immunogenicity and protective efficacy.
Understanding the role of these genes and how they contribute to BCG clinical properties is vital
to the improvement of BCG.
7
Figure 1. Updated genealogy of BCG vaccine strains. Diagrammatic representation of the known genetic mutations
gathered in BCG sub-strains from the original M. bovis. Comparative genomic analysis of 13 different BCG sub-
strains by our laboratory revealed the mutations shaded in grey and red. Mutations highlighted in red are
investigated further in this work: phoP knock out (KO) in BCG-Prague , whiB3 deletion in BCG-Birkhaug and
BCG-Sweden, and the IS6110 insertion in the promoter of phoP in BCG-Japan, -Russia, and –Moreau. Genealogy
diagram was modified from a previous model (24).
8
1.4.1 PDIM/PGL and BCG safety
Previous studies from our laboratory established a novel link between the production of
phthiocerol dimycocerosates (PDIM) and phenolic glycolipids (PGL) and the safety of BCG (31).
PDIM and PGL are important cell wall lipids with established roles in M. tb and M. bovis
virulence (41, 105). They are required for bacterial growth in the host (27, 41) and protection
from reactive nitrogen species which are important for macrophage-mediated mycobacterial
killing (108). PDIMs may also serve to mask immunogenic components due to their abundance
in the cell wall, thereby altering immune recognition by the host (108). PDIMs are found in
pathogenic mycobacteria, including M. tb, M. bovis, M, africanum, M. leprae, M. marinum, M.
ulcerans, and M. kansasii (42, 98). Although less is known about PGLs, their ability to down-
regulate pro-inflammatory cytokines and their role in virulence has been characterized in vitro
and in animal models, respectively (105). Recent studies in our lab show that production of
PDIMs and PGLs are abrogated in BCG-Japan, BCG-Moreau and BCG-Glaxo (31). The loss of
these lipids may explain the decrease in virulence and low frequency of adverse reactions seen
clinically by these strains. While the source of this variation is unclear in BCG-Japan and BCG-
Glaxo, our lab identified a genetic deletion (ΔfadD26-ppsA) in the PDIM/PGL biosynthetic locus
of BCG-Moreau that likely accounts for its inability to produce these lipids (31, 86). Our finding
supports the notion that differences among BCG sub-strains reflect genetic heterogeneity of the
strains themselves.
1.4.2 phoP-phoR polymorphisms
PhoPR is one of 11 two-component systems in M. tb. Two-component systems are conserved
regulatory signal transduction systems often involved in bacterial virulence (46, 92). PhoR is a
membrane-associated sensor histidine kinase that is thought to phosphorylate PhoP, the cytosolic
9
response regulator, in response to a currently unknown environmental stimulus (35). PhoP (Rv
0757) is a 247 aa, 27.5 kDa protein that transcriptionally controls over 100 genes in M. tb (133).
Although there is no evidence yet that PhoP interacts with the promoters of these genes directly,
PhoP is able to autoregulate itself by recognizing three 9-bp direct repeat motifs in the phoP
promoter region (64) with a head-to-head binding orientation (71). However, whether PhoP
requires N-terminal phosphorylation to function and whether it activates or represses its own
transcription is still controversial (64, 72).
PhoP is involved in various aspects of mycobacterial virulence and host immune interaction.
Without phoP, M. tb is able to survive but cannot grow in macrophages and in mice (100, 133).
Furthermore, it was found that a mutation in phoP is partially responsible for the attenuation of
avirulent M. tb H37Ra (85). In addition, the upregulation of PhoP was responsible for increasing
the virulence of the clinical M. bovis B strain, resulting in a nosocomial outbreak of drug-
resistant TB in Spain (107, 120). Interestingly, PhoP mutants of M. tb were found to be more
attenuated than BCG-Pasteur, which has an intact phoP gene, highlighting the important role of
phoP in virulence (90). PhoP has also been linked to immune modulation by controlling
production of trehalose-based lipids (65, 93). This class of lipids include diacyltrehaloses
(DAT), implicated in suppressing T cell proliferation in ex vivo studies (109) and sulfolipids
(SL), which have a role in host immune modulation by altering cytokine secretion and protecting
against reactive oxygen species in the macrophage (78).
Our more recent comparative genomic analysis has revealed extensive polymorphisms in the
phoP-phoR locus among BCG strains. Given the important role of PhoP in M. tb, it is likely that
polymorphisms in the phoP-phoR locus among BCG sub-strains may contribute to BCG
variation. Of interest is a single nucleotide polymorphism in BCG-Prague, where a single
10
guanine (G) nucleotide insertion between bases 852067 and 852068 (M. tb genome coordinates)
results in a frameshift mutation (Figure 2). This mutation abrogates the C-terminal end of PhoP
(residues 154-247), affecting the DNA binding domain (71, 86, 114, 134). Other phoP
polymorphisms include the insertion (IS) element, IS6110, upstream phoP in BCG-Japan, BCG-
Russia and BCG-Moreau. This 1356 bp insertion is situated 18 bp from the phoP start codon at
nucleotide 851593 (M. tb genome coordinates) in an inverse orientation to the phoP gene (86)
(Figure 3). While this insertion has been described before (58), our study was the first to find the
exact insertion site and orientation of IS6110. This insertion may affect the regulation of phoP
and impact its important role in virulence. Taken together, the genetic polymorphisms at the
phoP-phoR locus, particularly in phoP, will likely have a major impact on BCG clinical
properties, which will be the major focus of my thesis study (see Chapter 3).
11
Figure 2. Schematic diagram of the PhoP frameshift mutation in BCG-Prague. A single guanine insertion (depicted
by *) is inserted at nucleotide 852067 and 852068 causing a frameshift mutation, changing residues 154-247 of the
DNA-binding domain of PhoP (residues 150-247).
12
Figure 3. IS6110 insertion into the phoP promoter in BCG-Japan, -Russia, and -Moreau. A schematic representation
of the IS6110 insertion in the promoter of phoP (A). IS6110 is inserted 18 bp upstream of the phoP start codon in
an inverse orientation. The nucleotide sequence surrounding the IS6110 insertion (B). IS6110 (boxed) is inserted
between nucleotides 851592 and 851593 and is flanked by GAA direct repeats. Start codons of phoP and phoR are
bolded.
13
1.4.3 whiB3 polymorphisms
In addition to polymorphisms in phoP, we found that BCG-Sweden and BCG-Birkhaug have a
disrupted whiB3 gene containing a 110 bp deletion (3834822 to 3834932 M. tb genome
coordinates) in the promoter and start site of whiB3 (Figure 4). WhiB3 (Rv3416) of M. tb is a
102 aa, 11.6 kDa protein that has 52% similarity to the S. coelicolor whiB3 on a DNA level (96).
It belongs to a family of seven whiB-like genes in M. tb which are involved in fatty acid
metabolism and pathogenesis (whiB1); cell division (whiB2); and antibiotic resistance (whiB7)
(63, 95, 102, 124). WhiB3 is a putative transcription factor that monitors changes in the redox
environment of the cell (113). It has been shown to bind to the principal sigma factor, RpoV, of
M. tb, supporting its role as a transcriptional regulator (124). Like others in the whiB family,
WhiB3 has four conserved cysteines coordinating an iron-sulfide [4Fe-4S] cluster, which are
known to play essential roles in sensing external signals and intracellular redox states (67, 113,
119). This cluster likely signals M. tb dormancy in response to stress by interacting with
fluctuating NO and O2 levels, resulting in cluster disassembly and modulation of its DNA
binding activity (112, 113). WhiB3 has also been shown to trigger dormancy when sensing
carbon stress, likely through a similar mechanism since central metabolism affects the
intracellular redox environment (17, 126). Interestingly, the WhiB3 ortholog in S. coelicolor has
been shown to be involved in sporulation, a state reminiscent of M. tb dormancy (96, 135).
Although implicated in dormancy, the exact role of WhiB3 in M. tb virulence is unclear. For
example, the loss of whiB3 significantly attenuates M. tb in a mouse model of infection, but does
not have any effect on bacterial replication in vivo (124). Although it is clear that WhiB3 is
involved in M. tb virulence, the role of WhiB3 in BCG remains unknown. Furthermore, the
14
impact of the whiB3 polymorphism on the residual virulence of BCG-Birkhaug and BCG-
Sweden is undetermined and is investigated in this study (see Chapter 4).
In previous studies comparing the virulence levels of 12 BCG strains, BCG-Sweden, a natural
whiB3 mutant, was found to be more virulent (25, 26, 81) and has often been associated with
increased reports of adverse reactions (40, 88). This association is further emphasized when
national vaccination programs are evaluated. As described earlier, the cases of osteitis reported
in Finland dropped with the switch from BCG-Sweden to BCG-Glaxo, a relatively more
attenuated strain missing PDIM/PGLs (88). Although BCG-Birkhaug has been less studied, it is
closely related to BCG-Sweden and is expected to have similar levels of virulence (25, 26, 80,
81). Taken together, I hypothesize that the absence of WhiB3-mediated transcriptional
regulation may account for the increased virulence and adverse reactions seen in these strains.
15
Figure 4. Schematic diagram of the whiB3 deletion in BCG-Birkaug and BCG-Sweden. The promoter and the first
15 aa of the whiB3 gene are disrupted by a 110 bp deletion of bases 3834822-3834932 (M. tb genome coordinates).
16
1.5 Current Vaccine Development Strategies: rBCG and subunit
vaccines
New TB vaccines currently in development are designed to either replace or be used in
combination with the existing BCG vaccine. Both approaches attempt to improve the protective
efficacy currently afforded by BCG and vaccines from both categories are in various stages of
clinical trials (117). The first strategy involves creating a recombinant BCG vaccine that over-
expresses an antigenic protein to elicit a better immune response. An example of this is rBCG30,
a BCG-Tice strain which over-expresses Antigen 85B (Rv1886c), a highly immunogenic
secreted protein. In animal studies rBCG30 provided better protection when compared to its
parental BCG strain (75-77). Immunological studies on rBCG30 showed greater induction of
interferon gamma (IFNγ), an important surrogate marker often used as a measure of immune
activation (91). IFNγ is an essential cytokine required for the activation of the Th1 T cell
response that is important for clearing M. tb (56, 79). Greater numbers of both CD4+ and CD8
+
T cells were also reported for rBCG30 (75), indicative of greater immunological induction. Both
CD4+ and CD8
+ T cells have been found to be vital in mounting an effective immune response
against M. tb and are required for immune activation through the production of IFNγ and other
cytokines (29, 55, 57). Although there is currently no biological marker for vaccine efficacy,
IFNγ production by CD4+ and CD8
+ T cells are commonly used as an important correlate of
protection (39, 56, 57).
Another recombinant BCG candidate is rBCG::ΔureC-llo+, a urease deficient strain of BCG-
Pasteur expressing listeriolysin (hly) from Listeria monocytogenes. The urease deletion inhibits
phagosome de-acidification, allowing optimal pH for listeriolysin function. The expression of
17
listeriolysin damages the phagosome membrane in which BCG resides, thereby allowing
mycobacterial entry into the cytosol (68). This mechanism allows for better CD8+ T cell antigen
presentation in the cytosol (68), which aids in cell-mediated lysis of infected cells (55, 139). In
addition, more recent studies have shown a correlation between CD8+ T cells with protective
efficacy in both humans and mice, although the exact mechanism is unknown (118). In animal
studies, rBCG::ΔureC-llo+ protects against M. tb infection better than the parental strain and was
even safer in immunocompromised SCID mice (68). This vaccine entered phase I clinical trials
in 2008.
Another method to developing a new live vaccine is the strategic attenuation of live M. tb. One
such vaccine in development is SO2, a M. tb phoP mutant, which has not yet entered clinical
trials (90). While this method retains many immunologically important genes and mimics the
immune response induced by a natural infection, there are concerns regarding the safety and
possible reversion of the strain to wild type. Studies with SO2 also show that protection in mice
is not greater than that already offered by BCG (90).
The second approach to rational vaccine design is to create a subunit “booster” to be used in
conjunction with BCG as a “prime”. Subunit vaccines, whether protein or DNA-based, present
antigens to the host and boosts immunity through strong IFNγ induction (1). Some currently in
development include Hybrid-1 (Ag85B-ESAT-6) and Mtb72f (PPE18-Rv0125), which are fusion
proteins of immunogenic M. tb secreted antigens (20, 136). Although each protein subunit
vaccine has completed phase I clinical trials as a standalone vaccine, they have not surpassed the
protection of BCG (84, 97, 116). However, when used as a booster, Mtb72f has been shown to
effectively increase the protection primed by BCG in monkeys (106).
18
DNA-based subunit vaccines using replication deficient vectors have also been produced in an
attempt to stimulate CD8+ T cell recognition. Two of these in development are MVA-85A, a
vaccinia virus expressing Antigen 85A (132) and Aeras-402, an adenovirus expressing Antigen
85A, Antigen 85B, and EsxH (a protein of the ESAT-6 family) (89). When tested in monkeys,
MVA-85A increased the protection of BCG whereas Aeras-402 boosted T cell responses. Both
are currently in Phase I clinical trials. While very different approaches are used in rational
vaccine design, they all attempt to compensate for the deficiencies of the current BCG strain.
1.6 Significance and Rationale
Although BCG is still in wide use today, it is not an ideal vaccine. Due to the growing number
of M. tb infections and increasing incidences of TB disease, development of a new and more
effective vaccine is vital. The ideal vaccine must provide both long term efficacy and guaranteed
safety. This is of increased importance in countries with high incidences of HIV/AIDS due to
the increased risk of adverse reactions. The threat of disseminated BCG disease in
immunocompromised HIV+ children has become such a concern that the WHO amended its
vaccination policy in 2007 to not immunize HIV+ infants (11), thus subjecting an already
vulnerable population to increased risk of TB. However, it has been demonstrated that the risk
of disseminated BCG disease and other adverse reactions is associated with only certain strains
of BCG. For example, in South Africa, reported cases increased when the vaccine was switched
from BCG-Japan (a less virulent strain) to BCG-Danish (a relatively more virulent strain) in
2000 (74). While there are many efforts to repair or replace the current BCG vaccine, our first
19
concern should be the investigation and selection of a suitable sub-strain for future vaccine
development.
1.6.1 The role of PhoP in BCG immunogenicity
BCG-Prague has long been considered a weak vaccine due to its poor immune response in
tuberculin tests, which serves as a crude measure for immunogenicity (81, 130). Up until
recently, there has been no molecular explanation for this phenotype. Comparative sequence
analysis from our lab has shown that unlike the other 12 BCG sub-strains examined, BCG-
Prague is the only strain with a phoP mutation (86). PhoP positively regulates 44 genes in M. tb
(133), including several well-established T cell antigens that may contribute to tuberculin
reactivity. One of these, Antigen 85A is currently in clinical trials as a component of a booster
subunit vaccine, highlighting the impact of these antigens on immunogenicity (137). Taken
together, this suggests that the PhoP mutation is likely the reason for the loss of immunogenicity
seen in BCG-Prague and would also explain the low tuberculin sensitivity seen in previous
studies on children and guinea pigs (81, 130).
I hypothesize that PhoP function is directly related to BCG immunogenicity and that over-
expression of phoP in a BCG strain will likely improve immunogenicity. I will first confirm this
hypothesis by testing whether restoring PhoP function in BCG-Prague will improve the immune
response elicited by this vaccine strain. I will then determine whether phoP over-expression in
BCG-Japan increases the immunogenicity of this strain. BCG-Japan was chosen for this study
because it is an „early‟ BCG sub-strain containing fewer genomic deletions, which likely makes
it naturally more immunogenic. This strain was also chosen because it has previously been
established as a safe vaccine strain due to the lack of PDIM and PGLs. The relative safety of
BCG-Japan has been demonstrated in HIV-endemic areas. In 2000, the replacement of BCG-
20
Japan with BCG-Danish was associated with an increased risk of disseminated BCG disease in
HIV-infected children (74, 94).
1.6.2 The impact of WhiB3 on BCG virulence
Although the role of WhiB3 in M. tb remains unclear, it is associated with increased virulence
(124) and effective host immunomodulation (112) during infection. WhiB3 also has a role in
sensing and responding to NO, O2, and carbon stress, conditions often encountered by M. tb
during the infection process. Since BCG-Sweden and BCG-Birkhaug are whiB3 mutants, I will
examine the impact of this mutation on carbon metabolism and residual virulence in infected
animals, which will help to clarify whether or not the whiB3 mutation has any effect on the
clinical properties of these two strains.
Ultimately, the goal of this work is to contribute to the rational design of future TB vaccines that
will either complement or replace the current BCG. I propose a novel strategy of repairing an
already existing strain of BCG so that immunogenicity and overall efficacy is increased while
virulence remains low. This vaccine will aim to be both more effective than the current BCG
strains and will also be safe enough to use in HIV-endemic countries.
21
Chapter 2
Materials and Methods
2.1 Bacterial strains, plasmids and growth conditions
BCG- Prague, -Pasteur, -Japan, -Russia, and -Moreau were grown in Middlebrook 7H9 broth
(BD Biosciences) supplemented with 10% ADC (bovine serum album [fraction V], dextrose, and
catalase; BD Biosciences) and 0.05% Tween-80 (Sigma) or cultured on Middlebrook 7H11 agar
supplemented with 10% OADC (oleic acid, bovine serum album [fraction V], dextrose, and
catalase; BD Biosciences). Constructs were made using the Mycobacterium/E. coli shuttle
vector pME, a 5.3 kbp plasmid containing a lacZ gene for Blue/White selection with an internal
multiple cloning site and a kanamycin resistance cassette for antibiotic selection. Cloned genes
were expressed using their native promoter. Mycobacteria strains containing the plasmid pME
(Prague pME, Prague pME-phoP, Prague pME-phoP/R, Japan pME, Japan pME-phoP, Japan
pME-phoP/R, Birkhaug pME, Birkhaug pME-whiB3, Sweden pME, and Sweden pME-whiB3),
were cultured in the same manner as above but with the addition of 25 µg/ml kanamycin.
Plasmid manipulation and propagation was performed using Escherichia coli strain DH5 grown
in Luria-Bertani broth with 50 µg/ml kanamycin.
2.2 Cloning of recombinant BCG
In order to complement the phoP mutation in BCG-Prague, a WT phoP gene was amplified from
BCG-Pasteur genomic DNA. The 1028 bp product was obtained using forward primer phoP-F
(5‟- AAAAAGGTACCGCTTGTTTGGCCATGTCAAC -3‟) and reverse primer phoP-R (5‟-
AAAAACTGCAGGCTGCCGATCCGATTAACTAC -3‟) containing a KpnI and a PstI
22
restriction site (underlined), respectively. Using these restriction sites, the PCR product was
cloned into pME, a shuttle vector containing a kanamycin resistance cassette, and was named
pME-phoP. The cloned region spans 257 bp upstream of the phoP start site and the phoP gene.
To clone phoP and phoR, a 2501 bp product was amplified from BCG-Pasteur genomic DNA
using forward primer phoPR-F (5‟- AAAAAGGTACCGGTCGCAATACCCACGAG -3‟) and
reverse primer phoPR-R (5‟- AAAAACTGCAGCCTCAGTGATTTCGGCTTTG -3‟) containing
a kpnI and pstI restriction site (underlined), respectively. The PCR fragment was then cloned into
shuttle vector pME using kpn1 and pstI sites and was named pME-phoP/R. The cloned region
contains 177 bp upstream of the phoP start codon, both phoP and phoR, the intergenic region
between the two genes and 78 bp downstream of the phoR stop codon.
The above constructs as well as the empty vector pME, were propagated in E. coli and then
electroporated into BCG-Prague and BCG-Japan strains. Plasmid presence was confirmed by
extracting the plasmid from the BCG strain, amplifying in E. coli, and checking for the presence
of the intact gene by DNA sequencing (ACGT, Inc., Toronto).
2.3 Microarray analysis of Prague pME and Prague pME-phoP
RNA Isolation
BCG-Prague strains, Prague pME and Prague pME-phoP were grown in triplicate cultures to an
OD600 between 0.4 and 0.6. Cells from 40 ml of each culture were collected by centrifugation at
4000 rpm for 10 minutes at room temperature (RT) using a Sorvall Heraeus 75006445 rotor.
Cells were resuspended in 1 ml Washing Buffer (0.5% Tween 80, 0.8% NaCl, in RNase free
water). The resuspended pellet was then divided into two 2 ml screw top, O-ring bead beating
tubes, each containing 1 ml RNAprotect reagent (Qiagen). Tubes were vortexed for 5 seconds,
23
incubated for 5 minutes at RT, and then centrifuged at 5000 rcf for 10 minutes at RT. Bacterial
pellets were stored at -80ºC until ready to use.
Thawed pellets were resuspended with 400 µl freshly made Lysis Buffer (20 mM Na acetate, pH
5.5, 0.5% SDS, 1 mM EDTA, in RNase free water). To the tube, 0.8 g of 0.1 mm silica beads
(BioSpec Products) and 1 ml acidified phenol:chloroform (5:1, pH 4.5) were added. Cell
suspensions were mechanically disrupted in a mini-beadbeater (BioSpec Products) for 1 minute,
followed by 1 minute on ice. This was repeated for 3 cycles. Tubes were then incubated at 65ºC
for 4 minutes and centrifuged at 13K rpm for 5 minutes at 4ºC. The resulting aqueous layer was
then transferred to a new 2 ml microcentrifuge tube containing 900 µl chloroform:isoamyl
alcohol (24:1) placed on ice. To maximize the amount of extracted RNA, 300 µl Lysis Buffer
was replaced in each of the bead beating tubes containing the remaining organic phase and
mechanical lysis by bead beating, incubation and centrifugation were repeated two more times.
Aqueous phases resulting from each round were combined in the same 2 ml tube containing
chloroform: isoamyl alcohol mentioned previously. The tubes were then mixed by inversion and
centrifuged at 13K rpm for 5 minutes at 4ºC. The top aqueous layer was then transferred to a
new 2 ml microcentrifuge tube containing 900 µl isopropanol and 90 µl 3M Na acetate, pH 5.5.
Tubes were mixed gently by inversion and nucleic acids were allowed to precipitate overnight at
-20ºC.
The next day, tubes containing precipitated nucleic acids were centrifuged at 13K rpm for 10
minutes at 4ºC. The supernatant was decanted and the pellet was washed with 1 ml 70% ethanol.
After air drying the pellet for approximately 10 minutes, the pellet was resuspended in 90 µl
RNase-free water and heat-dissolved for 10 minutes at 55ºC.
24
Since both DNA and RNA were precipitated, the mixture was then treated with 5 units DNaseI
(Fermentas) for 30 minutes at 37ºC. DNase inactivation and RNA purification were then
performed using an RNeasy purification kit (Qiagen) using the manufacturer‟s RNA Cleanup
Protocol. The resulting RNA was eluted from the column with 45 µl RNase-free water. A
second round of DNA removal was executed using the Turbo DNA-free kit (Ambion) according
to the manufacturer‟s protocol. The concentration of the RNA was then quantified (NanoDrop
ND-1000, Thermo Scientific) and visualized on a 1% agarose gel. Samples were stored at -80ºC.
cDNA Synthesis
To perform microarray analyses on gene expression, RNA needed to be reverse transcribed into
cDNA. Twenty five micrograms of previously extracted RNA was combined with: 25 mM Tris,
pH 8.4, 37.5 mM KCl, 25 µg random nonomer primer and RNase-free water to a final volume of
50 µl. The mixture was then incubated for 5 minutes at 65ºC and subsequently placed on ice. To
this, 50 µl of a mix containing: 25 µM Tris, pH 8.4, 37.5 mM KCl, 3 mM MgCl2, 20 mM
dithiothreitol, 1.2 mM dATP, 1.2 mM dCTP, 1.2 mM dGTP, 0.4 mM dTTP, 0.4 mM 5-(3-
Aminoallyl)-2‟-Deoxyuridine-5‟-Triphosphate (aadUTP), 400 units Superscript II Reverse
Transcriptase (Invitrogen), in RNase-free water was added. Tubes were incubated at 42ºC for 12
hours to allow reverse transcription into cDNA. Remaining RNA was hydrolyzed by adding 15
µl of 1M NaOH and incubating for 20 minutes at 65ºC. The reaction was then neutralized by the
addition of the same amount of HCl.
To clean up the reaction and remove excess Tris, the cDNA reaction was purified using
QIAquick PCR Purification kit (Qiagen) according to the manufacturer‟s enzymatic clean up
protocol with minor modifications. Equal volumes of 70% ethanol were substituted for the two
rounds of DNA washes. Complementary DNA was eluted by incubating 40 µl of 90ºC water on
25
the column membrane for 1 minute followed by centrifugation at 13K for 1 minute. This was
repeated, resulting in 80 µl. The final cDNA concentration was quantified (NanoDrop ND-1000,
Thermo Scientific).
Cy3 and Cy5 Coupling
Two µg of cDNA was desiccated using a speed vacuum system (Savant DNA 120 SpeedVac
Concentrator; Thermo Electron Corporation) and resuspended in 3.5 µl water. The reconstituted
sample was then combined with the appropriate fluorescent dye. Cy3 and Cy5 Mono-reactive
dye packs (GE Healthcare) were resuspended in 15 µl anhydrous DMSO and 30 µl of 2x
Bicarbonate Buffer (230 mM NaHCO3, 0.5% HCl in water). Subsequently, 3.5µl of the
appropriate dye were added to the designated samples. Mixtures were vortexed, spun down
briefly in the centrifuge, and then incubated for 60 minutes in the dark. To quench the reaction,
3.5 µl of 4M hydroxylamine was added and incubated for an additional 15 minutes in the dark.
To remove excess dye not conjugated to cDNA, a QIAquick PCR cleanup kit (Qiagen) was used
according to the manufacturer‟s protocol with minor modifications. The volume of the cDNA
labeling reaction was increased to 50 µl and diluted in double the volume of PB (Qiagen)
specified by the manufacturer‟s protocol. Resultant purified labeled cDNA was eluted twice in
20 µl EB (10 mM Tris-Cl, pH 8.5) and dried down in a speed vacuum system (Savant DNA 120
SpeedVac Concentrator; Thermo Electron Corporation).
Hybridization to the Microarray
Paired samples, one labeled with Cy3 dye and the other with Cy5, were reconstituted and
combined with 2X GEx Hybridization Buffer HI-RPM (Agilent) and 10X Blocking Reagent
(Agilent) to a final volume of 40 µl. Samples were heated at 95ºC for 3 minutes and collected by
26
centrifugation. Fourty microlitres of each sample was placed onto the microarray (Agilent) and
hybridized at 65ºC for 20 hours.
Before scanning, the microarrays were washed to remove excess cDNA in Wash Buffer 1 (900
mM NaCl, 60 mM NaH2PO4, 6 mM EDTA with 0.005% Sarcosine) by gentile agitation in the
dark. Arrays were then washed again in Wash Buffer 2 (90 mM NaCl, 6 mM NaH2PO4, 600 µM
EDTA) in the same manner as previous. Microarrays were scanned on a GenePix 4200A
Professional microarray scanner (Molecular Devices) using GenePix Pro 6.1 software.
Microarray Analysis
Microarray intensities were corrected using Lowess normalization with R software version 1.9.
Statistically significant genes were detected using Significance Analysis of Microarrays (SAM)
3.0 (Stanford University). Genes were considered to significantly different if they were within a
false discovery rate (FDR) of 5% and showed at least 2-fold change in gene expression.
2.4 IFNγ production in Mice
Inoculation
Each strain (Prague pME, Prague pME-phoP, Prague pME-phoP/R, Japan pME, Japan pME-
phoP, and Japan pME-phoP/R) was grown to an OD600 of 0.4-0.7. Cultures were centrifuged at
4000 rpm for 10 minutes at RT and washed once with PBS/0.01% Tween 80. After centrifuging
again, the pellet was resuspended in PBS/0.01% Tween 80 and passed through a 25 gauge needle
(BD Biosciences) to break up clumps. This was followed by a low speed spin at 1500 rpm for 10
minutes to pellet down larger bacterial clumps. The resulting cell suspension was adjusted to an
OD600 of 0.4 representing 6.7 x 108 cells/ml. Cells were plated to confirm this number.
27
Spleenocyte Isolation
Four female C57BL/6 mice (Charles River Laboratories) were inoculated subcutaneously (s.c.)
with approximately 1.3 108 cfu in 0.2 ml PBS/0.01%Tween 80 per group. A PBS/0.01% Tween
80 alone group was included as a negative control. Mice were euthanized by CO2 inhalation 8
weeks post-inoculation. Spleens were harvested and spleenocytes were isolated. In brief,
spleens were ground between two frosted microscope slides into RPMI media (Invitrogen) and
filtered through a 70 µm cell strainer (BD Biosciences). Resultant cell suspensions were then
centrifuged at 1000 rpm for 10 minutes at 4ºC. The supernatant was decanted and red blood
cells were lysed by resuspending the pellet in 1 ml ACK Lysis Buffer (0.15 M NH4Cl, 10 mM
KHCO3, 0.1 mM Na2EDTA, pH 7.2). After 2 minutes at RT, the reaction was quenched by
adding 30 ml of RPMI and filtered again through a 70 µm cell strainer (BD Biosciences).
Samples were then centrifuged at 1000 rpm for 10 minutes at 4ºC. Media was again removed
and the cell pellet resuspended in 2 ml complete RPMI (cRPMI: RPMI, 10% FBS, 1% L-
glutamine, 1% penicillin/streptomycin). Cells were then quantified using a haemocytometer.
Spleenocyte Activation
Spleenocytes were seeded in a round-bottomed 96-well plate (Falcon) at a concentration of 5 x
105 cells/ well in 200 µl. To stimulate spleenocytes, 50 µl of purified protein derivative (PPD)
(Statens Serum Institute, Denmark) was added to reach a 10 µg/ml final concentration in each
well. For non-stimulated wells, 50 µl of cRPMI were added instead. Five wells were seeded per
mouse spleen for each condition. As control, media alone was cultured with and without PPD
stimulation. Spleenocytes were incubated at 37ºC, 5% CO2 for 72 hours.
28
After 72 hours, cell suspensions for each condition were pooled into a microcentrifuge tube. To
obtain cell free supernatant, tubes were spun for 5 minutes at 5K rpm, 10K rpm, and 13K rpm,
transferring the media to a new tube after each spin, taking care to avoid the cell pellet. Since
extracellular IFNγ release was being measured in this assay, removal of other IFNγ sources that
would skew the results was important. Starting with a low centrifuge speed ensured that
spleenocytes were not lysed, which would release intracellular IFNγ, and higher speeds ensured
all cells were pelleted away from the supernatant. Supernatants were stored at -80ºC.
IFNγ ELISA
Enzyme-linked immunosorbant assays (ELISAs) for IFNγ were conducted on mouse
spleenocytes to determine the extracellular IFNγ released by the activated cells. The OptEIA
Mouse IFNγ ELISA set (BD Biosciences) was used to assay IFNγ levels according to the
manufacturer‟s protocol. In brief, 96-well, flat-bottomed plates (Nunc MaxiSorp) were coated
overnight with capture antibody diluted 1:250 in Coating Buffer (0.1 M Sodium carbonate, pH
9.5). Wells were washed 5 times with 300 µl Wash Buffer (PBS with 0.05% Tween 20). Plates
were then blocked with 200 µl Assay Diluent (PBS, 10% FBS, pH 7.0) for 1 hour in RT.
Following this, 5 rounds of washes were performed with Wash Buffer to remove excess blocking
reagent. Then, 100 µl of each sample in Assay Diluent/0.05% Tween 20 were plated in
triplicate. Standards ranging from 0 pg/ml to 2000 pg/ml were plated in duplicate. After a 2
hour RT incubation, the plate was washed 5 times with Wash Buffer and 100 µl of Working
Detector (detection antibody diluted 1:250 and streptavidin-horseradish peroxidase conjugate
diluted 1:250 in Assay diluents) was added. The plate was then again incubated for 1 hour in
RT. Wells were washed 10 times with Wash Buffer to rid of any unbound substrates. To
develop, 100µl of tetramethylbenzidine (TMB) and hydrogen peroxide was added and incubated
29
for 30 minutes in the dark. To stop the reaction, 50 ml of Stop Solution (1 M H3PO4) was added
and the absorbance at 450 nm was measured on a microplate reader (TECAN infinite M200).
IFNγ levels were calculated based on a standard curve generated by the standards. Controls
including unstimulated media, stimulated media and blank wells were also included to detect
background levels and to ensure the absence of any non-specific binding or reactions with the
developing substrates. Blank wells containing no capture antibody were blocked, and had either
a) detecting antibody, HRP and TMB substrate added, b) HRP and TMB only, or c) detection
antibody and TMB only. These combinations were done in order to ensure that detection
substrates did not produce a false positive result. T-tests were performed using GraphPad Prism
version 5.00 for Windows.
Intracellular Cytokine Staining (ICS) and Fluorescence Activated Cell Sorting (FACS)
Spleenocytes were seeded in a round-bottomed 96-well plate (Falcon) at 2 x 106 cells/well in 100
µl. To stimulate cells, 50 ml PPD was added to a final concentration of 12.5 µg/ml. The
unstimulated cells received the same volume in media. Extra wells for colour controls were also
included and stimulated. Spleenocytes were incubated at 37ºC in 5% CO2. After 19 hours of
stimulation, GolgiPlug (BD Biosciences) was added in a 1:1000 final dilution to each well and
incubated for an additional 5 hours.
After a total of 24hrs stimulation, plates were gently centrifuged at 1400 rpm for 5 minutes at
4ºC. The supernatant was removed and the cell pellet was washed in 200 µl FACS Buffer (0.5%
BSA/PBS) to remove FBS, which may bind non-specifically to antibodies. After washing, the
cell pellet was resuspended in Fc Block (eBiosciences) diluted in FACS Buffer (1:400) and
incubated for 15 minutes on ice in the dark. An additional 150 µl of FACS Buffer was added,
mixed, and plates were centrifuged at 1400 rpm for 5 minutes at 4ºC. Supernatant was removed
30
and cells were extracellularly stained with fluorophore conjugated antibodies: FITC-CD4, PE-
CD3, PerCy5.5-CD8a (BD Biosciences) diluted in FACS Buffer. The antibody against the CD3
receptor was used as a marker to identify T cells. Antibodies to CD4 and CD8 were used to
identify those specific populations among the T cells. The antibodies were incubated with the
cells for 30 minutes on ice in the dark. Incubations were then stopped with the addition of 150
µl FACS Buffer and then centrifuged at 1400 rpm for 5 minutes at 4ºC.
After removal of the supernatant, cells were permeabilized and fixed in preparation for
intracellular cytokine staining by adding 1X CytoFix/CytoPerm (BD Biosciences) to each well.
Reactions were incubated for 20 minutes on ice in the dark, after which plates were centrifuged
as previous and supernatant was removed. Cells were then washed with 1X PermWash (BD
Biosciences) and centrifuged again. Fluorophore conjugated antibody for intracellular IFNγ,
APC-IFNγ (BD Biosciences) diluted in PermWash was added and incubated for 30 minutes on
ice in the dark. Cells were again centrifuged as above and were resuspended in 200 µl FACS
Buffer.
FACS samples were passed through a nylon filter before analysis. FACS analysis was
performed on a FACS Calibur (BD) and data analysis was performed using FlowJo V7.6 by
Vanessa Tran.
2.5 Virulence studies in mice
Virulence studies were conducted using phoP strains (Prague pME, Prague pME-phoP/R, Japan
pME, and Japan pME-phoP/R) and whiB3 strains (Birkhaug pME, Birkhaug pME-whiB3,
Sweden pME, and Sweden pME-whiB3) grown to an OD600 of 0.4-0.7. Cultures were then
pelleted by centrifuging at 4000 rpm for 10 minutes at RT and washed once with sterile
31
PBS/0.01% Tween 80. Once resuspended in PBS/0.01% Tween 80, cells were adjusted until
they were at OD600 0.4, which was approximately 6.7 x 108 cells/ml. Inoculants were each plated
to confirm estimated bacterial numbers.
Six week old, male C57BL/6 mice (Charles River Laboratories Inc.) were inoculated
intravenously (i.v.) with approximately 1.3 108 cfu in 0.2 ml PBS/0.01% Tween 80 of the
appropriate BCG strain. Four mice were included in each group. PBS/0.01% Tween 80 alone
was also included as a negative control group. At days 1, 14, 21, and 42 after injection (Day 21
timepoint was omitted in WhiB3 studies), mice were sacrificed by CO2 asphyxiation. The lungs,
liver, and spleen were harvested and homogenized. Homogenates were then serially diluted and
plated onto Middlebrook 7H11 plates containing 10% OADC and 25 µg/ml kanamycin. Colony
forming units (CFUs) were counted 3 weeks later. Bacterial counts from organ homogenates
harvested 24 hours after inoculation (Day 1 time point) were used as an indicator of initial
infection titre.
2.6 2-D Lipid Analysis of PDIMs and PGLs
Extraction of Apolar Lipids
BCG strains used for phoP related investigations (Prague, Prague pME, Prague pME-phoP,
Prague pME-phoP/R, Japan, Japan pME, Japan pME-phoP, Japan pME-phoP/R) were grown to
mid-log phase. Each culture was pelleted by centrifuging at 3500 rpm for 20 minutes at RT and
was stored at -20ºC. Pellets were then lyophilized (Lyph-Lock 10; Labconco) for 24 hours and
dried cells were stored at -20C until ready to use.
Fifty mg of dried pellet from each strain was extracted with 2 ml methanol-0.3% NaCl (100:10
v/v) and 1 ml petroleum ether for 15 minutes on a rotator at RT. Samples were centrifuged at
32
2600 rpm for 8 minutes at RT to separate the aqueous and organic phases. After separation, the
top petroleum ether phase was transferred to a new 3.7 ml glass tube (Fisher Scientific). The
remaining cell pellet was re extracted with the addition of 1 ml petroleum ether in the same
manner as described above. Both petroleum ether layers were collected in the same tube and
evaporated using a Reacti-Therm Heat/Stirring Module (Pierce).
2-D Apolar Lipid Analysis
Ten mg of apolar lipids resuspended in dichloromethane were spotted onto a Silicon 60 TLC
plate (Whatman). For PDIM analysis, plates were separated in the first dimension with
petroleum ether: ethyl acetate (98:2 v/v) three times. Petroleum ether: acetone (98:2 v/v) was
used to develop in the second dimension. Plates were visualized with 5% molybdophosphoric
acid (5% phosphomolybdic acid in ethanol), followed by charring. For PGL analysis, plates
were developed in the first dimension with chloroform: methanol (96:4 v/v) and in the second
dimension with tolulene: acetone (80:20 v/v). Plates were visualized with -naphthol (9.75% -
naphthol, 10.5% sulphuric acid, 83% ethanol) followed by charring.
2.7 Lipid analysis for DATs, PATs, and SLs
Extraction of Lipids
phoP strains (BCG Pasteur pME, Prague, Prague pME, Prague pME-phoP, and Prague pME-
phoP/R) were each grown to mid-log phase. Cultures were then pelleted by centrifuging at 3500
rpm for 20 minutes at RT and stored at -20ºC. Pellets were lyophilized (Lyph-Lock 10;
Labconco) for 24 hours and stored at -20ºC.
33
Lipids from 50 mg dried bacteria were extracted with 2 ml chloroform:methanol (1:2 v/v) for 20
minutes. Tubes were then centrifuged at 2600 rpm for 8 minutes at RT and the liquid was
transferred to a separate tube. Lipids were re-extracted using 2 ml chloroform:methanol (2:1
v/v) following the same procedure. Liquid containing the extracted lipids were combined and
evaporated at 37ºC using a Reacti-Therm Heat/Stirring Module (Pierce).
Lipid Analysis
Ten mg of lipids resuspended in dichloromethane were spotted onto Silica Gel 60 TLC plates
(Whatman). To develop DATs, PATs, and SLs, chloroform: methanol: water (60:16:2 v/v) was
used. To develop PATs alone, petroleum ether: acetone (92:8) was used. Lipids in both cases
were visualized by dipping in 5% molydophosphoric acid (5% phosphomolydic acid in 95%
ethanol).
2.8 qRT-PCR of phoP in IS6110 strains
RNA Isolation
BCG-Pasteur, -Japan, -Russia, and –Moreau were grown to an OD600 of 0.4-0.6. Subsequent
RNA isolation followed the same protocol as stated above for the microarrays.
cDNA Synthesis
RNA was reverse transcribed into cDNA in the same manner as stated above for the microarrays.
However, reactions contained only 15 µg RNA and dNTPs used in the reaction were as follows:
0.6 mM dATP, 0.6 mM dCTP, 0.6 mM dGTP, and 0.6 mM dTTP (Fermentas). Negative control
reactions were performed in parallel without the addition of enzyme. Resultant cDNA was
quantified (NanoDrop ND-1000, Thermo Scientific) and visualized on a 1% agarose gel.
34
Quantitive PCR (qPCR)
Total cDNA for each BCG strain was diluted to a concentration of 20 ng/µl. A standard curve
was generated by designating the 20 ng/µl aliquot as the 100 copy sample and doing 10-fold
dilutions. The 20 ng/µl solution was then diluted 1:10 and used as the unknown sample to be
quantified. The 15 µl qPCR reactions were done on a 96-well plate (twintec PCR plate,
Eppendorf) with each well containing 2X SYBR Green Jumpstart Taq Ready Mix (Sigma),
0.5uM of respective forward primer, 0.5uM of respective reverse primer, and 4.5 µl of the
appropriate cDNA sample. Primers used for the detection of phoP were forward primer phoP-F
(5‟- TATCGGCGAACGTCAGTCGAACAT -3‟) and reverse primer phoP-R (5‟-
TATCGGCGAACGTCAGTCGAACAT -3‟). Sigma factor A (sigA), a housekeeping gene, was
used for normalization and was detected using forward primer sigA-F (5‟-
TCGAGGTGATCAACAAGCTG -3‟) and reverse primer sigA-R (5‟-
TGGATCTCCAGCACCTTCTC -3‟). Cycling conditions were as follows: 95ºC for 2 min, and
then 40 cycles of 95ºC for 15 seconds, 55ºC for 15 seconds, and 68ºC for 20 seconds. After
cycling was completed, a melting curve was performed where PCR products were heated with
increasing temperature over 20 minutes from 60ºC to 95ºC. This process detected when double
stranded PCR products melted to confirm that each reaction contained only one type of PCR
product.
Standards and unknown samples were done in triplicate. A negative control for each set of
primers was included for each BCG strain tested. The negative control sample consisted of the
product from the negative cDNA synthesis reaction previously done without reverse
transcriptase. Quantitive PCRs was performed in a Mastercycler ep realplex4 real-time
35
thermocycler (Eppendorf) using Realplex 4.4 software. T-tests were performed using GraphPad
Prism version 5.00 for Windows.
2.9 WhiB3 plate assays
WhiB3 plate assays were conducted according to Singh et. al. (113). Briefly, Birkhaug pME,
Birkhaug pME-whiB3, Sweden pME, and Sweden pME-whiB3 were grown to mid-log phase in
7H9 broth and normalized to an OD600 ~1.0. Twenty µl of each strain were spot-plated onto each
plate and kept at 37ºC for 3 weeks. Plates were comprised of Dubos media (glycerol omitted)
with 1.5% agar and an added carbon source. Dubos agar was supplemented with no additional
carbon source (basal) or 50 mM glucose, 50 mM succinate, 50 mM fumarate, 50 mM pyruvate,
50 mM citrate, or 25 mM acetate.
36
Chapter 3
Role of PhoP in BCG Immunogenicity
Introduction
Compared to other BCG sub-strains, BCG-Prague is considered a weak vaccine due to its low
PPD reactivity, which is used as a measure of immunogenicity (81, 130). However, the
mechanism behind this was unclear until recent analysis by our lab revealed that BCG-Prague
contains a mutation within the phoP gene, a defect not present in any of the other 12 strains
examined (86). This single guanine (G) insertion caused a frame shift mutation affecting the
majority of the C-terminal DNA-binding domain, likely abrogating PhoP function. PhoP is
responsible for transcriptionally upregulating 44 genes in M. tb, some of which are well
established immunogenic antigens (133). phoP mutants of M. tb were previously shown to be
attenuated, including the avirulent H37Ra strain which also has a mutation in the DNA binding
domain of the protein (85). Taken together, I hypothesize that the non-functional PhoP in BCG-
Prague is unable to induce immunogenic T cell antigens and thus is responsible for the weak
immune response elicited by this strain.
To test this hypothesis, I complemented the natural phoP defect in BCG-Prague with either the
WT phoP gene alone or WT phoP and phoR on an external plasmid. Using these strains I
determined by microarray whether PhoP regulated known immunogenic proteins and confirmed
that the upregulation of these antigenic proteins induced a stronger immunogenic reaction in a
mouse model of infection. I also tested the residual virulence of the strains to ensure that the
addition of PhoP did not inadvertently increase virulence. In addition, the importance of PhoP
37
was demonstrated by assessing the effect of an IS6110 insertion on phoP expression in BCG-
Russia, BCG-Japan, and BCG-Moreau and associating this to their clinical vaccine properties.
Results
3.1 PhoP regulates genes associated with BCG Immunogenicity
As the first step to confirm my hypothesis, I constructed a recombinant BCG-Prague containing
a WT phoP gene on a plasmid (named Prague pME-phoP) and performed microarray analysis.
The WT phoP gene was cloned from BCG-Pasteur, which previous NimbleGen analysis had
shown to contain no mutations in the phoP-phoR locus (86).
My microarray analysis reveals that out of approximately 4000 genes in the BCG genome, 67
were upregulated by PhoP by at least 2-fold, some of which encode proteins associated with host
immune induction. In addition, six genes were downregulated by PhoP. These genes along with
their genomic loci and functions are listed in Table 1. One particular gene of interest is fbpA,
which encodes Antigen 85A, a highly antigenic secreted protein (16, 99). Antigen 85A belongs
to a complex of proteins including Antigen 85B and 85C. Together they are the main
constituents of the proteins secreted by mycobacteria (60) and are also bound to the cell surface
(104). While the exact role of the Antigen 85 complex is still unknown, it may be involved in
attachment and uptake of the bacilli into host cells (138). Antigen 85A is also a well established
T cell antigen. Host antibodies against Antigen 85A block bacterial attachment and prevent
mycobacterial infection of host cells. Consistent with my finding, Antigen 85A was also
upregulated by PhoP in an expression profile study done by Walters, et al., which compared M.
tb H37Rv and an isogenic phoP mutant (133). These results suggest that Antigen 85A is an
important immunogenic factor across mycobacterial species.
38
Another group of upregulated genes encode ESAT-6-like proteins: EsxJ (Rv1038c), EsxK
(Rv1197), EsxL (Rv1198), EsxM (Rv 1792), EsxN (Rv1793), EsxO (Rv 2346c), EsxP
(Rv2347c), EsxV (Rv3619c), and EsxW (Rv 3620c). These are nine out of ten known ESAT-6-
like proteins secreted by the ESX-5 secretion system, which has been linked to virulence and
immunomodulation in M. marinum (3, 5, 111). The remaining ESX-5 secreted protein, EsxI
(Rv1037c), was upregulated but did not pass the 2-fold cut off (data not shown). Furthermore,
other ESAT-6-like proteins secreted by other ESX systems were not present, indicating that this
upregulation was specific for the ESX-5 secretion system. ESX-5 is one of five type VII
secretion systems in M. tb, which are specialized secretion systems found in actinomycetes. The
most well characterized member of this family is ESX-1, which secretes the important virulence
factors ESAT-6 (EsxA) and CFP-10 (EsxB) in M. tb. Interestingly, other than ESX-1 , ESX-5 is
the only other ESX system with an associated role in virulence (2). It also facilitates cell-to-cell
spread of M. marinum in infected macrophages, a function shared by ESX-1 (4). However, ESX-
5 does not complement ESX-1 deletion, which suggests that they have distinct roles in virulence
(2). The parallels between the ESX-1 and ESX-5 secretion systems, namely the secretion of the
ESAT-6-like and PE/PPE proteins, suggest that ESX-5 may have a similar role in virulence and
immunogenicity as ESX-1.
In addition to the ESAT-6-like proteins, expression of genes encoding PE25, PE_PGRS35,
PPE19, PPE41, and PPE 60 were increased. These proteins belong to the PE/PPE family of
proteins, which are characterized by N-terminal proline-glutamic acid (PE) and proline-proline-
glutamic acid (PPE) motifs. Although the exact role of these proteins is unknown, they have
been implicated in virulence (87, 103), immune evasion (21, 44), and are a source of
mycobacterial antigenic variation (12, 21). PE/PPE proteins are unique to mycobacteria and are
highly expanded in pathogenic strains, accounting for about 9% of the coding genome of M. tb
39
(35). Consistent with my results, PPE19 and PPE60 were also significantly upregulated by PhoP
in the aforementioned M. tb study by Walters et al. (133). Interestingly, PPE41 is secreted by
ESX-5 (4), further supporting the link between PhoP and ESX-5 secretion.
Taken together, I have shown that PhoP positively regulates the expression of known T cell
antigens in BCG-Prague. Although the majority of the PhoP-regulated genes from my
microarray analysis were distinct from the results obtained in M. tb by Walters et al. (133), this
large discrepancy was not unexpected. The study of BCG is often complicated by the fact that
the strains harbour many unidentified and uncharacterized mutations that may indirectly affect
the expression of genes. This genetic heterogeneity emphasizes the importance of conducting
studies in specific BCG strains since studies done in other mycobacteria and even other BCG
strains are not always representative.
40
Table 1. Comparison of Prague pME and Prague pMe-phoP by microarray.a
Genes upregulated by PhoP in BCG-Prague
Gene # Gene Function Mean Fold q-value (%) Classification
Rv0009 ppiA IRON-REGULATED PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A, PROTEIN FOLDING
2.02 4.783 information pathways
Rv0288 esxH LOW MOLECULAR WEIGHT PROTEIN ANTIGEN 7 (CFP-7) (PROTEIN TB10.4)
2.00 3.273 cell wall and cell
processes
Rv0341 iniB ISONIAZID INDUCTIBLE PROTEIN 6.65 1.542 cell wall and cell
processes
Rv0342 iniA ISONIAZID INDUCTIBLE PROTEIN 2.64 1.542 cell wall and cell
processes
Rv0371c Rv0371c CONSERVED HYPOTHETICAL PROTEIN 2.74 1.542 conserved
hypotheticals
Rv0467 icl ISOCITRATE LYASE, GLYOXYLATE
BYPASS 2.00 1.542
intermediary metabolism and
respiration
Rv0500B Rv0500B CONSERVED HYPOTHETICAL PROTEIN 2.18 4.783 conserved
hypotheticals
Rv0640 rplK 50S RIBOSOMAL PROTEIN 2.20 1.542 information pathways
Rv0685 tuf IRON-REGULATED ELONGATION FACTOR 3.88 4.783 information pathways
Rv0700 rpsJ RIBOSOMAL PROTEIN S10 2.81 1.785 information pathways
Rv0701 rplC 50S RIBOSOMAL PROTEIN L3 2.91 3.625 information pathways
Rv0703 rplW 50S RIBOSOMAL PROTEIN L23 2.57 4.899 information pathways
Rv0704 rplB 50S ribosomal protein L2 3.00 4.783 information pathways
Rv0708 rplP 50S RIBOSOMAL PROTEIN L16 2.18 4.899 information pathways
Rv1038c esxJ ESAT-6 LIKE PROTEIN 5.72 1.542 cell wall and cell
processes
Rv1094 desA2 ACYL-[ACYL-CARRIER PROTEIN]
DESATURASE, FATTY ACID BIOSYNTHESIS
2.01 3.273 lipid metabolism
Rv1197 esxK ESAT-6 LIKE PROTEIN 4.02 1.542 cell wall and cell
processes
Rv1198 esxL ESAT-6 LIKE PROTEIN 5.21 1.542 cell wall and cell
processes
Rv1211 Rv1211 CONSERVED HYPOTHETICAL PROTEIN 2.38 3.528 conserved
hypotheticals
Rv1322A Rv1322A CONSERVED HYPOTHETICAL PROTEIN 2.43 3.273 conserved
hypotheticals
Rv1361c PPE19 PPE FAMILY PROTEIN 2.26 3.273 PE/PPE
41
Rv1641 infC PROBABLE INITIATION FACTOR IF-3 2.87 1.542 information pathways
Rv1642 rpmI 50S ribosomal protein L35 2.06 3.273 information pathways
Rv1643 rplT 50S ribosomal protein L20 2.54 3.625 information pathways
Rv1792 esxM ESAT-6 LIKE PROTEIN 5.21 1.542 cell wall and cell
processes)
Rv1793 esxN ESAT-6 LIKE PROTEIN 4.41 1.785 cell wall and cell
processes
Rv1884c rpfC RESUSCITATION-PROMOTING FACTOR 2.39 1.542 cell wall and cell
processes
Rv1983 PE_PGRS35 PE-PGRS FAMILY PROTEIN 2.48 1.542 PE/PPE
Rv2204c Rv2204c CONSERVED HYPOTHETICAL PROTEIN 2.26 3.273 conserved
hypotheticals
Rv2346c esxO ESAT-6 LIKE PROTEIN 5.00 1.785 cell wall and cell
processes
Rv2347c esxP ESAT-6 LIKE PROTEIN 5.36 1.542 cell wall and cell
processes
Rv2430c PPE41 PPE FAMILY PROTEIN 2.13 3.273 PE/PPE
Rv2431c PE25 PE FAMILY PROTEIN 2.01 1.542 PE/PPE
Rv2931 ppsA PHENOLPTHIOCEROL SYNTHASE, PDIM
BIOSYNTHESIS 2.17 0 lipid metabolism
Rv2935 ppsE PHENOLPTHIOCEROL SYNTHASE, PDIM
BIOSYNTHESIS 2.54 0 lipid metabolism
Rv2936 drrA ATP BINDING PROTEIN, PDIM
BIOSYNTHESIS & ANTIBIOTIC EXPORT 2.96 0
cell wall and cell processes
Rv2945c lppX CONSERVED LIPOPROTEIN 2.20 1.785 cell wall and cell
processes
Rv2946c pks1 POLYKETIDE SYNTHASE, LIPID
SYNTHESIS 2.02 1.542 lipid metabolism
Rv2949c Rv2949c CONSERVED HYPOTHETICAL PROTEIN 2.32 1.542 conserved
hypotheticals
Rv2950c fadD29 FATTY-ACID-CoA LIGASE, LIPID
DEGRADATION 2.70 1.542 lipid metabolism
Rv3211 rhlE ATP-DEPENDENT RNA HELICASE 2.18 1.542 information pathways
Rv3219 whiB1 TRANSCRIPTIONAL REGULATORY
PROTEIN 3.88 1.542 regulatory proteins
Rv3460c rpsM PROBABLE 30S RIBOSOMAL PROTEIN S13 2.26 1.542 information pathways
Rv3462c infA TRANSLATION INITIATION FACTOR IF-1 2.69 1.542 information pathways
Rv3478 PPE60 PE FAMILY PROTEIN 2.12 4.783 PE/PPE
42
Rv3619c esxV ESAT-6 LIKE PROTEIN 4.89 1.542 cell wall and cell
processes
Rv3620c esxW ESAT-6 LIKE PROTEIN 4.05 1.542 cell wall and cell
processes
Rv3648c cspA COLD SHOCK PROTEIN A 3.57 1.785
Rv3804c fbpA SECRETED ANTIGEN 85-A, CELL WALL
MYCOLOYLATION 2.78 3.625 lipid metabolism
Rv3841 bfrB BACTERIOFERRITIN 4.15 1.542 intermediary
metabolism and respiration
Rv3863 Rv3863 CONSERVED HYPOTHETICAL ALANINE-
RICH PROTEIN 2.00 0
conserved hypotheticals
Rv3924c rpmH 50S RIBOSOMAL PROTEIN L34 2.08 1.542 information pathways
rrl RIBOSOMAL RNA 23S 12.35 0
rrs RIBOSOMAL RNA 16S 9.10 1.542
rrf ribosomal RNA 5S 7.41 1.542
rnpB ribonuclease P RNA 5.02 3.273
ssr 10Sa RNA 4.92 1.542
glyU tRNA-Gly 4.37 1.542
glnU tRNA-Gln 3.26 3.625
lysU tRNA-Lys 3.04 3.273
thrT tRNA-Thr 2.94 4.783
valU tRNA-Val 2.80 1.785
asnT tRNA-Asn 2.50 1.785
serX tRNA-Ser 2.38 4.899
valV tRNA-Val 2.16 1.542
serU tRNA-Ser 2.14 1.785
ileT tRNA-Ile 2.06 0
43
Genes repressed by PhoP in BCG-Prague
Gene # Gene Function Mean Fold q-value(%) Classification
Rv0160c PE4 PE FAMILY PROTEIN 0.48 2.188 PE/PPE
Rv0252 nirB PROBABLE NITRITE REDUCTASE, LARGE
SUBUNIT 0.49 4.899
intermediary metabolism and
respiration
Rv1130 Rv1130 CONSERVED HYPOTHETICAL PROTEIN 0.46 3.273 conserved
hypotheticals
Rv1542c glbN HEMOGLOBIN 0.50 2.678 intermediary
metabolism and respiration
Rv1703c Rv1703c catechol-o-methyltransferase 0.23 2.188 intermediary
metabolism and respiration
Rv1704c cycA D-SERINE/ALANINE/GLYCINE TRANSPORTER
PROTEIN 0.47 2.188
cell wall and cell processes
The transcription profiles of Prague pME (WT) and the complemented strain Prague pME-phoP were compared to
determine genes under the control of PhoP. Strains were grown in Middlebrook 7H9 media (supplemented with
10% ADC, 0.05% Tween 80) and were harvested at an OD600 nm between 0.4-0.6. Three independent microarrays
(Agilent) were performed using different biological RNA samples for each. Microarrays were normalized using
Lowess normalization. Genes with 2-fold or greater changes compared to WT and with a q-value ≤ 5% (% chance
of being a false positive), as determined by SAM statistical analysis, were included in this list. Genes are listed in
the order they occur in the BCG genome along with the average fold change, q-value, and their annotation according
to the M. tb genome on TUBERCULIST (Pasteur Institute). There are 67 genes upregulated and 6 downregulated
by PhoP. In blue: genes that are ESAT-6-like proteins belonging to ESX-5 secretion system (9 of 10 known). In
green: genes that are part of the PDIM/PGL synthesis locus.
44
3.2 Recombinant BCG-Prague expressing PhoP induces an elevated
immune response
Since PhoP regulates antigenic proteins in BCG-Prague (Antigen 85A, ESAT-6-like and PE/PPE
proteins), I wanted to determine whether PhoP-dependent regulation of these proteins affect
levels of immune induction. IFNγ is a surrogate marker of immune response and its production
by immune cells is correlated with protective BCG vaccination (18, 54). To test the role PhoP
plays in immunogenicity, I compared IFNγ induction in Prague pME to two PhoP-complemented
strains, Prague pME-phoP, and Prague pME-phoP/R. As described in Materials and Methods
(Chapter 2), four mice per group were subcutaneously (s.c.) inoculated with each strain and
spleenocytes were isolated eight weeks post-injection. Secreted IFNγ was then measured by
ELISA from spleenocytes that were either stimulated with 10 µg/ml PPD, or left unstimulated.
My results show that restoration of phoP in BCG-Prague increases IFNγ production (Figure 5).
IFNγ levels rose significantly from 5,327 ± 3,096 pg/ml in Prague pME to 12,510 ± 9,393 pg/ml
in Prague pME-phoP (p< 0.05, n=4). Surprisingly, a decrease in IFNγ was reported in Prague
pME-phoP/R (3,872 ± 2,272 pg/ml). These results show that PhoP-regulated proteins affect the
immunogenicity of BCG-Prague since complementation with PhoP increased IFNγ production.
This further supports the loss of phoP as the mechanism behind the loss of immunogenicity in
BCG-Prague.
45
Figure 5. The effect of phoP on BCG-Prague IFNγ production in stimulated mouse spleenocytes. BCG-Prague
strains (Prague pME, Prague pME-phoP, Prague pME-phoP/R) were inoculated subcutaneously into C57BL/6 mice.
Eight weeks post-inoculation, spleenocytes were harvested and stimulated with 10µg/ml PPD. Extracellular IFNγ
production was determined by ELISA. Results reported are IFNγ levels produced by PPD-stimulated spleenocytes
adjusted by subtracting IFNγ released in corresponding unstimulated spleenocytes. Statistical analysis using a T-test
show significant difference between Prague pME and Prague pME-phoP (p<0.05, n=4)(*).
46
3.3 Recombinant BCG-Japan over-expressing PhoP induces an
increased immune response
Since my ultimate goal is to make a more effective vaccine, I wanted to see whether the over-
expression of PhoP in BCG-Japan would increase the immunogenicity of the strain. BCG-Japan
has a consistent safety record in clinical studies mainly due to the loss of PDIM/PGLs, cell wall
lipids tightly associated with virulence. In addition, BCG-Japan is an „early strain‟ and retains
more characteristics of the original BCG strain compared to the later evolved BCG-Prague (14).
I hypothesized that the over-expression of phoP would make BCG-Japan a more immunogenic
vaccine while still maintaining its safety due to the absence of PDIM/PGLs. To test this, IFNγ
induction was measured in the same manner as before using Japan pME, Japan pME-phoP, and
Japan pME-phoP/R (Figure 6). Both Japan pME-phoP (26,364 ± 13,057 pg/ml IFNγ) and Japan
pME-phoP/R (31,772 ± 4,260 pg/ml IFNγ) elicited higher IFNγ production in mice spleenocytes
compared to Japan-pME alone (11,550 ± 2,759 pg/ml IFNγ). The IFN γ levels induced by Japan
pME-phoP (p< 0.01, n=4) and Japan pME-phoP/R (p< 0.001, n=4) were also both significantly
different from the amount produced by Japan pME.
Closer inspection of these results shows that BCG-Japan strains cause stronger IFNγ production
than BCG-Prague strains. The lowest inducer of IFNγ among the Japan strains, Japan pME,
produced higher readings than the highest inducer of IFNγ in the Prague strains, Prague pME-
phoP. This phenomenon may be due to the over-expression of PhoP in BCG-Japan strains,
which already have a functional phoP gene in addition to the one introduced on the external
plasmid. Evidence presented later in this work also shows that PhoP expression in BCG-Japan is
naturally high and not properly regulated, thereby compounding the level of PhoP over-
expression. It is clear from these results that while PhoP affects the immunogenicity of both
47
BCG sub-strains, more work is needed to characterize the type of immune response elicited by
both strains.
48
Figure 6. The effect of phoP on BCG-Japan IFNγ production in stimulated mouse spleenocytes. Japan pME, Japan
pME-phoP, and Japan pME-phoP/R strains were injected subcutaneously into C57BL/6 mice. Eight weeks post-
inoculation, spleenocytes were harvested and stimulated with 10µg/ml PPD. Extracellular IFNγ production was
determined by ELISA. Reported numbers are IFNγ levels produced by PPD-stimulated spleenocytes adjusted for
background IFNγ released in corresponding unstimulated spleenocytes. Statistical analysis using a T-test show
significant difference between Japan pME and Japan pME-phoP (p<0.01, n=4) (**) and between Japan pME and
Japan pME-phoP/R (p<0.001, n=4) (***).
49
3.4 Over-expression of PhoP induces higher levels of IFNγ-
producing CD4+ T cells in recombinant BCG-Japan
I have shown that PhoP is involved in host immune induction through its control of secreted
antigens. These antigens are recognized by T cells, which play an essential role in
immunological memory. In order to be effective, the vaccine strain must elicit the proper
immune response, including the induction of the proper T cell subtypes. Of particular interest
are changes in CD4+ and CD8
+ T cells because both these populations are required for a
protective immune response against M. tb (55, 57, 131). While my ELISA data provided overall
IFNγ levels released by immune cells, it is still unclear what T cells subsets are activated
specifically. It is expected that strains with increased phoP expression would also show
increased numbers of T cells. To determine the relative amount of each T cell subpopulation
induced by PhoP, Vanessa Tran from my lab performed ICS (Intracellular Cytokine Staining)
and FACS (Fluorescence Activated Cell Sorting) analysis on mouse spleenocytes isolated for
previous ELISA experiments. This allowed the identification and enumeration of T cell sub-
populations producing specific cytokines of interest. Spleenocytes were either stimulated with
PPD or left unstimulated and were stained for extracellular T cell markers CD3+, CD4
+ and
CD8+ using fluorophore conjugated antibodies. A CD3
+ antibody was used to identify T cells by
recognizing a T cell receptor. Antibodies for CD4+ and CD8
+ were specific for their respective T
cell subtypes. Cells were also stained for intracellular expression of IFNγ. Only CD3+ CD4
+
IFNγ+ or CD3
+ CD8
+ IFNγ
+ T cell populations were examined for this study. Cell counts in each
population of interest derived from unstimulated spleen cells were considered background and
were subtracted from the counts obtained from stimulated spleenocytes.
50
Results from BCG-Prague strains show that Prague pME (122,425 ± 93,371 cells) have higher
counts of IFNγ producing CD4+ T cells compared to Prague pME-phoP (87,375 ± 59,485 cells)
and Prague pME-phoP/R (51,400 ± 45,183 cells) (Figure 7a). The same is seen in CD8+
populations with Prague pME (97,250 ± 103,284 cells) producing higher cell counts than Prague
pME-phoP (48,075 ± 27,137 cells) and Prague pME-phoP/R (26,575 ± 23,566 cells) (Figure 7b).
The high levels of both CD4+ and CD8
+ T cell induction observed in Prague pME was surprising
since they contradict earlier IFNγ ELISA results and cannot be explained at this time.
IFNγ producing T cells were also examined in Japan pME, Japan pME-phoP, and Japan pME-
phoP/R to determine whether over-expressing phoP would have an effect on T cell populations.
Both Japan pME-phoP (70,980 ± 41,778 cells) and Japan pME-phoP/R (128,575 ± 39,951 cells)
showed an increase of CD4+ IFNγ producing T cells when compared to Japan pME (46,825 ±
56,710 cells) (Figure 7c). However, no statistically significant differences were found between
the strains. The number of IFNγ producing CD8+ T cells induced by Japan pME (52,100 ±
36,118 cells), Japan pME-phoP (46,760 ± 35,217 cells), and Japan pME-phoP/R (47,525 ±
44,644 cells) were similar among the three strains (Figure 7d). Although not statistically
significant, the increased CD4+ T cells in recombinant BCG-Japan strains is a promising result
that further demonstrates the role of PhoP in immunogenicity.
51
Figure 7. The effect of phoP on IFNγ-producing CD4+ and CD8
+ T cells in the spleen. FACS analysis was
performed on activated spleenocytes stained for intracellular IFNγ and the extracellular T cell markers CD4, CD8,
and CD3. Specific T cell populations induced by recombinant BCG-Prague strains were identified and enumerated:
CD3+ CD4
+ IFNγ
+ T cells (A) and CD3
+ CD8
+ IFNγ
+ (B). The same was done for T cell populations reported for
recombinant BCG-Japan constructs: CD3+ CD4
+ IFNγ
+ T cells (C) and CD3
+ CD8
+ IFNγ
+ (D). Numbers from
activated spleenocytes were background subtracted using counts from unstimulated spleenocytes stained in parallel.
Four mice per BCG strain were tested. No significant differences were found using a T-test.
52
3.5 The over-expression of PhoP/R does not increase BCG-Prague
and BCG-Japan virulence
As mentioned previously, PhoP is a virulence factor in M. tb. One potential concern is that over-
expression of phoP in BCG may increase its virulence and have a negative impact on safety. My
microarray analysis found seven genes in the PDIM/PGL biosynthetic locus that were also
upregulated with PhoP expression. PDIMs and PGLs are structurally related cell wall lipids that
have been linked to virulence (66, 78, 108).
To assess whether virulence in Prague pME-phoP/R was increased compared to WT BCG-
Prague, I intravenously (i.v.) injected each strain into immunocompetent mice and enumerated
the bacterial burdens in the lung, spleen and liver. My results show that virulence in BCG-
Prague is generally unaffected by the addition of a functional PhoP (Figure 8). Although Day 21
counts in the liver indicate a slight increase in virulence, this may not be significant enough to
produce a noticeable clinical difference.
The same experiments were performed in BCG-Japan, using Japan pME and Japan pME-
phoP/R, to ensure that over-expression of PhoP does not result in increased virulence. The
results also show that PhoP does not increase virulence of BCG-Japan strains in mice (Figure 8).
53
Fig
ure
8.
Th
e ef
fect
of
ph
oP
on
BC
G-P
rag
ue
and
BC
G-J
apan
vir
ule
nce
. T
o d
eter
min
e th
e ef
fect
of
pho
P o
n v
iru
len
ce,
stra
ins
con
tain
ing
ph
oP
on
an
ex
tern
al p
lasm
id (
Pra
gue
pM
E-p
ho
P/R
an
d J
apan
pM
E-p
ho
P/R
) w
ere
com
par
ed t
o t
hei
r W
T e
qu
ival
ents
(P
rag
ue
pM
E a
nd
Jap
an p
ME
,
resp
ecti
vel
y).
F
ou
r m
ice
per
gro
up
wer
e in
ocu
late
d w
ith
eac
h s
trai
n.
Lu
ng
s, s
ple
en a
nd l
iver
s w
ere
har
ves
ted
at
day
s 1
, 1
4,
21
, an
d 4
2 p
ost
-
ino
cula
tio
n.
Ho
mog
eniz
ed o
rgan
s w
ere
pla
ted
an
d C
FU
s w
ere
enu
mer
ated
aft
er 3
wee
ks.
S
om
e ti
me
po
ints
had
no
dat
a (N
D)
du
e to
inap
pro
pri
ate
sele
ctio
n o
f d
iluti
on
ran
ges
fo
r p
lati
ng
org
an h
om
og
enat
es.
54
3.6 PhoP has no effect on PDIM and PGL synthesis
Since my microarray results indicated an upregulation of seven genes in the PDIM/PGL
biosynthesis locus due to the over-expression of phoP, I wanted to verify that their production
was affected. To do this, I used TLC (thin layer chromatography) to separate the different lipid
classes based on their relative polarity. In order to investigate the possible link between phoP
expression and PDIM/PGL synthesis in BCG-Prague, I performed 2D-TLC (two-dimensional
thin layer chromatography) analysis on the strains compared previously by microarray, Prague
pME and Prague pME-phoP. In addition, I also performed 2D-TLC analysis on the other BCG-
Prague strains used in this work, Prague pME-phoP/R, as well as a WT strain without a vector.
To do this, apolar lipids were extracted from each of the recombinant strains and separated
chromatographically using the appropriate solvents as described in Materials and Methods
(Chapter 2).
TLC analysis revealed an unexpected loss of PDIM and PGL production in some BCG-Prague
strains, which may account for the upregulation of the seven PDIM/PGL biosynthetic genes seen
in my microarray expression study. As expected from previous studies in our lab comparing
lipid production among BCG strains (31), BCG-Prague showed both PDIM and PGL production
(Figure 9A-1 and 9B-1). Surprisingly, there was a loss of both lipids in Prague-pME, which is
considered WT (Figure 9A-2 and 9B-2). While Prague pME-phoP produced PDIM and PGLs
(Figure 9A-3 and 9B-3) as anticipated, these lipids were also absent in the Prague pME-phoP/R
strain (Figure 9A-4 and 9B-4). Active PDIM/PGL production in the PhoP-complemented strain
(Prague pME-phoP) combined with the loss of PDIM/PGL production in the WT strain (Prague
pME) resulted in an artificial increase in expression of PDIM/PGL biosynthesis genes in my
microarray since the WT strain was not producing these lipids. These results indicate that
55
PDIM/PGL upregulation in my microarray analysis was affected by inconsistencies in the lipid
production in the BCG-Prague strains themselves and not by PhoP-dependent regulation.
PDIMs and PGLs are complex lipids associated with virulence and are sometimes selected
against in vitro, a phenomenon seen in other labs (47). It is hypothesized that random lipid loss
occurs because their production requires a large expenditure of energy that is wasted when
grown in culture. Unfortunately, this finding has complicated the results of not only the
microarray, but also of mouse studies done in this work that would be affected by the drop in
virulence in the Prague pME strain. Nonetheless, this serves as confirmation that PDIM/PGL
production is not regulated by PhoP. This result is consistent with previously published studies
in M. tb H37Rv, where PDIM production and PhoP regulation were completely independent
from one another (32)
In addition to BCG-Prague strains, BCG-Japan strains (Japan pME, Japan pME-phoP, and Japan
pME-phoP/R) constructed for mice experiments were also analyzed by TLC. Since BCG-Japan
is naturally deficient in PDIM/PGL production (31), they are not expected to produce either
lipid. As predicted, 2-D TLC analysis showed no production of PDIMs or PGLs in any of the
strains (Figure 9C and 9D).
56
Figure 9. PDIM and PGL lipids in BCG-Prague and BCG-Japan bacterial strains by two-dimensional thin layer
chromatography. Apolar lipids from BCG-Prague strains (Prague, Prague pME, Prague pME-phoP, Prague pME-
phoP/R) and BCG-Japan strains (Japan, Japan pME, Japan pME-phoP, Japan pME-phoP/R) were analyzed by TLC.
PDIMs for BCG-Prague strains (A) and BCG-Japan strains (C) were separated using the solvents petroleum
ether/ether acetate (98:2 v/v) three times in the first dimension and petroleum ether/acetone (98:2 v/v) in the second
dimension. Plates were then charred with 5% molydophosphoric acid. PGLs for BCG-Prague strains (B) and BCG-
Japan strains (D) were developed using chloroform/methanol (96:4 v/v) in the first dimension and tolulene/acetone
(80:20 v/v) in the second dimension. Lipid spots were visualized using -naphthol/sulphuric acid, followed by
charring of the plate. PDIMs and PGLs are shown as indicated.
57
3.7 PhoP has no effect on DAT, PAT and SL production in BCG
The cell wall of mycobacteria is comprised of many complex lipids that serve both protective
and pathogenic roles. More than half of the 44 genes upregulated by PhoP in M. tb are
associated with cell wall components including lipid biosynthesis and secretion (133). Included
in this list are pks2 and msl3, which encode enzymes involved in the biosynthesis of sulfolipids
(SLs), diacyltrehalose (DATs), and polyacyltrehaloses (PATs) (48, 115). These lipids are only
found in pathogenic mycobacteria closely related to M. tb and are crucial to the bacteria‟s ability
to survive in its host (42, 78). Previous studies with an M. tb H37Rv phoP mutant demonstrated
that PhoP regulates the biosynthesis of these trehalose-containing lipids (32, 65). Although the
expression of these biosynthetic genes was not significantly upregulated in my microarray
analysis, lipid production could still be affected. In order to determine whether PhoP in BCG-
Prague controls production of these lipids as well, a one-dimensional TLC was performed to
separate and visualize DATs, PATs, and SLs. In addition, the recapitulation of these lipids will
also provide evidence that phoP has functionally complemented the defective PhoP in BCG-
Prague. To do this, lipids were extracted using chloroform/methanol and developed in
chloroform/methanol/water (60:16:2 v/v) for DATs and PATs, or petroleum ether/acetone (98:2
v/v) for SLs as described in Material and Methods (Chapter 2).
The lipid profiles of BCG-Pasteur, BCG-Prague, Prague pME, Prague pME-phoP, and Prague
pME-phoP/R showed no discernable differences in banding patterns (Figure 10) meaning that
DAT, PAT, and SL production are not affected by PhoP in BCG-Prague. As a consequence, the
restoration of the trehalose-containing lipids, signifying functional complementation of the
defective phoP gene in BCG-Prague, also could not be confirmed. To further complicate the
analysis, the banding patterns were distinct from other TLC analyses done in M. tb and M. tb
58
phoP mutants (32, 65, 133). Therefore, lipid bands cannot currently be identified and would
require further analysis by mass spectrophotometry, which was not performed in this study. Due
to numerous genetic lesions in BCG that have yet to be characterized, any number of varying
factors could have an effect on the biosynthesis of these lipids. Lipid profiles of DATs, PATs,
and SLs have never been performed in BCG strains and remain unknown. Since banding
patterns between BCG-Prague and BCG-Pasteur (a strain containing no known phoP-phoR
mutations) are similar, pre-existing aberrations in trehalose-containing lipids may be common
among all or at least multiple BCG sub-strains. Additionally, because the stimulus for the phoP-
phoR system is not known, it is possible that PhoP activation has not reached the threshold
needed to drive up lipid regulation.
59
Figure 10. Comparison of DATs, PATs, and SLs in BCG-Prague bacterial strains by thin layer chromatography.
Lipids from Pasteur pME, Prague, Prague pME, Prague pME-phoP, and Prague pME-phoP/R were extracted from
lyophilized cells using chloroform/methanol (2:1 then 1:2 v/v). Lipids were developed in
chloroform/methanol/water (60:16:2 v/v) (A), or petroleum ether/acetone (98:2 v/v) (B). Bands were visualized by
charring with 5% molydophosphoric acid. Specific lipids could not be identified at this time since banding patterns
were unique from previous lipid analyses done in M. tb and could not be directly compared.
60
3.8 phoP expression is upregulated in BCG strains containing
IS6110
PhoP has a role in virulence in M. tb (85, 100) and its upregulation is connected to a
hypervirulent strain of M. bovis (107, 120). The PhoP protein autoregulates its own transcription
by using recognition sites in the promoter of its gene. However it is currently debated whether
this is a mechanism for activation (64) or repression (72) of phoP expression. Comparative
sequencing of 13 BCG sub-strains using the NimbleGen technique revealed three BCG sub-
strains with IS6110 present in the promoter region upstream of phoP. These strains include
BCG-Japan, BCG-Russia, and BCG-Moreau. To determine the effect of IS6110 on phoP
expression and the possible correlation with variations in clinical virulence, I performed qRT-
PCR on the strains and compared them to BCG-Pasteur, which has no mutations in the phoP-
phoR locus (86). I predicted that differing levels of phoP expression may account for the
differences in virulence seen in these BCG sub-strains clinically. To do this, RNA from the
strains were extracted and reverse transcribed into cDNA as described in Materials and Methods
(Chapter 2) and quantified by real time PCR. Levels of phoP transcripts were normalized with
sigma factor A (sigA), a commonly used house-keeping gene so that the different strains could be
compared. Three biological samples were examined for each strain.
Results show that all three IS6110-containing strains have increased phoP expression when
compared to BCG-Pasteur (Figure 11). The differences were statistically significant in each case
when strains were compared using an unpaired, two-tailed T-test. The most pronounced increase
in phoP expression was in BCG-Japan with 1.039 ± 0.079 copies phoP/sigA in contrast to BCG-
Pasteur with 0.366 ± 0.045 copies phoP/sigA (almost 3-fold increase). BCG-Moreau showed a
smaller increase of 0.741 ± 0.062 (2-fold increase) while BCG-Russia displayed a much more
61
modest increase of 0.496 ± 0.046 copies phoP/sigA (1.4 times that found in BCG-Pasteur).
Consistent with my result, phoP expression in BCG-Japan was also higher than BCG-Pasteur in
a study by Brosch et al. (24).
62
Figure 11. Expression levels of phoP in BCG strains containing IS6110. Quantitive RT-PCR was used to determine
the relative expression levels of phoP among the IS6110 containing strains, BCG-Japan, -Russia, and -Moreau.
BCG-Pasteur was used as a comparison strain since no mutations were detected in the phoP-phoR locus. Copies of
phoP were normalized to copies of the sigma factor A gene (sigA) present in each tested sample. Results are
expressed as a relative ratio of phoP to sigA. All three BCG strains had increased phoP expression compared to
BCG-Pasteur as determined by a T-test, as indicated. BCG-Japan showed the highest upregulation of phoP
(p<0.001, n=3) (***); BCG-Russia had the smallest difference (p<0.05, n=3) (*); and BCG-Moreau had an
intermediate level of phoP upregulation among the strains (p<0.01, n=3) (**).
63
Discussion
Evidence from this chapter demonstrated the important role of PhoP in BCG immunogenicity.
Complementation of phoP in BCG-Prague and the over-expression of phoP in BCG-Japan
resulted in the upregulation of genes encoding T cell antigens and other potentially immunogenic
proteins. The restoration of these antigens by phoP complementation successfully increased the
immunogenicity of BCG-Prague. In addition, phoP over-expression in BCG-Japan achieved
higher levels of IFNγ induction to PPD, a mixture of M. tb secreted antigens that likely mimics a
natural infection, than any other single vaccine candidate to date. This feat was also
accomplished without a concomitant increase in virulence. Since both parental BCG strains
were relatively safe strains clinically, the new re-engineered strain will likely have low incidence
of adverse reactions as well.
Since the PhoPR system of M. tb is largely uncharacterized, it is not known whether phoR is
affected by the natural phoP mutation in BCG-Prague. Studies in DosRST, another
mycobacterial two-component system, showed that deletion of the response regulator (DosR) led
to abrogated expression of the sensor kinase (DosS), which was not repaired even with the
reintroduction of DosR (38). To address this concern I had included both phoP and phoP/R
constructs in my immunogenicity studies. If PhoR has no effect on PhoP expression or function,
then the two strains were expected to behave similarly in experiments.
Immune induction studies showed inconsistencies in IFNγ production between phoP and phoP/R
expressing strains. The most striking example was the large difference in IFNγ production
between Prague pME-phoP and Prague pME-phoP/R. However, the weak IFNγ induction by
Prague pME-phoP/R may be due to the loss of virulent PDIM/PGL lipids (Figure 9). In addition,
despite having similar overall IFNγ release (Figure 6), Japan pME-phoP and Japan pME-phoP/R
64
exhibited differential activation of IFNγ-producing CD4+ T cells (Figure 7). This unexplained
discrepancy suggests that the effects caused by the presence of the signal transducer, PhoR,
cannot be entirely discounted. Since the over-expression of PhoR is the only discernable
difference in these strains, the enhanced expression of the sensor kinase may alter the induction
of specific immune cells. This will likely be resolved with further study comparing the
behaviour of the two constructs in BCG-Pasteur, which is WT in the phoP-phoR locus, and also
by ensuring that PDIM/PGL production is maintained.
Since PhoP is associated with virulence and immunogenicity, I tried to establish a link between
the increased phoP expression seen in the three IS6110-containing BCG sub-strains (BCG-
Russia, -Japan, -Moreau) and their clinical behaviour. BCG-Russia is known for its high
virulence and adverse reactions as a vaccine (25, 26, 88) and the upregulated expression of phoP
may be partially responsible for this phenotype. Conversely, BCG-Japan and BCG-Moreau are
both consistently low in reactogenicity (88, 94) but showed the highest phoP expression among
the strains tested here (Figure 11). This discrepancy can be explained by the absence of the
virulent PDIM and PGL lipids (31), which no doubt also has an effect on their reactogenicity.
Due to the extensive role of these lipids in virulence, it would not be surprising if their loss
masked the increased effects brought on by phoP upregulation.
The upregulation of phoP in all three IS6110-containing strains support the autorepression model
of phoP regulation. The 1356 bp IS6110 fragment contains no identifiable transcriptional start
site and its insertion 18 bp from the phoP start site likely interferes with the three known PhoP
binding sites: DR1 (-61 to -69), DR2 (-47 to -55), and DR3 (-3 to -11) (72). In agreement with
the repression model, this presumably abrogates PhoP-dependent repression of the promoter and
65
drives up phoP expression as a consequence. Supporting this is the higher phoP expression in
M. tb H37Ra, a phoP mutant with abrogated DNA binding ability (59, 62).
66
Chapter 4
Impact of WhiB3 on BCG Metabolism and Residual
Virulence
Introduction
WhiB3 has been associated with virulence in mycobacteria. WhiB3 has a vital role in M. bovis
since a whiB3 mutant was deficient in growth by approximately five logs in mice compared to
WT M. bovis. This same mutant was even further attenuated when examined in a gerbil animal
model (124). Since gerbils develop necrotic lung granulomas that are rich in fatty acids but low
in other carbon sources, WhiB3 has been implicated in metabolic switchover because mutants
are unable to adapt (129). Further supporting its role in regulatory switchover is the maximal
induction of WhiB3 during the early phase of infection, coinciding with granuloma formation
(129).
Both BCG-Birkhaug and BCG-Sweden are natural whiB3 mutants due to a mutation disrupting
the promoter and start site of the gene (86). Although the role of WhiB3 in M. tb virulence is
still being uncovered, it has been shown to function as a transcriptional regulator responsible for
metabolic switchover in response to NO, O2, or carbon stress (113). Due to its similarity to the
B. subtilis whiB3 gene, it has been implicated in mycobacterial dormancy. WhiB3 may also have
a role in immunomodulation through its regulation of trehalose-containing lipids, which may
also serve a secondary role as a byproduct of redox regulation. I hypothesize that as seen in
other mycobacteria, the whiB3 mutation affects BCG metabolism and residual virulence and its
loss in BCG-Birkhaug and BCG-Sweden contributes to the attenuation of these strains. To test
67
this, I complemented each strain with a WT whiB3 gene on an external plasmid and then
compared the in vitro growth of each strain on plates supplemented with different carbon
sources. After observing a difference in growth, I tested whether WhiB3 also has an effect in
vivo in a mouse model of infection.
Results
4.1 Carbon metabolism is affected in BCG whiB3 mutants
Recent studies showed that in addition to NO and O2, nutrient depletion signals persistence in M.
tb and influences expression of respiratory and metabolic enzymes that modulate the intracellular
redox state (17). When compared to WT, an M. tb whiB3 mutant grew poorly on carbohydrate-
based carbon sources, but grew more effectively on acetate, a short chain fatty acid molecule
(113). This suggested that the whiB3 mutant had a diminished ability to sense and/or adapt to the
various carbohydrate sources and also reflected the bacteria‟s preference for fatty acids during
infection. Taken together, this implicated WhiB3 in transcriptionally regulating the switchover
to fatty acid metabolism, a vital adaptation in the host macrophage.
To test whether this was also the case in BCG, I examined BCG-Birkhaug and BCG-Sweden on
different carbon sources in the same manner as the study in M. tb (113). WT or whiB3-
complemented strains were compared for growth and colony morphology on various carbon
sources (glucose, succinate, fumarate, pyruvate, citrate and acetate). In each case, the whiB3-
complemented strain grew to an equal or higher density than the WT strain (Figure 12). Growth
differences were more pronounced when comparing Birkhaug pME and Birkhaug pME-whiB3,
especially on plates supplemented with glucose, acetate and fumerate. Differences between
68
Sweden pME and Sweden pME-whiB3 were minimal. Plate assays were repeated twice with
similar results.
In agreement with M. tb, the presence of whiB3 allowed the strains to grow better on all
carbohydrate-based carbon sources. However, the differences are not as pronounced as those
seen in the M. tb study and in some cases, are indiscernible (i.e. BCG-Sweden on citrate and
fumarate supplemented plates). This trend is also evident when strains were grown on acetate,
which opposed the result seen in M. tb. The variation from M. tb results cannot currently be
accounted for and is likely due to other accumulated mutations in the BCG strains.
69
Figure 12. The effect of whiB3 on carbon metabolism in BCG-Birkhaug and BCG-Sweden. The ability to utilize
different sources of carbon was compared between whiB3 mutants (Birkhaug pME and Sweden pME) and whiB3-
complemented equivalents (Birkhaug pME-whiB3 and Sweden pME-whiB3). Birkhaug pME-whiB3 colonies have
denser growth on all carbon sources compared to Birkhaug pME. The same is seen to a lesser degree in Sweden
pM-whiB3 verses Sweden pME. Plates were made of Dubos agar supplemented with the indicated carbon course.
Colonies shown are at 3 weeks growth.
70
4.2 Virulence is not affected in BCG whiB3 mutants
Both BCG-Birkhaug and BCG-Sweden metabolize various carbon sources more effectively
when complemented with a functional whiB3 gene. I wanted to next determine whether this
phenotype seen in vitro would affect their growth and virulence in vivo. To do this, I took the
same strains (Birkhaug-pME, Birkhaug pME-whiB3, Sweden pME, Sweden pME-whiB3) and
inoculated mice through i.v. injections and measured bacterial load in the lung, spleen and liver
at different time points as described in Materials and Methods (Chapter 2).
My results indicated that complementation with WhiB3 did not increase virulence of these BCG
strains (Figure 13). However, CFU counts in some organs reflect a marginal increase in
virulence in WhiB3-containing strains. For example, the livers of mice infected with BCG-
Birkhaug strains show that Birkhaug-whiB3 grew better than Birkhaug pME by Day 42 despite
having lower starting inoculant counts at Day 1. In addition, CFUs in BCG-Sweden infected
livers also show a WhiB3-associated increase in virulence. Although the CFUs at these
described time points are statistically significantly different (not shown), it is still unclear if the
changes are substantial enough for a clinical effect. Unfortunately, more accurate comparisons
of the strains are hampered by the unequal inoculations of the strains as indicated by the Day 1
time point.
71
Fig
ure
12
. E
ffec
t o
f w
hiB
3 o
n v
iru
len
ce i
n B
CG
-Bir
kh
aug
an
d B
CG
-Sw
eden
. T
o d
eter
min
e w
het
her
wh
iB3
has
an i
n v
ivo
eff
ect
on
BC
G v
iru
len
ce,
wh
iB3
mu
tant
stra
ins
(Bir
kh
aug
pM
E a
nd S
wed
en p
ME
) an
d t
hei
r co
mp
lem
ente
d c
ou
nte
rpar
ts (
Bir
kh
aug
pM
E-
wh
iB3
an
d S
wed
en p
ME
-wh
iB3
) w
ere
com
par
ed.
Fo
ur
mic
e p
er g
rou
p w
ere
ino
cu
late
d a
nd
sac
rifi
ced
on
day
s 1
, 1
4 a
nd
42
po
st
ino
cula
tio
n.
Lu
ng
s, s
ple
en,
and
liv
er w
ere
ho
mog
eniz
ed a
nd p
late
d.
CF
U c
ou
nts
wer
e en
um
erat
ed a
fter
3 w
eek
s in
cub
atio
n a
t 37
ºC.
72
Discussion
Results from this chapter showed that the impact of WhiB3 on BCG is minimal. Unlike in M. tb
and M. bovis, WhiB3 expression in BCG-Birkhaug and BCG-Sweden did not lead to a
substantial increase in virulence. This suggested that unlike ESAT-6 and PDIM/PGLs, WhiB3 is
not a major virulence factor. Since BCG is already deficient in ESAT-6 secretion and other
virulence mechanisms, the effects of the whiB3 deletion are over shadowed and do not result in a
significant change in virulence. However, since M. tb contains many virulence factors the
consequence of whiB3 loss was not masked by other attenuations. This result is consistent with
previous clinical findings. When comparing the virulence of 12 BCG sub-strains, BCG-Sweden
was identified as one of the more virulent strains (25, 26, 81). BCG-Sweden has also often been
associated with increased reports of adverse reactions compared to many other BCG sub-strains
(40, 88). While the risk of BCG-induced osteitis was 0.01 cases per million for BCG-Japan,
reported cases for BCG-Sweden were 32.5 and 43.4 cases per million in Sweden and Finland,
respectively (88). This association was further emphasized when national vaccination programs
were evaluated. As described earlier, the cases of osteitis reported in Finland dropped when
BCG-Sweden was replaced by BCG-Glaxo, a strain missing PDIM/PGLs (88). Although BCG-
Birkhaug has been less studied, the two strains are closely related and are expected to have
consistent levels of virulence (25, 26, 80, 81).
Another unexpected result was the altered ability for the whiB3 mutants to grow on acetate.
While the presence of whiB3 in M. tb led to decreased growth, BCG strains showed the opposite
effect of increased growth with whiB3 complementation. Since WhiB3 may be involved in the
sense and switchover from carbohydrates to fatty acid metabolism, this growth difference could
73
indicate that WhiB3 function in BCG is somehow dysregulated. This could also explain why the
addition of a functional WhiB3 had no significant effect on the virulence of the BCG strains.
74
Chapter 5
General Discussion and Future Directions
This work investigates the effect of two virulence factors, PhoP and WhiB3 on the attenuation
and immunogenicity of BCG. The dramatic effect of PhoP on immunogenicity has been
established several times in this study. Microarray expression analysis demonstrates that PhoP
positively regulates genes encoding proteins or protein family members associated with
mycobacterial virulence and immunogenicity. These include the upregulation of Antigen 85A, a
dominant T cell antigen that is exploited in several subunit vaccines (89, 132); and members of
the ESAT-6-like and PE/PPE family of proteins, which have roles in virulence and possibly
immune recognition (23, 44, 87, 121). Interestingly, all nine upregulated esx genes as well as
PE41 are secreted by the ESX-5 secretion system (2, 4). Although the role of ESX-5 is unclear
in BCG, preliminary studies done in M. marinum and its similarity to ESX-1 of M. tb suggests it
is an important contributor to virulence and immunogenicity.
The crucial role of PhoP in BCG immunogenicity is further validated by my in vivo mouse work.
The re-introduction of phoP in the natural phoP mutant, BCG-Prague, greatly improved the
immunogenicity of the strain as measured by IFNγ production (Figure 5), showing that the loss
of phoP is at least partially responsible for its reduced vaccine potency. The immunogenicity of
BCG-Japan, a strain with naturally high levels of PhoP expression due to the presence of IS6110
(Figure 11), was further enhanced with the over-expression of PhoP (Figure 6). In fact, the level
of IFNγ induction surpassed vaccine candidates that are currently in pre-clinical and clinical
trials. More importantly, the over-expression of PhoP in both strains did not result in a
concomitant increase in virulence compared to the parental BCG.
75
Although the vaccine candidates currently in development have shown promising results, they
have major limitations. DNA and protein subunit vaccines have shown potential as boosters in
conjunction with BCG but have shown limited success as standalone vaccines (53, 89, 97, 106,
132). The success of this strategy is debatable considering the poor efficacy of BCG. Attempts
at using other avirulent or attenuated strains of mycobacteria have also been unsuccessful,
including M. vaccae (43), recombinant M. vaccae expressing M. tb antigens (6), and the M. tb
phoP mutant (7, 28). In addition, the safety of these live vaccines is a primary concern.
Although some strains of BCG can cause adverse reactions, the general safety of BCG has been
proven in humans over decades of vaccination. Thus, it is favourable to build upon existing
strains of BCG with proven safety records rather than engineering a completely new strain.
However, the unique characteristics of each BCG sub-strain should be taken into consideration
when choosing a parental strain, which was not done for the current BCG vaccine candidates.
Gene expression profiling of immune responses after BCG vaccination show that BCG strains
activate distinct immune pathways (140). This is supported by their unique behaviour clinically,
especially in terms of residual virulence and adverse reactions (51, 52, 81, 88). It is evident that
BCG sub-strains have unique vaccine properties. Identifying and understanding these
differences is crucial for vaccine development and evaluation since the benefits and drawbacks
of each strain will be known.
BCG will undoubtedly remain an important component of TB vaccine development, whether as
recombinant vaccine or the „prime‟ in a prime-boost regiment. However, the development of a
new vaccine against TB has many obstacles. Not only must it be more effective than the existent
BCG, it should also be safe enough to use in both the general population and in
immunocompromised individuals, such as those affected by HIV. Attempts at creating a new
76
vaccine, whether a recombinant BCG or a subunit vaccine, have so far fallen short. While they
are promising, none has considerably surpassed the performance of the current BCG and have
not properly addressed the need for increased safety in immunocompromised individuals who are
at the most risk of TB infection. My work proposes a novel vaccine strategy that exploits the
natural properties of BCG. Most importantly, safety was a primary factor in choosing both
BCG-Prague and BCG-Japan as parental strains. Although preliminary, the over-expression of
PhoP in these strains increased the immunogenicity to very promising levels that surpassed
current vaccine strategies. As such, these are excellent candidates for future TB vaccine
development. Future work will need to be done to completely characterize these strains and
assess their protection efficacy.
Evaluate the protection efficacy of the vaccine strains
In order to determine the vaccine potential of these strains, the protection efficacy will be
examined in a mouse model of infection. To do this, C57BL/6 mice will be vaccinated with
BCG-Prague and BCG-Japan over-expressing PhoP and then challenged with aerosolized M. tb,
mimicking the natural infection route of TB. The ability of these strains to protect mice from M.
tb infection will be determined by M. tb burden in target organs and compared to parental BCG
as well as other sub-strains commonly considered potent vaccines such as BCG-Pasteur or BCG-
Russia. This will help determine whether the increased immune response is significant enough
to enhance protection. The safety of these recombinant BCG strains will be assessed in an
immunocompromised SCID mouse model of infection. This will ensure the safety of these
strains for use in HIV-positive individuals, who are at high risk. More in depth investigation into
the effects of increased PhoP expression, protective efficacy, and safety will demonstrate that
these strains are superior candidate TB vaccines.
77
Investigate the PhoP-PhoR System
The PhoPR two-component system of M. tb is largely uncharacterized. It belongs to the diverse
OmpR/PhoB subfamily of response regulators, which have important roles in stress adaptation
and virulence (125). PhoP of Salmonella enterica serovar Typhimurium is positively
autoregulated and responds to Mg2+
starvation, resulting in the regulation of over 40 genes, some
of which are virulence factors (69). PhoB in Bacillus subtilis however regulates itself through
repression mechanisms and senses phosphate starvation (83). Currently, the activating signal for
the M. tb PhoPR system remains unknown and its method of regulation is also debated. Both the
association of two-component systems with virulence and adaptation mechanisms and the PhoP-
dependent regulation of secreted antigenic genes found in this work suggest that PhoPR is
activated by an environmental cue during host infection. My work also shows that PhoP likely
represses its own transcription since disruption of the promoter with IS6110 leads to upregulated
expression (Figure 11) in various BCG strains. To confirm phoP autorepression, the three DR
sites used for PhoP recognition will be re-introduced into the IS6110-containing strains, BCG-
Japan, BCG-Russia, and BCG-Moreau in the proper location and phoP expression will be
examined. Lowered phoP expression in these „repaired‟ strains will support the autorepression
model. Alternatively, IS6110 will be inserted into BCG-Pasteur in an attempt to increase phoP
expression. Once characterized, these sites can be exploited to control phoP expression levels in
future recombinant vaccine strains.
Another necessary experiment would be to repeat the microarray expression analysis with a
Prague pME-phoP strain positive for PDIM and PGLs. While unlikely, PDIM/PGLs may have
unexpected secondary effects on the microarray results due to their role in virulence. However,
the increased IFNγ production also seen in Prague pME-phoP/R, which produce PDIM/PGLs
78
indicate the loss of these lipids may have no significant effect. Additional expression analyses
should also be done to determine whether the PhoP regulon is similar in other BCG sub-strains.
Due to the many other uncharacterized mutations in BCG sub-strains, PhoP may not be the only
mutation responsible for regulation of ESX-5 genes in BCG-Prague.
Investigate the role of ESX-5 in immunogenicity
The ESX-5 secretion system likely plays an important role in BCG virulence due to its similarity
to ESX-1 and its connection to virulence in M. marinum. The microarray results reveal that nine
out of ten ESAT-6-like proteins as well as PE41, known to be secreted by ESX-5, were
upregulated with PhoP function. To specifically examine the role of ESX-5 on BCG virulence
and immunogenicity, isogenic ESX-5 BCG mutants will be constructed and immunological
studies in mice will be performed as described in this work. To avoid any effects that irregular
PhoP expression may have on the system, BCG-Pasteur will be used to generate the mutants
since it has normal phoP expression. This allows more direct examination of ESX-5 secretion
and ascertains any differences in the ESX-5-specific immune response induced by these strains.
According to the M. marinum model, ESX-5 secretion actively decreases pro-inflammatory host
cytokines, alters macrophage expressed surface antigens, and is involved in phagosome escape
and spread (3, 4). This is predicted to hinder bacterial recognition and killing by the host to
increase bacterial load. If this is true, the loss of ESX-5 proteins in BCG-Prague could
contribute to early clearance of the strain and thus not allowing adequate time for the host to
develop an immunological response. To investigate this proposed mechanism, the ESX-5 mutant
and WT BCG strains will be used to infect mice and the levels of pro-inflammatory cytokines,
such as TNF, will be determined and compared.
79
My work has established molecular factors that partially account for the differences seen in BCG
virulence and immunogenicity. Using this knowledge, I have developed two promising vaccine
candidates, BCG-Prague expressing PhoP and BCG-Japan over-expressing PhoP, which will
contribute to the development of new TB vaccines that are more safe and effective. This also
validates the novel approach to vaccine development taken by our laboratory, in which BCG
strain selection based on unique vaccine properties is a key step in rational vaccine design.
80
References
1. Aagaard, C., J. Dietrich, M. Doherty, and P. Andersen. 2009. TB vaccines: current
status and future perspectives. Immunol Cell Biol 87:279-86.
2. Abdallah, A. M., N. C. Gey van Pittius, P. A. Champion, J. Cox, J. Luirink, C. M.
Vandenbroucke-Grauls, B. J. Appelmelk, and W. Bitter. 2007. Type VII secretion--
mycobacteria show the way. Nat Rev Microbiol 5:883-91.
3. Abdallah, A. M., N. D. Savage, M. van Zon, L. Wilson, C. M. Vandenbroucke-
Grauls, N. N. van der Wel, T. H. Ottenhoff, and W. Bitter. 2008. The ESX-5 secretion
system of Mycobacterium marinum modulates the macrophage response. J Immunol
181:7166-75.
4. Abdallah, A. M., T. Verboom, F. Hannes, M. Safi, M. Strong, D. Eisenberg, R. J.
Musters, C. M. Vandenbroucke-Grauls, B. J. Appelmelk, J. Luirink, and W. Bitter. 2006. A specific secretion system mediates PPE41 transport in pathogenic mycobacteria.
Mol Microbiol 62:667-79.
5. Abdallah, A. M., T. Verboom, E. M. Weerdenburg, N. C. Gey van Pittius, P. W.
Mahasha, C. Jimenez, M. Parra, N. Cadieux, M. J. Brennan, B. J. Appelmelk, and
W. Bitter. 2009. PPE and PE_PGRS proteins of Mycobacterium marinum are
transported via the type VII secretion system ESX-5. Mol Microbiol 73:329-40.
6. Abou-Zeid, C., M. P. Gares, J. Inwald, R. Janssen, Y. Zhang, D. B. Young, C.
Hetzel, J. R. Lamb, S. L. Baldwin, I. M. Orme, V. Yeremeev, B. V. Nikonenko, and
A. S. Apt. 1997. Induction of a type 1 immune response to a recombinant antigen from
Mycobacterium tuberculosis expressed in Mycobacterium vaccae. Infect Immun
65:1856-62.
7. Aguilar, D., E. Infante, C. Martin, E. Gormley, B. Gicquel, and R. Hernandez
Pando. 2007. Immunological responses and protective immunity against tuberculosis
conferred by vaccination of Balb/C mice with the attenuated Mycobacterium tuberculosis
(phoP) SO2 strain. Clin Exp Immunol 147:330-8.
8. Anonymous. 2004. BCG Vaccine. W.H.O. position paper, p. 27-38, The Weekly
Epidemiological Record, vol. 79. World Health Organization.
9. Anonymous. 2006. Global tuberculosis control- surveillance, planning, financing. In W.
H. Organization (ed.). World Health Organization, Geneva, Switzerland.
10. Anonymous. 2008. Global Tuberculosis control 2008: surveillance, planning, financing,
WHO Report 2008. The World Health Organization.
11. Anonymous. 2007. Revised BCG vaccination guidelines for infants at risk for HIV
infection, p. 193-196, The Weekly Epidemiological Record. World Health Organization.
81
12. Banu, S., N. Honore, B. Saint-Joanis, D. Philpott, M. C. Prevost, and S. T. Cole.
2002. Are the PE-PGRS proteins of Mycobacterium tuberculosis variable surface
antigens? Mol Microbiol 44:9-19.
13. Behr, M. A. 2002. BCG--different strains, different vaccines? Lancet Infect Dis 2:86-92.
14. Behr, M. A., and P. M. Small. 1999. A historical and molecular phylogeny of BCG
strains. Vaccine 17:915-22.
15. Behr, M. A., M. A. Wilson, W. P. Gill, H. Salamon, G. K. Schoolnik, S. Rane, and P.
M. Small. 1999. Comparative genomics of BCG vaccines by whole-genome DNA
microarray. Science 284:1520-3.
16. Belisle, J. T., V. D. Vissa, T. Sievert, K. Takayama, P. J. Brennan, and G. S. Besra.
1997. Role of the major antigen of Mycobacterium tuberculosis in cell wall biogenesis.
Science 276:1420-2.
17. Betts, J. C., P. T. Lukey, L. C. Robb, R. A. McAdam, and K. Duncan. 2002.
Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by
gene and protein expression profiling. Mol Microbiol 43:717-31.
18. Black, G. F., R. E. Weir, S. Floyd, L. Bliss, D. K. Warndorff, A. C. Crampin, B.
Ngwira, L. Sichali, B. Nazareth, J. M. Blackwell, K. Branson, S. D. Chaguluka, L.
Donovan, E. Jarman, E. King, P. E. Fine, and H. M. Dockrell. 2002. BCG-induced
increase in interferon-gamma response to mycobacterial antigens and efficacy of BCG
vaccination in Malawi and the UK: two randomised controlled studies. Lancet 359:1393-
401.
19. Brandt, L., J. Feino Cunha, A. Weinreich Olsen, B. Chilima, P. Hirsch, R.
Appelberg, and P. Andersen. 2002. Failure of the Mycobacterium bovis BCG vaccine:
some species of environmental mycobacteria block multiplication of BCG and induction
of protective immunity to tuberculosis. Infect Immun 70:672-8.
20. Brandt, L., Y. A. Skeiky, M. R. Alderson, Y. Lobet, W. Dalemans, O. C. Turner, R.
J. Basaraba, A. A. Izzo, T. M. Lasco, P. L. Chapman, S. G. Reed, and I. M. Orme. 2004. The protective effect of the Mycobacterium bovis BCG vaccine is increased by
coadministration with the Mycobacterium tuberculosis 72-kilodalton fusion polyprotein
Mtb72F in M. tuberculosis-infected guinea pigs. Infect Immun 72:6622-32.
21. Brennan, M. J., and G. Delogu. 2002. The PE multigene family: a 'molecular mantra'
for mycobacteria. Trends Microbiol 10:246-9.
22. Brewer, T. F. 2000. Preventing tuberculosis with bacillus Calmette-Guerin vaccine: a
meta-analysis of the literature. Clin Infect Dis 31 Suppl 3:S64-7.
23. Brodin, P., I. Rosenkrands, P. Andersen, S. T. Cole, and R. Brosch. 2004. ESAT-6
proteins: protective antigens and virulence factors? Trends Microbiol 12:500-8.
82
24. Brosch, R., S. V. Gordon, T. Garnier, K. Eiglmeier, W. Frigui, P. Valenti, S. Dos
Santos, S. Duthoy, C. Lacroix, C. Garcia-Pelayo, J. K. Inwald, P. Golby, J. N.
Garcia, R. G. Hewinson, M. A. Behr, M. A. Quail, C. Churcher, B. G. Barrell, J.
Parkhill, and S. T. Cole. 2007. Genome plasticity of BCG and impact on vaccine
efficacy. Proc Natl Acad Sci U S A 104:5596-601.
25. Bunch-Christensen, K., A. Ladefoged, and J. Guld. 1968. The virulence of some
strains of BCG for golden hamsters. Bull World Health Organ 39:821-8.
26. Bunch-Christensen, K., A. Ladefoged, and J. Guld. 1970. The virulence of some
strains of BCG for golden hamsters. Further studies. Bull World Health Organ 43:65-70.
27. Camacho, L. R., D. Ensergueix, E. Perez, B. Gicquel, and C. Guilhot. 1999.
Identification of a virulence gene cluster of Mycobacterium tuberculosis by signature-
tagged transposon mutagenesis. Mol Microbiol 34:257-67.
28. Cardona, P. J., J. G. Asensio, A. Arbues, I. Otal, C. Lafoz, O. Gil, N. Caceres, V.
Ausina, B. Gicquel, and C. Martin. 2009. Extended safety studies of the attenuated live
tuberculosis vaccine SO2 based on phoP mutant. Vaccine 27:2499-505.
29. Caruso, A. M., N. Serbina, E. Klein, K. Triebold, B. R. Bloom, and J. L. Flynn.
1999. Mice deficient in CD4 T cells have only transiently diminished levels of IFN-
gamma, yet succumb to tuberculosis. J Immunol 162:5407-16.
30. Chen, J. M., D. C. Alexander, M. A. Behr, and J. Liu. 2003. Mycobacterium bovis
BCG vaccines exhibit defects in alanine and serine catabolism. Infect Immun 71:708-16.
31. Chen, J. M., S. T. Islam, H. Ren, and J. Liu. 2007. Differential productions of lipid
virulence factors among BCG vaccine strains and implications on BCG safety. Vaccine
25:8114-22.
32. Chesne-Seck, M. L., N. Barilone, F. Boudou, J. Gonzalo Asensio, P. E. Kolattukudy,
C. Martin, S. T. Cole, B. Gicquel, D. N. Gopaul, and M. Jackson. 2008. A point
mutation in the two-component regulator PhoP-PhoR accounts for the absence of
polyketide-derived acyltrehaloses but not that of phthiocerol dimycocerosates in
Mycobacterium tuberculosis H37Ra. J Bacteriol 190:1329-34.
33. Colditz, G. A., C. S. Berkey, F. Mosteller, T. F. Brewer, M. E. Wilson, E. Burdick,
and H. V. Fineberg. 1995. The efficacy of bacillus Calmette-Guerin vaccination of
newborns and infants in the prevention of tuberculosis: meta-analyses of the published
literature. Pediatrics 96:29-35.
34. Colditz, G. A., T. F. Brewer, C. S. Berkey, M. E. Wilson, E. Burdick, H. V. Fineberg,
and F. Mosteller. 1994. Efficacy of BCG vaccine in the prevention of tuberculosis.
Meta-analysis of the published literature. JAMA 271:698-702.
35. Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V.
Gordon, K. Eiglmeier, S. Gas, C. E. Barry, 3rd, F. Tekaia, K. Badcock, D. Basham,
D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles,
83
N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, A. Krogh, J. McLean, S. Moule, L.
Murphy, K. Oliver, J. Osborne, M. A. Quail, M. A. Rajandream, J. Rogers, S.
Rutter, K. Seeger, J. Skelton, R. Squares, S. Squares, J. E. Sulston, K. Taylor, S.
Whitehead, and B. G. Barrell. 1998. Deciphering the biology of Mycobacterium
tuberculosis from the complete genome sequence. Nature 393:537-44.
36. Comstock, G. W. 1994. Field trials of tuberculosis vaccines: how could we have done
them better? Control Clin Trials 15:247-76.
37. Comstock, G. W., S. F. Woolpert, and V. T. Livesay. 1976. Tuberculosis studies in
Muscogee County, Georgia. Twenty-year evaluation of a community trial of BCG
vaccination. Public Health Rep 91:276-80.
38. Converse, P. J., P. C. Karakousis, L. G. Klinkenberg, A. K. Kesavan, L. H. Ly, S. S.
Allen, J. H. Grosset, S. K. Jain, G. Lamichhane, Y. C. Manabe, D. N. McMurray, E.
L. Nuermberger, and W. R. Bishai. 2009. Role of the dosR-dosS two-component
regulatory system in Mycobacterium tuberculosis virulence in three animal models.
Infect Immun 77:1230-7.
39. Cooper, A. M., D. K. Dalton, T. A. Stewart, J. P. Griffin, D. G. Russell, and I. M.
Orme. 1993. Disseminated tuberculosis in interferon gamma gene-disrupted mice. J Exp
Med 178:2243-7.
40. Corbel, M. J., U. Fruth, E. Griffiths, and I. Knezevic. 2004. Report on a WHO
consultation on the characterisation of BCG strains, Imperial College, London 15-16
December 2003. Vaccine 22:2675-80.
41. Cox, J. S., B. Chen, M. McNeil, and W. R. Jacobs, Jr. 1999. Complex lipid determines
tissue-specific replication of Mycobacterium tuberculosis in mice. Nature 402:79-83.
42. Daffe, M., and P. Draper. 1998. The envelope layers of mycobacteria with reference to
their pathogenicity. Adv Microb Physiol 39:131-203.
43. de Bruyn, G., and P. Garner. 2003. Mycobacterium vaccae immunotherapy for treating
tuberculosis. Cochrane Database Syst Rev:CD001166.
44. Delogu, G., and M. J. Brennan. 2001. Comparative immune response to PE and
PE_PGRS antigens of Mycobacterium tuberculosis. Infect Immun 69:5606-11.
45. Demangel, C., T. Garnier, I. Rosenkrands, and S. T. Cole. 2005. Differential effects
of prior exposure to environmental mycobacteria on vaccination with Mycobacterium
bovis BCG or a recombinant BCG strain expressing RD1 antigens. Infect Immun
73:2190-6.
46. DiRita, V. J., and J. J. Mekalanos. 1989. Genetic regulation of bacterial virulence.
Annu Rev Genet 23:455-82.
84
47. Domenech, P., and M. B. Reed. 2009. Rapid and spontaneous loss of phthiocerol
dimycocerosate (PDIM) from Mycobacterium tuberculosis grown in vitro: implications
for virulence studies. Microbiology 155:3532-43.
48. Dubey, V. S., T. D. Sirakova, and P. E. Kolattukudy. 2002. Disruption of msl3
abolishes the synthesis of mycolipanoic and mycolipenic acids required for
polyacyltrehalose synthesis in Mycobacterium tuberculosis H37Rv and causes cell
aggregation. Mol Microbiol 45:1451-9.
49. Dubos, R. J., and C. H. Pierce. 1956. Differential characteristics in vitro and in vivo of
several substrains of BCG. I. Multiplication and survival in vitro. Am Rev Tuberc
74:655-66.
50. Dubos, R. J., and C. H. Pierce. 1956. Differential characteristics in vitro and in vivo of
several substrains of BCG. II. Morphologic characteristics in vitro and in vivo. Am Rev
Tuberc 74:667-82.
51. Dubos, R. J., and C. H. Pierce. 1956. Differential characteristics in vitro and in vivo of
several substrains of BCG. IV. Immunizing effectiveness. Am Rev Tuberc 74:699-717.
52. Dubos, R. J., C. H. Pierce, and W. B. Schaefer. 1956. Differential characteristics in
vitro and in vivo of several substrains of BCG. III. Multiplication and survival in vivo.
Am Rev Tuberc 74:683-98.
53. Fan, X., Q. Gao, and R. Fu. 2007. DNA vaccine encoding ESAT-6 enhances the
protective efficacy of BCG against Mycobacterium tuberculosis infection in mice. Scand
J Immunol 66:523-8.
54. Fine, P. E. 1995. Variation in protection by BCG: implications of and for heterologous
immunity. Lancet 346:1339-45.
55. Flory, C. M., R. D. Hubbard, and F. M. Collins. 1992. Effects of in vivo T lymphocyte
subset depletion on mycobacterial infections in mice. J Leukoc Biol 51:225-9.
56. Flynn, J. L., J. Chan, K. J. Triebold, D. K. Dalton, T. A. Stewart, and B. R. Bloom.
1993. An essential role for interferon gamma in resistance to Mycobacterium tuberculosis
infection. J Exp Med 178:2249-54.
57. Flynn, J. L., M. M. Goldstein, K. J. Triebold, B. Koller, and B. R. Bloom. 1992.
Major histocompatibility complex class I-restricted T cells are required for resistance to
Mycobacterium tuberculosis infection. Proc Natl Acad Sci U S A 89:12013-7.
58. Fomukong, N. G., J. W. Dale, T. W. Osborn, and J. M. Grange. 1992. Use of gene
probes based on the insertion sequence IS986 to differentiate between BCG vaccine
strains. J Appl Bacteriol 72:126-33.
59. Frigui, W., D. Bottai, L. Majlessi, M. Monot, E. Josselin, P. Brodin, T. Garnier, B.
Gicquel, C. Martin, C. Leclerc, S. T. Cole, and R. Brosch. 2008. Control of M.
85
tuberculosis ESAT-6 secretion and specific T cell recognition by PhoP. PLoS Pathog
4:e33.
60. Fukui, Y., T. Hirai, T. Uchida, and M. Yoneda. 1965. Extracellular proteins of tubercle
bacilli. IV. Alpha and beta antigens as major extracellular protein products and as cellular
components of a strain (H37Rv) of Mycobacterium tuberculosis. Biken J 8:189-99.
61. Gandhi, N. R., A. Moll, A. W. Sturm, R. Pawinski, T. Govender, U. Lalloo, K.
Zeller, J. Andrews, and G. Friedland. 2006. Extensively drug-resistant tuberculosis as
a cause of death in patients co-infected with tuberculosis and HIV in a rural area of South
Africa. Lancet 368:1575-80.
62. Gao, Q., K. Kripke, Z. Arinc, M. Voskuil, and P. Small. 2004. Comparative
expression studies of a complex phenotype: cord formation in Mycobacterium
tuberculosis. Tuberculosis (Edinb) 84:188-96.
63. Gomez, J. E., and W. R. Bishai. 2000. whmD is an essential mycobacterial gene
required for proper septation and cell division. Proc Natl Acad Sci U S A 97:8554-9.
64. Gonzalo-Asensio, J., C. Y. Soto, A. Arbues, J. Sancho, M. del Carmen Menendez, M.
J. Garcia, B. Gicquel, and C. Martin. 2008. The Mycobacterium tuberculosis phoPR
operon is positively autoregulated in the virulent strain H37Rv. J Bacteriol 190:7068-78.
65. Gonzalo Asensio, J., C. Maia, N. L. Ferrer, N. Barilone, F. Laval, C. Y. Soto, N.
Winter, M. Daffe, B. Gicquel, C. Martin, and M. Jackson. 2006. The virulence-
associated two-component PhoP-PhoR system controls the biosynthesis of polyketide-
derived lipids in Mycobacterium tuberculosis. J Biol Chem 281:1313-6.
66. Goren, M. B., O. Brokl, and W. B. Schaefer. 1974. Lipids of putative relevance to
virulence in Mycobacterium tuberculosis: phthiocerol dimycocerosate and the attenuation
indicator lipid. Infect Immun 9:150-8.
67. Green, J., and M. S. Paget. 2004. Bacterial redox sensors. Nat Rev Microbiol 2:954-66.
68. Grode, L., P. Seiler, S. Baumann, J. Hess, V. Brinkmann, A. Nasser Eddine, P.
Mann, C. Goosmann, S. Bandermann, D. Smith, G. J. Bancroft, J. M. Reyrat, D.
van Soolingen, B. Raupach, and S. H. Kaufmann. 2005. Increased vaccine efficacy
against tuberculosis of recombinant Mycobacterium bovis bacille Calmette-Guerin
mutants that secrete listeriolysin. J Clin Invest 115:2472-9.
69. Groisman, E. A. 2001. The pleiotropic two-component regulatory system PhoP-PhoQ. J
Bacteriol 183:1835-42.
70. Guinn, K. M., M. J. Hickey, S. K. Mathur, K. L. Zakel, J. E. Grotzke, D. M.
Lewinsohn, S. Smith, and D. R. Sherman. 2004. Individual RD1-region genes are
required for export of ESAT-6/CFP-10 and for virulence of Mycobacterium tuberculosis.
Mol Microbiol 51:359-70.
86
71. Gupta, S., A. Pathak, A. Sinha, and D. Sarkar. 2009. Mycobacterium tuberculosis
PhoP recognizes two adjacent direct-repeat sequences to form head-to-head dimers. J
Bacteriol 191:7466-76.
72. Gupta, S., A. Sinha, and D. Sarkar. 2006. Transcriptional autoregulation by
Mycobacterium tuberculosis PhoP involves recognition of novel direct repeat sequences
in the regulatory region of the promoter. FEBS Lett 580:5328-38.
73. Hart, P. D., and I. Sutherland. 1977. BCG and vole bacillus vaccines in the prevention
of tuberculosis in adolescence and early adult life. Br Med J 2:293-5.
74. Hesseling, A. C., B. J. Marais, R. P. Gie, H. S. Schaaf, P. E. Fine, P. Godfrey-
Faussett, and N. Beyers. 2007. The risk of disseminated Bacille Calmette-Guerin (BCG)
disease in HIV-infected children. Vaccine 25:14-8.
75. Hoft, D. F., A. Blazevic, G. Abate, W. A. Hanekom, G. Kaplan, J. H. Soler, F.
Weichold, L. Geiter, J. C. Sadoff, and M. A. Horwitz. 2008. A new recombinant
bacille Calmette-Guerin vaccine safely induces significantly enhanced tuberculosis-
specific immunity in human volunteers. J Infect Dis 198:1491-501.
76. Horwitz, M. A., and G. Harth. 2003. A new vaccine against tuberculosis affords greater
survival after challenge than the current vaccine in the guinea pig model of pulmonary
tuberculosis. Infect Immun 71:1672-9.
77. Horwitz, M. A., G. Harth, B. J. Dillon, and S. Maslesa-Galic. 2000. Recombinant
bacillus calmette-guerin (BCG) vaccines expressing the Mycobacterium tuberculosis 30-
kDa major secretory protein induce greater protective immunity against tuberculosis than
conventional BCG vaccines in a highly susceptible animal model. Proc Natl Acad Sci U
S A 97:13853-8.
78. Jackson, M., G. Stadthagen, and B. Gicquel. 2007. Long-chain multiple methyl-
branched fatty acid-containing lipids of Mycobacterium tuberculosis: biosynthesis,
transport, regulation and biological activities. Tuberculosis (Edinb) 87:78-86.
79. Kaufmann, S. H. 2001. How can immunology contribute to the control of tuberculosis?
Nat Rev Immunol 1:20-30.
80. Ladefoged, A., K. Bunch-Christensen, and J. Guld. 1970. The protective effect in
bank voles of some strains of BCG. Bull World Health Organ 43:71-90.
81. Ladefoged, A., K. Bunch-Christensen, and J. Guld. 1976. Tuberculin sensitivity in
guinea-pigs after vaccination with varying doses of BCG of 12 different strains. Bull
World Health Organ 53:435-43.
82. Lagranderie, M. R., A. M. Balazuc, E. Deriaud, C. D. Leclerc, and M. Gheorghiu.
1996. Comparison of immune responses of mice immunized with five different
Mycobacterium bovis BCG vaccine strains. Infect Immun 64:1-9.
87
83. Lamarche, M. G., B. L. Wanner, S. Crepin, and J. Harel. 2008. The phosphate
regulon and bacterial virulence: a regulatory network connecting phosphate homeostasis
and pathogenesis. FEMS Microbiol Rev 32:461-73.
84. Langermans, J. A., T. M. Doherty, R. A. Vervenne, T. van der Laan, K.
Lyashchenko, R. Greenwald, E. M. Agger, C. Aagaard, H. Weiler, D. van Soolingen,
W. Dalemans, A. W. Thomas, and P. Andersen. 2005. Protection of macaques against
Mycobacterium tuberculosis infection by a subunit vaccine based on a fusion protein of
antigen 85B and ESAT-6. Vaccine 23:2740-50.
85. Lee, J. S., R. Krause, J. Schreiber, H. J. Mollenkopf, J. Kowall, R. Stein, B. Y. Jeon,
J. Y. Kwak, M. K. Song, J. P. Patron, S. Jorg, K. Roh, S. N. Cho, and S. H.
Kaufmann. 2008. Mutation in the transcriptional regulator PhoP contributes to
avirulence of Mycobacterium tuberculosis H37Ra strain. Cell Host Microbe 3:97-103.
86. Leung, A. S., V. Tran, Z. Wu, X. Yu, D. C. Alexander, G. F. Gao, B. Zhu, and J. Liu.
2008. Novel genome polymorphisms in BCG vaccine strains and impact on efficacy.
BMC Genomics 9:413.
87. Li, Y., E. Miltner, M. Wu, M. Petrofsky, and L. E. Bermudez. 2005. A
Mycobacterium avium PPE gene is associated with the ability of the bacterium to grow in
macrophages and virulence in mice. Cell Microbiol 7:539-48.
88. Lotte, A., O. Wasz-Hockert, N. Poisson, N. Dumitrescu, M. Verron, and E. Couvet.
1984. BCG complications. Estimates of the risks among vaccinated subjects and
statistical analysis of their main characteristics. Adv Tuberc Res 21:107-93.
89. Magalhaes, I., D. R. Sizemore, R. K. Ahmed, S. Mueller, L. Wehlin, C. Scanga, F.
Weichold, G. Schirru, M. G. Pau, J. Goudsmit, S. Kuhlmann-Berenzon, M.
Spangberg, J. Andersson, H. Gaines, R. Thorstensson, Y. A. Skeiky, J. Sadoff, and
M. Maeurer. 2008. rBCG induces strong antigen-specific T cell responses in rhesus
macaques in a prime-boost setting with an adenovirus 35 tuberculosis vaccine vector.
PLoS One 3:e3790.
90. Martin, C., A. Williams, R. Hernandez-Pando, P. J. Cardona, E. Gormley, Y.
Bordat, C. Y. Soto, S. O. Clark, G. J. Hatch, D. Aguilar, V. Ausina, and B. Gicquel. 2006. The live Mycobacterium tuberculosis phoP mutant strain is more attenuated than
BCG and confers protective immunity against tuberculosis in mice and guinea pigs.
Vaccine 24:3408-19.
91. McShane, H., A. A. Pathan, C. R. Sander, N. P. Goonetilleke, H. A. Fletcher, and A.
V. Hill. 2005. Boosting BCG with MVA85A: the first candidate subunit vaccine for
tuberculosis in clinical trials. Tuberculosis (Edinb) 85:47-52.
92. Mekalanos, J. J. 1992. Environmental signals controlling expression of virulence
determinants in bacteria. J Bacteriol 174:1-7.
93. Middlebrook, G., R. J. Dubos, and C. Pierce. 1947. Virulence and Morphological
Characteristics of Mammalian Tubercle Bacilli. J Exp Med 86:175-84.
88
94. Milstien, J. B., and J. J. Gibson. 1990. Quality control of BCG vaccine by WHO: a
review of factors that may influence vaccine effectiveness and safety. Bull World Health
Organ 68:93-108.
95. Morris, R. P., L. Nguyen, J. Gatfield, K. Visconti, K. Nguyen, D. Schnappinger, S.
Ehrt, Y. Liu, L. Heifets, J. Pieters, G. Schoolnik, and C. J. Thompson. 2005.
Ancestral antibiotic resistance in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A
102:12200-5.
96. Mulder, N. J., H. Zappe, and L. M. Steyn. 1999. Characterization of a Mycobacterium
tuberculosis homologue of the Streptomyces coelicolor whiB gene. Tuber Lung Dis
79:299-308.
97. Olsen, A. W., A. Williams, L. M. Okkels, G. Hatch, and P. Andersen. 2004.
Protective effect of a tuberculosis subunit vaccine based on a fusion of antigen 85B and
ESAT-6 in the aerosol guinea pig model. Infect Immun 72:6148-50.
98. Onwueme, K. C., C. J. Vos, J. Zurita, J. A. Ferreras, and L. E. Quadri. 2005. The
dimycocerosate ester polyketide virulence factors of mycobacteria. Prog Lipid Res
44:259-302.
99. Orme, I. M., and F. M. Collins. 1984. Adoptive protection of the Mycobacterium
tuberculosis-infected lung. Dissociation between cells that passively transfer protective
immunity and those that transfer delayed-type hypersensitivity to tuberculin. Cell
Immunol 84:113-20.
100. Perez, E., S. Samper, Y. Bordas, C. Guilhot, B. Gicquel, and C. Martin. 2001. An
essential role for phoP in Mycobacterium tuberculosis virulence. Mol Microbiol 41:179-
87.
101. Pym, A. S., P. Brodin, R. Brosch, M. Huerre, and S. T. Cole. 2002. Loss of RD1
contributed to the attenuation of the live tuberculosis vaccines Mycobacterium bovis
BCG and Mycobacterium microti. Mol Microbiol 46:709-17.
102. Raghunand, T. R., and W. R. Bishai. 2006. Mapping essential domains of
Mycobacterium smegmatis WhmD: insights into WhiB structure and function. J Bacteriol
188:6966-76.
103. Ramakrishnan, L., N. A. Federspiel, and S. Falkow. 2000. Granuloma-specific
expression of Mycobacterium virulence proteins from the glycine-rich PE-PGRS family.
Science 288:1436-9.
104. Rambukkana, A., P. K. Das, A. Chand, J. G. Baas, D. G. Groothuis, and A. H. Kolk.
1991. Subcellular distribution of monoclonal antibody defined epitopes on
immunodominant Mycobacterium tuberculosis proteins in the 30-kDa region:
identification and localization of 29/33-kDa doublet proteins on mycobacterial cell wall.
Scand J Immunol 33:763-75.
89
105. Reed, M. B., P. Domenech, C. Manca, H. Su, A. K. Barczak, B. N. Kreiswirth, G.
Kaplan, and C. E. Barry, 3rd. 2004. A glycolipid of hypervirulent tuberculosis strains
that inhibits the innate immune response. Nature 431:84-7.
106. Reed, S. G., R. N. Coler, W. Dalemans, E. V. Tan, E. C. DeLa Cruz, R. J. Basaraba,
I. M. Orme, Y. A. Skeiky, M. R. Alderson, K. D. Cowgill, J. P. Prieels, R. M. Abalos,
M. C. Dubois, J. Cohen, P. Mettens, and Y. Lobet. 2009. Defined tuberculosis vaccine,
Mtb72F/AS02A, evidence of protection in cynomolgus monkeys. Proc Natl Acad Sci U S
A 106:2301-6.
107. Rivero, A., M. Marquez, J. Santos, A. Pinedo, M. A. Sanchez, A. Esteve, S. Samper,
and C. Martin. 2001. High rate of tuberculosis reinfection during a nosocomial outbreak
of multidrug-resistant tuberculosis caused by Mycobacterium bovis strain B. Clin Infect
Dis 32:159-61.
108. Rousseau, C., N. Winter, E. Pivert, Y. Bordat, O. Neyrolles, P. Ave, M. Huerre, B.
Gicquel, and M. Jackson. 2004. Production of phthiocerol dimycocerosates protects
Mycobacterium tuberculosis from the cidal activity of reactive nitrogen intermediates
produced by macrophages and modulates the early immune response to infection. Cell
Microbiol 6:277-87.
109. Saavedra, R., E. Segura, R. Leyva, L. A. Esparza, and L. M. Lopez-Marin. 2001.
Mycobacterial di-O-acyl-trehalose inhibits mitogen- and antigen-induced proliferation of
murine T cells in vitro. Clin Diagn Lab Immunol 8:1081-8.
110. Sherman, D. R., K. M. Guinn, M. J. Hickey, S. K. Mathur, K. L. Zakel, and S.
Smith. 2004. Mycobacterium tuberculosis H37Rv: Delta RD1 is more virulent than M.
bovis bacille Calmette-Guerin in long-term murine infection. J Infect Dis 190:123-6.
111. Simeone, R., D. Bottai, and R. Brosch. 2009. ESX/type VII secretion systems and their
role in host-pathogen interaction. Curr Opin Microbiol 12:4-10.
112. Singh, A., D. K. Crossman, D. Mai, L. Guidry, M. I. Voskuil, M. B. Renfrow, and A.
J. Steyn. 2009. Mycobacterium tuberculosis WhiB3 maintains redox homeostasis by
regulating virulence lipid anabolism to modulate macrophage response. PLoS Pathog
5:e1000545.
113. Singh, A., L. Guidry, K. V. Narasimhulu, D. Mai, J. Trombley, K. E. Redding, G. I.
Giles, J. R. Lancaster, Jr., and A. J. Steyn. 2007. Mycobacterium tuberculosis WhiB3
responds to O2 and nitric oxide via its [4Fe-4S] cluster and is essential for nutrient
starvation survival. Proc Natl Acad Sci U S A 104:11562-7.
114. Sinha, A., S. Gupta, S. Bhutani, A. Pathak, and D. Sarkar. 2008. PhoP-PhoP
interaction at adjacent PhoP binding sites is influenced by protein phosphorylation. J
Bacteriol 190:1317-28.
115. Sirakova, T. D., A. K. Thirumala, V. S. Dubey, H. Sprecher, and P. E. Kolattukudy.
2001. The Mycobacterium tuberculosis pks2 gene encodes the synthase for the hepta- and
90
octamethyl-branched fatty acids required for sulfolipid synthesis. J Biol Chem
276:16833-9.
116. Skeiky, Y. A., M. R. Alderson, P. J. Ovendale, J. A. Guderian, L. Brandt, D. C.
Dillon, A. Campos-Neto, Y. Lobet, W. Dalemans, I. M. Orme, and S. G. Reed. 2004.
Differential immune responses and protective efficacy induced by components of a
tuberculosis polyprotein vaccine, Mtb72F, delivered as naked DNA or recombinant
protein. J Immunol 172:7618-28.
117. Skeiky, Y. A., and J. C. Sadoff. 2006. Advances in tuberculosis vaccine strategies. Nat
Rev Microbiol 4:469-76.
118. Smith, S. M., and H. M. Dockrell. 2000. Role of CD8 T cells in mycobacterial
infections. Immunol Cell Biol 78:325-33.
119. Soliveri, J. A., J. Gomez, W. R. Bishai, and K. F. Chater. 2000. Multiple paralogous
genes related to the Streptomyces coelicolor developmental regulatory gene whiB are
present in Streptomyces and other actinomycetes. Microbiology 146 ( Pt 2):333-43.
120. Soto, C. Y., M. C. Menendez, E. Perez, S. Samper, A. B. Gomez, M. J. Garcia, and
C. Martin. 2004. IS6110 mediates increased transcription of the phoP virulence gene in a
multidrug-resistant clinical isolate responsible for tuberculosis outbreaks. J Clin
Microbiol 42:212-9.
121. Stanley, S. A., J. E. Johndrow, P. Manzanillo, and J. S. Cox. 2007. The Type I IFN
response to infection with Mycobacterium tuberculosis requires ESX-1-mediated
secretion and contributes to pathogenesis. J Immunol 178:3143-52.
122. Stanley, S. A., S. Raghavan, W. W. Hwang, and J. S. Cox. 2003. Acute infection and
macrophage subversion by Mycobacterium tuberculosis require a specialized secretion
system. Proc Natl Acad Sci U S A 100:13001-6.
123. Sterne, J. A., L. C. Rodrigues, and I. N. Guedes. 1998. Does the efficacy of BCG
decline with time since vaccination? Int J Tuberc Lung Dis 2:200-7.
124. Steyn, A. J., D. M. Collins, M. K. Hondalus, W. R. Jacobs, Jr., R. P. Kawakami, and
B. R. Bloom. 2002. Mycobacterium tuberculosis WhiB3 interacts with RpoV to affect
host survival but is dispensable for in vivo growth. Proc Natl Acad Sci U S A 99:3147-
52.
125. Stock, J. B., A. J. Ninfa, and A. M. Stock. 1989. Protein phosphorylation and regulation
of adaptive responses in bacteria. Microbiol Rev 53:450-90.
126. Taylor, B. L., and I. B. Zhulin. 1999. PAS domains: internal sensors of oxygen, redox
potential, and light. Microbiol Mol Biol Rev 63:479-506.
127. Trunz, B. B., P. Fine, and C. Dye. 2006. Effect of BCG vaccination on childhood
tuberculous meningitis and miliary tuberculosis worldwide: a meta-analysis and
assessment of cost-effectiveness. Lancet 367:1173-80.
91
128. Tsenova, L., R. Harbacheuski, N. Sung, E. Ellison, D. Fallows, and G. Kaplan. 2007.
BCG vaccination confers poor protection against M. tuberculosis HN878-induced central
nervous system disease. Vaccine 25:5126-32.
129. Turner, O. C., R. J. Basaraba, and I. M. Orme. 2003. Immunopathogenesis of
pulmonary granulomas in the guinea pig after infection with Mycobacterium
tuberculosis. Infect Immun 71:864-71.
130. Vallishayee, R. S., A. N. Shashidhara, K. Bunch-Christensen, and J. Guld. 1974.
Tuberculin sensitivity and skin lesions in children after vaccination with 11 different
BCG strains. Bull World Health Organ 51:489-94.
131. van Pinxteren, L. A., J. P. Cassidy, B. H. Smedegaard, E. M. Agger, and P.
Andersen. 2000. Control of latent Mycobacterium tuberculosis infection is dependent on
CD8 T cells. Eur J Immunol 30:3689-98.
132. Verreck, F. A., R. A. Vervenne, I. Kondova, K. W. van Kralingen, E. J. Remarque,
G. Braskamp, N. M. van der Werff, A. Kersbergen, T. H. Ottenhoff, P. J. Heidt, S.
C. Gilbert, B. Gicquel, A. V. Hill, C. Martin, H. McShane, and A. W. Thomas. 2009.
MVA.85A boosting of BCG and an attenuated, phoP deficient M. tuberculosis vaccine
both show protective efficacy against tuberculosis in rhesus macaques. PLoS One
4:e5264.
133. Walters, S. B., E. Dubnau, I. Kolesnikova, F. Laval, M. Daffe, and I. Smith. 2006.
The Mycobacterium tuberculosis PhoPR two-component system regulates genes essential
for virulence and complex lipid biosynthesis. Mol Microbiol 60:312-30.
134. Wang, S., J. Engohang-Ndong, and I. Smith. 2007. Structure of the DNA-binding
domain of the response regulator PhoP from Mycobacterium tuberculosis. Biochemistry
46:14751-61.
135. Wayne, L. G. 1994. Dormancy of Mycobacterium tuberculosis and latency of disease.
Eur J Clin Microbiol Infect Dis 13:908-14.
136. Weinrich Olsen, A., L. A. van Pinxteren, L. Meng Okkels, P. Birk Rasmussen, and
P. Andersen. 2001. Protection of mice with a tuberculosis subunit vaccine based on a
fusion protein of antigen 85b and esat-6. Infect Immun 69:2773-8.
137. Whelan, K. T., A. A. Pathan, C. R. Sander, H. A. Fletcher, I. Poulton, N. C. Alder,
A. V. Hill, and H. McShane. 2009. Safety and immunogenicity of boosting BCG
vaccinated subjects with BCG: comparison with boosting with a new TB vaccine,
MVA85A. PLoS One 4:e5934.
138. Wiker, H. G., and M. Harboe. 1992. The antigen 85 complex: a major secretion product
of Mycobacterium tuberculosis. Microbiol Rev 56:648-61.
139. Woodworth, J. S., Y. Wu, and S. M. Behar. 2008. Mycobacterium tuberculosis-
specific CD8+ T cells require perforin to kill target cells and provide protection in vivo. J
Immunol 181:8595-603.
92
140. Wu, B., C. Huang, L. Garcia, A. Ponce de Leon, J. S. Osornio, M. Bobadilla-del-
Valle, L. Ferreira, S. Canizales, P. Small, M. Kato-Maeda, A. M. Krensky, and C.
Clayberger. 2007. Unique gene expression profiles in infants vaccinated with different
strains of Mycobacterium bovis bacille Calmette-Guerin. Infect Immun 75:3658-64.