Genes and Drugs

OUTLINE– How do we know if a patient will respond to a drug?

– What are the response rates for different classes of drugs?

– How are doses determined?

– Why does drug response vary?

– Genetic variation• What is it?• How do you measure it?• How extensive is it?• Pharmacogenomics: genetic variation and drug response

– Examples• Gefitinib• Warfarin

– Pharmacogenomics – costs and benefits

How do we know if a patient will respond (or have an adverse response) to a drug?

(we don’t)

Some examples of drug response rates

Dose determination– Phase I clinical trials (safety)

• 20 to 80 healthy volunteers• Determine max tolerable dose

– Phase II clinical trials (efficacy)• Several hundred patients• estimate therapeutic dose range

– Drugs approved with a specific indication and dose range

– Phase III monitoring.

– Dose that patients actually receive depends on…• Prior treatment history of patient (drug naïve?)• Physicians experience with prescribing drug • Empirical knowledge of appropriate dose • In practice – start low, ramp to ~80% of recommended dose before trying

different drug• Liability issues

– No clinical trials are done to study dose escalation

– Therapeutic drug monitoring

Potential causes of variability in drug Potential causes of variability in drug effects:effects:

• Pathogenesis and the severity of the disease Pathogenesis and the severity of the disease being treated.being treated.

• Drug interactions from concomitant treatments Drug interactions from concomitant treatments (plasma protein binding, metabolism)(plasma protein binding, metabolism)

• Individual’s age, gender, lifestyle (including Individual’s age, gender, lifestyle (including environmental factors), behavior, nutritional environmental factors), behavior, nutritional state, renal and liver function, and concomitant state, renal and liver function, and concomitant illnesses.illnesses.

• Genetic variationGenetic variation

A patient’s response to a drug may depend A patient’s response to a drug may depend on factors that can vary according to the on factors that can vary according to the alleles that an individual carries, includingalleles that an individual carries, including

Pharmacokinetic factorsPharmacokinetic factors• AbsorptionAbsorption• DistributionDistribution• MetabolismMetabolism• EliminationElimination

Pharmacodynamic factorsPharmacodynamic factors• target proteinstarget proteins• downstream downstream

messengersmessengers

Phase I metabolism (oxidation by Phase I metabolism (oxidation by CYP450s)CYP450s)Over 1000 CYP450 enzymes identified (50 active enzymes Over 1000 CYP450 enzymes identified (50 active enzymes in human). Expressed mainly in liver.in human). Expressed mainly in liver.

Multiple alleles with different frequencies in different Multiple alleles with different frequencies in different ethnic groupsethnic groups

P450 enzymes oxidize drugs or other xenobiotics in order P450 enzymes oxidize drugs or other xenobiotics in order to:to:

1. increase polarity, and enhance excretion 1. increase polarity, and enhance excretion (decrease resorption in distal nephron) (decrease resorption in distal nephron)

2. convert to substrate for phase2 metabolism2. convert to substrate for phase2 metabolism

RH + O2 + NADPH + H+ ROH +H2O +NADP+

CYP450

CYP3A4 • most important (50%)• inducible

CYP2D6• next in line (20%)• not inducible

CYP2C9 and 2C19• next (15%)• inducible

CYP450s important in Drug Metabolism

* Functional allelic variants. There are 70 identified functionalvariants of CYP2D6 alone

Phase II metabolism (conjugation)Phase II metabolism (conjugation)Substrate is phase I reaction product, or other endogenous Substrate is phase I reaction product, or other endogenous compound ( eg. steroid hormones)compound ( eg. steroid hormones)

Congugaton of highly polar glucuronide enhances water Congugaton of highly polar glucuronide enhances water solubility/decreases lipid solubility and thereby promotes solubility/decreases lipid solubility and thereby promotes excretionexcretion

Fewer genes and functional variants than P450sFewer genes and functional variants than P450s

Gtxase

EM

PM

EM = extensive metabolizers

PM = poor metabolizers

Distribution of metabolic efficiency

Metabolic ratio = [parent]/[metabolite]

Variation in the genome most Variation in the genome most relevant to pharmacogenomics:relevant to pharmacogenomics:

• Insertions/deletions (small and large)Insertions/deletions (small and large)

• Single nucleotide polymorphisms Single nucleotide polymorphisms (SNPs)(SNPs)

Copy Number Polymorphisms in Human Genome

gains

losses

• 39 healthy unrelated individuals

• 255 loci

• 24 variants present in >10% of individuals

Iafrate et al., Nat Genet. 36, 949 (2004)

SNPs are the most commonly SNPs are the most commonly occurring genetic differencesoccurring genetic differences

ACGCCTTGACGAACGCCTTGACGAAAGCTTACGCTTACACGCCTTGACGAACGCCTTGACGATTGCTTACGCTTAC

SNPs are single base pair positions in genomic SNPs are single base pair positions in genomic DNA at which different sequence alternatives DNA at which different sequence alternatives (alleles) exist wherein the least frequent allele (alleles) exist wherein the least frequent allele has an abundance of 1% or greaterhas an abundance of 1% or greater

SNPs are estimated to occur throughout SNPs are estimated to occur throughout the genome at a rate of between 3 and 6 the genome at a rate of between 3 and 6

per 1000 base pairs per 1000 base pairs

– Any individual selected at random contains Any individual selected at random contains ~25% of human variation~25% of human variation

– ~90% of snps in any given individual are ~90% of snps in any given individual are present in pop’n at largepresent in pop’n at large

– There are expected to be a total of 10-20M There are expected to be a total of 10-20M SNPs in human populationSNPs in human population

Biochemistry of SNP Genotyping

MassARRAY™ Compact System

Affymetix SNP Chip

ABI 7900

PharmacogenomicsPharmacogenomics

The effects of an individual’s genotype on The effects of an individual’s genotype on the pharmacokinetics and the pharmacokinetics and pharmacodynamics of drug action.pharmacodynamics of drug action.

Gefitinib (Iressa) Gefitinib (Iressa)

Gefitinib Gefitinib •Epidermal Growth Factor Receptor over-expressed in 40-80% of Non-Small-Cell Epidermal Growth Factor Receptor over-expressed in 40-80% of Non-Small-Cell Lung CarcinomasLung Carcinomas

•EGFR signaling triggered by binding of growth factors, resulting in dimerization of EGFR signaling triggered by binding of growth factors, resulting in dimerization of receptor, auto/trans phosphorylation via tyrosine kinase domain, recruitment of receptor, auto/trans phosphorylation via tyrosine kinase domain, recruitment of downstream effectors and activation of cell prolioferation/survival programsdownstream effectors and activation of cell prolioferation/survival programs

•Gefitinib inhibits EGFR by blocking ATP cleft, thereby preventing activation by Gefitinib inhibits EGFR by blocking ATP cleft, thereby preventing activation by autophosphorylationautophosphorylation

•Tumor responses seen in only ~10% of patients with chemotherapy resistant Tumor responses seen in only ~10% of patients with chemotherapy resistant advanced NSCLCadvanced NSCLC

•A subgroup of patients with NSCLC have specific mutations in the EGFR gene A subgroup of patients with NSCLC have specific mutations in the EGFR gene that constitutively activate the receptor, and confer sensitivity ot Gefitinibthat constitutively activate the receptor, and confer sensitivity ot Gefitinib

Lynch TJ et al., Lynch TJ et al., NEJMNEJM 350,2129; Paez JG et al., 350,2129; Paez JG et al., ScienceScience, 304,1497, 304,1497

Gefitinib Gefitinib •25/275 patients at Mass General identified as being responsive. EGFR sequenced in 9 25/275 patients at Mass General identified as being responsive. EGFR sequenced in 9 responsive patients.responsive patients.

Gefitinib Gefitinib

•All mutations in kinase domainAll mutations in kinase domain•Matched tissue showed wild type sequence. No mutations seen in 7 non-Matched tissue showed wild type sequence. No mutations seen in 7 non-responsive cases analysedresponsive cases analysed•Heterozygous mutations seen in 2 cases. Dominant gain of function mutationHeterozygous mutations seen in 2 cases. Dominant gain of function mutation•Heterologous expression in Cos-7 cells shows mutant receptors (Heterologous expression in Cos-7 cells shows mutant receptors ( IC50 = 0.015uMIC50 = 0.015uM) ) more sensitive to inhibition by gefitinib than wild type (more sensitive to inhibition by gefitinib than wild type ( IC50 = 0.1uMIC50 = 0.1uM).).

Gefitinib Gefitinib ConclusionsConclusions

•Only a subgroup of NSCLC tumors harbour EGFR mutations. Only a subgroup of NSCLC tumors harbour EGFR mutations.

•This subtype of NSCLC sensitive to genfitinibThis subtype of NSCLC sensitive to genfitinib

•Patients should be screened for EGFR mutations, and if they have them, Patients should be screened for EGFR mutations, and if they have them, be given gefitinib as first line therapy.be given gefitinib as first line therapy.

Warfarin (Coumadin)Warfarin (Coumadin)

Warfarin Warfarin •Anticoagulant of choice in North America for cardivascular disease, Anticoagulant of choice in North America for cardivascular disease, thromboembolic disease, and prophylactic post-surgery applicationthromboembolic disease, and prophylactic post-surgery application

mechanismmechanism• activation of coagulation factors II, VII, IX and X by carboxylation activation of coagulation factors II, VII, IX and X by carboxylation requires vitamin Krequires vitamin K• vitK generated by vitK-epoxide-reductase. vitK generated by vitK-epoxide-reductase. • warfarin (and other oral anticoagulants) inhibits this enzyme warfarin (and other oral anticoagulants) inhibits this enzyme complex.complex.

•1515thth most prescribed drug and 1 most prescribed drug and 1stst in category of accidents and adverse in category of accidents and adverse reactions (bleeding)reactions (bleeding)

•Very narrow therapeutic index and individualized dosing mandatory. Very narrow therapeutic index and individualized dosing mandatory. Effective daily dose 0.5 to 80mgEffective daily dose 0.5 to 80mg

•Dosing determined by patient history and physical exam, in conjunction Dosing determined by patient history and physical exam, in conjunction with INR (international normalization ratio. In-vitro clotting time versus with INR (international normalization ratio. In-vitro clotting time versus standard reference)standard reference)

WarfarinWarfarin• genetic factors genetic factors influencing influencing warfarin warfarin response response unknown. unknown.

• genetic data genetic data may help may help determining determining correct dose correct dose and preventing and preventing adverse adverse reactionsreactions

• present present studystudy: type 14 : type 14 genes in 1000+ genes in 1000+ patients and patients and associate associate variants with variants with warfarin warfarin responseresponse

• Logistics - how do you obtain genotypes clinically and how do you Logistics - how do you obtain genotypes clinically and how do you manage this informationmanage this information

• costcost

• How deterministic is a genotypeHow deterministic is a genotype

• Do primary caregivers know how to interpret and apply these data?Do primary caregivers know how to interpret and apply these data?

• Fractionating market not immediately desirable for drug makersFractionating market not immediately desirable for drug makers

Genes and Drugs

Documents

Transcript of Genes and Drugs