TECHNOLOGY REPORT

Generation of a Conditional Allele of the B-myb GenePaloma Garcıa,1 Oscar Berlanga,1 Roger Watson,2 and Jon Frampton1*1Institute for Biomedical Research, Birmingham University Medical School, Edgbaston, Birmingham, United Kingdom2Department of Virology, Imperial College London, Faculty of Medicine, London, United Kingdom

Received 30 July 2005; Accepted 3 October 2005

Summary: B-Myb is an essential transcription factorinvolved in control of the cell cycle and the regulation oftissue-specific gene expression in a wide range of celltypes. Loss of both alleles results in early embryoniclethality at E4.5–6.5. To address the function of B-Myb inlater stages of embryogenesis and in specific adult tis-sues, a floxed B-myb allele (B-mybF) was generated.Cre-mediated deletion in vivo was demonstrated bybreeding with a transgenic GATA-Cre mouse line. Anintermediate allele produced in the creation of the floxedallele, in which the PGK-neoR cassette is present inintron 3 (B-mybloxneo), was deduced to be a weak hypo-morph based on the later embryonic death of homozy-gotes compared to B-myb–/– embryos. To demonstratethe efficiency and possible consequences of B-mybinactivation, we performed conditional deletion in cul-tured MEFs and observed decreased growth that corre-lated with aberrant nuclear DNA replication. genesis43:189–195, 2005. VVC 2005 Wiley-Liss, Inc.

Key words: B-Myb; cell cycle; S-phase; conditional genedeletion; Cre/loxP

The B-myb gene, which is ubiquitously expressed ingrowing cells, encodes a transcriptional regulator that ismaximally expressed in S phase and acts as a centralplayer in the cell cycle network (reviewed in Saville andWatson, 1998; Sala and Watson, 1999). B-myb is a classi-cal E2F-regulated gene, and as such its transcription isinduced to maximal levels at the G1/S boundary duringthe cell cycle (Lam and Watson, 1993; Lam et al., 1994,1995). Furthermore, activity of the B-Myb protein isregulated by cyclin A2/Cdk2-mediated phosphorylation(Golay et al., 1991; Reiss et al., 1991; Lane et al., 1997;Ziebold et al., 1997), which itself is maximally active atthe G1/S transition and throughout S phase. It is evident,therefore, that transcriptional and posttranslational con-trols combine to restrict active B-Myb to the late G1 andS phases of the cell cycle, strongly suggesting that it is atthese stages where B-Myb’s function is most critical. Arole for B-Myb in cell proliferation is supported by sev-eral studies on a variety of cell lines (Arsura et al., 1992;Lin et al., 1994; Sala and Calabretta, 1992). B-Myb couldregulate the expression of any of a number of genes

whose products are involved in entry into or progres-sion through S phase, and our experiments indicate thatB-Myb is required for a proper completion of S phase. Asa consequence of its downregulation, replication isimpaired, resulting in a defect in chromosome condensa-tion and arrest in mitosis (Garcıa and Frampton, submit-ted). Interestingly, a possible mechanism for the effectsof reduced B-Myb expression on S phase progression issuggested by the finding that Drosophila Myb (Dm-Myb), an ancestral Myb family member to which B-Mybis most closely related (Davidson et al., 2005), is anessential component of complexes that may assemble atspecific chromosomal sites for the regulation of tran-scription associated with replication (Beall et al., 2002,2004; Lewis et al., 2004). However, the effects of B-Mybmay well not be restricted to S phase. Hence, mutants ofDm-Myb have various mitotic defects, including centro-some amplification and genome instability (Fung et al.,2002), which may in part be due to a requirement forDm-Myb to induce cyclin B expression (Okada et al.,2002). In addition, studies in neuroblastoma and B-celllines have implicated B-Myb as a differentiation and anti-apoptotic factor (Raschella et al., 1995; Lang et al.,2005), while B-Myb has been shown to regulate extracel-lular matrix molecule gene expression in vascular cells(Hofmann et al., 2004) and adhesion molecule expres-sion in embryonic stem (ES) cells (Iwai et al., 2001).

During development, B-Myb expression is highest inthe preimplantation embryo, and reflecting this thegenetic knockout of B-myb in mice resulted in embry-onic lethality at a very early (E4.5–E6.5) stage of embryo-genesis (Tanaka et al., 1999). Although it is unclearwhether death resulted from effects on cell proliferation,

* Correspondence to: Prof. Jon Frampton, Institute for Biomedical

Research, Birmingham University Medical School, Edgbaston, Birmingham

B15 2TT, United Kingdom. E-mail: j.frampton@bham.ac.uk

Contract grant sponsor: Wellcome Trust (Senior Fellowship programme

to J.F.); Contract grant sponsor: the Association for International Cancer

Research (AICR) (to R.W., J.F.); Contract grant sponsor: Leukaemia Research

Fund (LRF) (to J.F.); Contract grant sponsor: EU Marie Curie award (to P.G.).Published online in

Wiley InterScience (www.interscience.wiley.com).

DOI: 10.1002/gene.20170

' 2005 Wiley-Liss, Inc. genesis 43:189–195 (2005)

the fact that the inner cell mass failed to outgrow whenB-myb�/� blastocysts were cultured in vitro suggests anessential role in the establishment or growth of ES cells.The early embryonic lethality of the constitutive B-mybknockout clearly limits its usefulness, and therefore wehave generated a conditional allele based on a Cre/loxPstrategy to allow studies of homozygous B-myb mutantmice at later developmental stages as well as time- andtissue-specific ablation of B-Myb function.

A targeting vector was constructed in which loxP siteswere introduced just 50 of exon 2 and 30 of exon 5,thereby encompassing all of the sequences encoding theB-Myb DNA binding domain except for a small regionencoded by exon 6. A neomycin resistance (neoR) cas-sette driven by the phosphoglycerate kinase (PGK) genepromoter and flanked by Flp recombinase target (FRT)sites (Emambokus et al., 2003) was inserted in intron 3(Fig. 1A). To increase the frequency of gene targeting by

counterselection for clones in which the targeting con-struct has inserted by a nonhomologous mechanism, acassette derived from pPNT (Tybulewicz et al., 1991)containing the HSV-1 thymidine kinase gene driven froma PGK promoter was included at the end of the con-struct. The targeting vector was electroporated into129/Sv strain CK35 ES cells. Homologous recombinationin neomycin-resistant clones was confirmed by Southernblot analysis of appropriately digested DNA using anexternal probe and a probe specific for the neoR cassette(Fig. 1B). In addition, the presence of both loxP siteswas confirmed by polymerase chain reaction (PCR) anal-ysis (Fig. 1C). Correctly targeted clones were obtained ata frequency of 1 in 60. Chimeras were generated byinjection of two targeted ES cell clones into C57BL/6blastocysts, and germline transmissibility was confirmedfor both by crossing to C57BL/6. The resulting alleleretaining the neoR cassette is designated B-mybloxneo.

FIG. 1. Introduction of loxP sites into the B-myb locus. A: Schematic representation of the wildtype B-myb gene, targeting vector, andmodified allele. LoxP sites (green/light arrow heads) and a PGK-neoR cassette, flanked by FRTsites (red/dark arrow heads), were introducedinto the B-myb gene by homologous recombination to produce the B-mybloxneo allele. Exons are represented by rectangles. A: AscI, B:BamHI, Bs: BstEII, E: EcoRI, H: HindIII, Sc: ScaI, Sp: SpeI, X: XhoI. B: Targeted events were detected by Southern blot analysis of genomicDNA from ES cells. EcoRI/SpeI-digested DNAs were hybridized to the external probe: a 6.9-kbp band was observed for the wildtype alleleand an 8.7-kbp band for the mutant allele. The somewhat lower intensity of the band representing the mutant allele was an artifact of trans-fer during blotting, since all subsequent analyses of the cells and the resulting animals indicated that correct targeting had occurred. Rehy-bridization of the blot with a probe specific for the neoR cassette confirmed the identity of the 8.7 kbp band. C: The presence of the 50 and 30loxP sites in targeted cells was confirmed by PCR analysis. Primers P1 and P2 produce fragments of 300 bp and 340 bp from the wildtypeand 50loxP-containing alleles, respectively. Primers P3 and P4 produce fragments of 360 bp and 410 bp from the wildtype and 30loxP-con-taining alleles, respectively. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

190 GARCIA ET AL.

Breeding of B-mybloxneo/þ heterozygotes to oneanother suggested that the floxed allele retainingthe neoR cassette is not fully functional in that no B-mybloxneo/loxneo homozygotes were detected among thelive births (Table 1). Examination of the genotype ofearly embryos revealed that B-mybloxneo/loxneo homozy-gotes could be detected at E6.5 and E7.5 but not at E8.5(Table 1). In comparison with the results obtained previ-ously with the null allele, from which it was concludedthat B-myb�/� embryos only develop as far as E4.5–6(Tanaka et al., 1999), this suggests that the B-mybloxneo

allele may be a weak hypomorph that gives rise to suffi-cient B-Myb to allow development to proceed further.

Given the effect of the neoR cassette, we next crossedB-mybloxneo/þ animals with mice expressing Flp recom-binase (Dymecki, 1996) to bring about deletion of theFRT-flanked sequences. Deletion, as detected by PCR,occurred in those progeny possessing the modified B-myb allele and the Flp transgene. Crossing of animalsexhibiting deletion with wildtype C57BL/6 mice re-vealed that recombination had not occurred in all germcells, since only a proportion of the progeny inheritingthe modified B-myb allele were positive for the deletion(data not shown). Intercrossing of mice heterozygousfor the loxP modified allele lacking neoR (the ‘‘floxed’’allele, B-mybF) demonstrated that homozygotes reachadulthood with a normal Mendelian frequency (Fig. 2Band data not shown).

To determine whether the B-mybF conditional allele isactive, B-mybF/þ animals were crossed to mice that carrythe GATA-Cre transgene. This Cre transgene is widelyexpressed and can lead to deletion of floxed sequencesin the germline (Jasinski et al., 2001). Tail DNA from theprogeny of such crosses was analyzed by PCR for thepresence of the deleted allele, B-mybD/þ. Deletionoccurred at a high frequency in progeny possessing themodified B-myb allele and the Cre transgene as evi-denced by the decrease in the relative intensity of the340-bp PCR amplification product, representing theunrecombined loxP site, and a corresponding appear-ance of the deleted product in DNA derived from the tailand (Fig. 2C) and hematopoietic tissues (data notshown). Of technical interest, when we performed asimilar cross between mice harboring the B-mybloxneo

allele and the GATA-Cre transgene we observed that Cre-mediated deletion of the floxed sequence was notdetectable in the tail, but occurred efficiently in hemato-poietic cells in the bone marrow and spleen (Fig. 2D). A

likely explanation for this difference is that the neoR

sequences inhibit Cre-mediated recombination to someextent, but this effect is less in those tissues that expressCre strongly, as is the case for the GATA-Cre transgene inhematopoietic cells (Jasinski et al., 2001).

To assess whether conditional deletion of B-myb leadsto a cellular phenotype, B-mybF/þ animals were crossedto mice that carry the Mx-Cre transgene, from which Creexpression can be induced by eliciting an interferonresponse (Kuhn et al., 1995). E13 embryos obtainedfrom intercrosses of B-mybF/þ:MxCre animals were usedto prepare embryonic fibroblasts (MEFs) with the geno-type B-mybþ/þ:MxCre and B-mybF/F:MxCre. After threepassages, the MEF cultures were treated with polydIC toinduce an interferon response and Cre expression. PCRof genomic DNA isolated from the MEFs was used toconfirm the generation of the deleted allele (Fig. 3A) andthe corresponding loss of the undeleted allele (Fig. 3B).By comparing the ratio of the internal control and 30loxP site PCR bands we estimated that a maximum of75% deletion was achieved after 14 h of induction (Fig.3B). Western blot analysis of B-Myb confirmed that theextent of deletion seen at the level of genomic DNA wasreflected in the level of protein expression (Fig. 3C). Wehad no indication for the generation of an aberrant pro-tein. Determination of the cell number following admin-istration of polydIC showed a relative decrease in thegrowth rate of B-mybF/F:MxCre MEFs (Fig. 3D), and cor-relating with this we noted a decrease in the proportionof cells in S phase as indicated by flow cytometric analy-sis of propidium iodide-stained cells (Fig. 3E). To furtherexplore the cell cycle defect following deletion of B-myb, we pulse-labeled the cells with bromodeoxyuri-dine (BrdU) and examined its incorporation into newlysynthesized nuclear DNA by fluorescent microscopy.The percentage of cells incorporating BrdU was thesame for both cell populations; however, the stainingdistribution was different (Fig. 3F and data not shown).This short pulse study, together with the cell cycle analy-sis, suggests that the initiation of DNA synthesis may beunaffected by the loss of B-Myb but that later stages ofthe replication cycle are perturbed. B-mybþ/þ:MxCrecells showed discrete foci of replication distributedthroughout the nucleus, whereas B-mybF/F:MxCre MEFsexhibited an aberrant localization of BrdU with a hetero-geneous and sometimes diffuse accumulation. Overall,these results indicate that B-Myb is essential for S phaseand that at least part of its influence is required for thecorrect progression of replication. Interestingly, we ob-tained analogous results in hematopoietic cells byknockdown of B-Myb using siRNA (Garcıa and Framp-ton, submitted).

In conclusion, we generated a floxed conditionalallele of B-myb that is susceptible to Cre-mediated re-combination, giving rise to a null allele. The B-mybF

allele should prompt further studies on the role of B-Myb in cell cycle regulation and will enable investigationof the specific importance of B-Myb in a variety of fetaland adult cell types.

Table 1Genotype of Embryos and Adults From B-mybloxneo/þ Intercrosses

Stage

Genotype

B-mybþ/þ B-mybloxneo/þ B-mybloxneo/loxneo

E6.5 3 7 2E7.5 6 0 1E8.5 2 7 0P2 15 19 0

191CONDITIONAL ALLELE OF THE B-myb GENE

MATERIALS AND METHODS

Generation of the Targeting Construct

A mouse 129/Sv PAC clone containing the B-myb genewas identified in a library provided by the UK HGMPResource Centre by screening with a cDNA probe. A12.5-kbp HindIII fragment containing exons 2 to 6 wassubcloned into pBSK. A second fragment of 5.0 kbp con-taining exons 1 and 2 was amplified from the same PACclone by high-fidelity PCR and subcloned into TOPO.Digestion of this second plasmid with XhoI gave a2.5-kbp fragment containing intron 1 adjacent to exon 2,and this was subcloned into the XhoI site 183 upstreamof exon 2 in the vector containing the 12.5-kbp HindIIIfragment. LoxP sites were cloned in the same orientationinto intron 1 at the BstEII site (50loxP) and into the ScaIsite in intron 5 (30loxP). A neomycin resistance (neoR)cassette driven by the phosphoglycerate kinase genepromoter and flanked by FRT sequences was subcloned

into a filled-in HindIII site upstream of exon 3. To enablenegative selection against nonhomologous recombi-nants, a thymidine kinase cassette driven by the herpessimplex virus promoter was subcloned at the end of thetargeting sequences in adjacent EcoRI/HindIII sites.

Targeting of ES Cells

A NotI-linearized targeting vector (50 lg) was intro-duced into 107 129/Sv CK35 ES cells by electroporation.Targeted clones were isolated after growth in the pres-ence of G418 (280 lg/ml) for 10 days and ganciclovir(1 lM) for 2 days and were then expanded in triplicate96-well plates. Homologous recombination was con-firmed by Southern blot analysis of DNA using two differ-ent probes (an external probe and an internal neoR

probe) and digestion with restriction enzymes outsideand inside the targeting construct. In addition, the pres-ence of both loxP sites was confirmed by PCR. Chimeras

FIG. 2. Generation and validation of the B-myb conditional knockout allele. A: Schematic representation of the modified loxneo, floxed (F)and deleted (D) B-myb alleles. Details are as described in Figure 1A. B: PCR analysis of progeny from the intercross of B-mybF animals. C:Cre-mediated deletion of the loxP flanked sequences in the B-mybF allele. PCR using primers P1 and P2 demonstrate loss of the majority ofthe 50 loxP site (340-bp fragment) in the tail of an animal containing the B-mybF allele and expressing Cre recombinase from the GATA-Cretransgene (upper panel). Correspondingly, primers P1 and P7 produce a fragment of 240 bp when sequences between the two loxP siteshave been deleted (lower panel). D: Cre-mediated deletion of the loxP flanked sequences in the B-mybloxneo allele. PCR using primers P1and P7 demonstrates significant levels of deletion in spleen and bone marrow but not in the tail of an animal containing the B-mybloxneo alleleand expressing Cre recombinase from the GATA-Cre transgene. [Color figure can be viewed in the online issue, which is available atwww.interscience.wiley.com.]

192 GARCIA ET AL.

were generated by microinjection of two correctly tar-geted ES cell clones into C57BL/6 blastocysts.

Genotyping

Genomic DNA was isolated from cultured ES cells, MEFs,embryos, and adult tail tips by digestion overnight at 558Cin lysis buffer (100 mM NaCl, 50 mM Tris-Cl pH7.5,10 mM EDTA, 0.5% SDS, 1 mg/ml proteinase K) followedby phenol-chloroform extraction and ethanol precipitation.For Southern blot analysis, genomic DNA was digestedwith EcoRIþSpeI in the presence of 100 lg/ml RNase and

4 mM spermidine and resolved on 1% agarose gels. PCRwas used to check for the presence of both the 50 and 30loxP sites, to determine the presence of Flp recombinaseand consequent deletion of the neoR cassette, and to deter-mine the presence of Cre recombinase and the effective-ness of the respective deletion. The corresponding oligo-nucleotide primer pairs are shown in Table 2.

Recombinase-Expressing Transgenic Mice

Two transgenic Cre lines were employed in this study,namely, GATA-Cre to elicit deletion in the germline and

FIG. 3. Downregulation of B-Myb in MEFs by conditional gene deletion leads to growth retardation and aberrant DNA replication. MEFsderived from B-mybþ/þ:MxCre or B-mybF/F:MxCre E13 embryos were treated with polydIC to induce Cre activity. A: Demonstration of thepresence of the deleted allele following activation of Cre. PCR was performed on cellular genomic DNA using primers P1 and P7. Lane 1:water control; Lane 2: B-mybF/F:MxCre MEFs without polydIC; Lane 3: B-mybF/F:MxCre MEFs with polydIC for 14 h; Lane 4: B-mybF/F:MxCre MEFs with polydIC for 21 h. B: PCR quantification of the deletion efficiency comparing amplification of an intron 1 segment with afragment encompassing the 30 loxP generated using primers P3 and P8. PCR reactions were performed in 50 ll, using 0.125 lg DNA, andprimers P3/P8 and internal control at 33 lM and 50 lM, respectively. Samples of 10 ll were removed from the reaction after 27, 30, 33, and36 cycles and fractionated on a 2.5% agarose gel. Comparison of the relative band intensities was used to calculate the ratio between theinternal standard and the 30 loxP band. C:Western blot analysis of B-Myb protein expression following deletion of B-myb. Forty lg of proteinextracted from MEFs of both genotypes that had been treated with polydIC for 21 h was fractionated on an 8% polyacrylamide gel, electro-blotted, and probed with anti-B-Myb monoclonal antibody. D: Cell number following addition of polydIC. MEFs of both genotypes that hadnot been treated with polydIC grew at an equivalent rate, reaching 4.56 0.153 104 at 21 h. E: Cell cycle analysis of MEFs following deletionof B-myb. The proportion of cells in G1, S, and G2/M phases are indicated. F: Immunofluorescence analysis of BrdU incorporation. MEFswere treated with polydIC for 20 h and then labeled with BrdU for 2.5 h. [Color figure can be viewed in the online issue, which is available atwww.interscience.wiley.com.]

193CONDITIONAL ALLELE OF THE B-myb GENE

in hematopoietic cells (Jasinski et al., 2001), and Mx-Creto enable inducible deletion through activation of aninterferon response (Kuhn et al., 1995). A transgenic lineexpressing Flp recombinase from a human b-actin pro-moter (Dymecki, 1996) was used to delete the FRT siteflanked neoR cassette in the germline.

Conditional Deletion of B-myb in MEFs and CellCycle Analysis

MEFs were prepared and cultured using standard meth-ods (Hogan et al., 1994). Induction of Cre expressionfrom the MxCre transgene was achieved by addition ofpolydIC to the growth medium at a concentration of10 lg/ml. The efficiency of deletion was determined bysemiquantitative PCR using genomic DNA and primersthat detect the deleted allele or the undeleted 30 loxPsite (Table 2). Primers that amplify a section of intron 1were used as an internal standard in multiplex reactionsto enable estimation of the extent of loss of the unde-leted 30 loxP site. For a given PCR reaction, sampleswere removed at intervals of three cycles to enable com-parison of the linear phases of amplification. PCR prod-ucts were analyzed by agarose gel electrophoresis.

DNA content was determined by staining with 50 lg/mlpropidium iodide (Sigma, St. Louis, MO) as previouslydescribed. Cell cycle analysis was performed with a FACS-calibur analyzer and CellQuest software (Becton Dickin-son, San Jose, CA).

For microscopic examination of DNA synthesis, poly-dIC-treated MEFs were cultured in the presence of 20lM BrdU (Sigma) for 2.5 h, cytospun onto glass cover-slips, and fixed in ethanol/acetic acid for 20 min andthen incubated with 1 N HCl at 608C for 30 min. Afterseveral washes in water, cells were incubated withmouse anti-BrdU antibody (Dako, Carpinteria, CA) for1 h at 378C followed by secondary antimouse-Ig-PE(Sigma).

Western Blot Analysis

Forty lg of total protein extract (lysis buffer: 20 mM Tris-HCl, pH 7.4; 10 mM EDTA; 100 mM NaCl; 1% Triton X-100 containing protease and phosphatase inhibitors)was subjected to SDS-PAGE and proteins transferred toBioTrace PVDF membranes (Bio-Rad, Hercules, CA) for2 h at 15 V using a semidry transfer apparatus (Amersham,Arlington Heights, IL). Ponceau Red staining was routinelyperformed on membranes to check sample loading andtransfer efficiency. After blocking overnight in TBS con-taining 0.1% Tween 20 (T-TBS) and 10% bovine serumalbumin (BSA), filters were incubated at room tempera-ture with antimouse B-Myb mouse monoclonal (SantaCruz Biotechnology, Santa Cruz, CA) diluted 1:1,000 in T-TBS. After washing and incubation with secondary anti-body conjugated to horseradish peroxidase (Amersham),signals were detected using the enhanced chemilumines-cence system (Pierce, Rockford, IL).

ACKNOWLEDGMENTS

The authors thank Nikla Emambokus for considerableassistance in the design of the targeting strategy.

LITERATURE CITED

Arsura M, Introna M, Passerini F, Mantovani A, Golay J. 1992. B-mybantisense oligonucleotides inhibit proliferation of human hemato-poietic cell lines. Blood 79:2708–2716.

Beall EL, Manak JR, Zhou S, Bell M, Lipsick JS, Botchan MR. 2002. Rolefor a Drosophila Myb-containing protein complex in site-specificDNA replication. Nature 420:833–837.

Beall EL, Bell M, Georlette D, Botchan MR. 2004. Dm-myb mutantlethality in Drosophila is dependent upon mip130: positive andnegative regulation of DNA replication. Genes Dev 18:1667–1680.

Davidson CJ, Tirouvanziam R, Herzenberg LA, Lipsick JS. 2005. Func-tional evolution of the vertebrate Myb gene family: B-Myb, but nei-ther A-Myb nor c-Myb, complements Drosophila Myb in hemo-cytes. Genetics 169:215–229.

Dymecki SM. 1996. Flp recombinase promotes site-specific DNArecombination in embryonic stem cells and transgenic mice. ProcNatl Acad Sci U S A 93:6191–6196.

Table 2Oligonucleotides Used in Diagnostic PCR

Primer (strand) Sequence Detection of Product size (bp)

P1 (U) TACTACTTAGAGAGACTGCC 50loxP 300 (wt)P2 (L) TCCTGGTAGTGTAACTCATC 340 (loxP)P3 (U) TAATAAAGGAGTGTCTCAGA 30loxP 360 (wt)P4 (L) TACATGGTACAAGTAGGCA 410 (loxP)P5 (U) GACGAGCAGTTGAGGGC

Deletion of neoR310 (wt)

P6 (L) CGTACGTAAACTAGTCAGG 350 (neoD)P1 (U) TACTACTTAGAGAGACTGCC Deletion of floxed sequence 240P7 (L) CTCTTTAGACAGGCCATTCFlp (U) GGTCCAACTGCAGCCCAA Flp recombinase 500Flp (L) TGGATCGATCCTACCCCTTCre (U) TCGATGCAACGAGTGATGAG

Cre recombinase 500Cre (L) TTCGGCTATACGTAACAGGGP3 (U) TAATAAAGGAGTGTCTCAGA 30loxP 143P8 (L) CTCTTTAGACAGGCCATTIntron 1 (U) GGAATTCGTTGTCTCATGG Internal control for deletion 530Intron 1 (L) CGGGGCTCTGGGATTAGTA

194 GARCIA ET AL.

Emambokus NR, Vegiopoulos A, Harman B, Jenkinson EJ, Anderson G,Frampton J. 2003. Progression through key stages of the hemato-poietic hierarchy is dependent on distinct threshold levels ofc-Myb. EMBO J 22:4478–4488.

Fung SM, Ramsay G, Katzen AL. 2002. Mutations in Drosophila myblead to centrosome amplification and genomic instability. Develop-ment 129:347–359.

Golay J, Capucci A, Arsura M, Castellano M, Rizzo V, Introna M. 1991.Expression of c-myb and B-myb, but not A-myb, correlates withproliferation in human hematopoietic cells. Blood 77:149–158.

Hofmann CS, Sullivan CP, Jiang HY, Stone PJ, Toselli P, Reis ED, Cheresh-nev I, Schreiber BM, Sonenshein GE. 2004. B-Myb represses vascu-lar smooth muscle cell collagen gene expression and inhibits neo-intima formation after arterial injury. Arterioscler Thromb VascBiol 24:1608–1613.

Hogan B, Beddington R, Constantini F, Lacey E. 1994. Manipulating themouse embryo: A laboratory manual. Cold Spring Harbor, NY:Cold Spring Harbor Laboratory Press.

Iwai N, Kitajima K, Sakai K, Kimura T, Nakano T. 2001. Alteration ofcell adhesion and cell cycle properties of ES cells by an inducibledominant interfering Myb mutant. Oncogene 20:1425–1434.

Jasinski M, Keller P, Fujiwara Y, Orkin SH, Bessler M. 2001. GATA1-Cremediates Piga gene inactivation in the erythroid/megakaryocyticlineage and leads to circulating red cells with a partial deficiencyin glycosyl phosphatidylinositol-linked proteins (paroxysmal noc-turnal hemoglobinuria type II cells). Blood 98:2248–2255.

Kuhn R, Schwenk F, Aguet M, Rajewsky K. 1995. Inducible gene target-ing in mice. Science 269:1427–1429.

Lam EW,Watson RJ. 1993. An E2F-binding site mediates cell-cycle regulatedrepression of mouse B-myb transcription. EMBO J 12:2705–2713.

Lam EW, Morris JD, Davies R, Crook T, Watson RJ, Vousden KH. 1994.HPV16 E7 oncoprotein deregulates B-myb expression: correlationwith targeting of p107/E2F complexes. EMBO J 13:871–878.

Lam EW, Bennett JD, Watson RJ. 1995. Cell-cycle regulation of humanB-myb transcription. Gene 160:277–281.

Lane S, Farlie P, Watson R. 1997. B-Myb function can be markedlyenhanced by cyclin A-dependent kinase and protein truncation.Oncogene 14:2445–2453.

Lang G, Gombert WM, Gould HJ. 2005. A transcriptional regulatory ele-ment in the coding sequence of the human Bcl-2 gene. Immunol-ogy 114:25–36.

Lewis PW, Beall EL, Fleischer TC, Georlette D, Link AJ, Botchan MR.2004. Identification of a Drosophila Myb-E2F2/RBF transcriptionalrepressor complex. Genes Dev 18:2929–2940.

Lin D, Fiscella M, O’Connor PM, Jackman J, Chen M, Luo LL, Sala A,Travali S, Appella E, Mercer WE. 1994. Constitutive expression ofB-myb can bypass p53-induced Waf1/Cip1-mediated G1 arrest.Proc Natl Acad Sci U S A 91:10079–10083.

Okada M, Akimaru H, Hou DX, Takahashi T, Ishii S. 2002. Myb controlsG(2)/M progression by inducing cyclin B expression in the Droso-phila eye imaginal disc. EMBO J 21:675–684.

Raschella G, Negroni A, Sala A, Pucci S, Romeo A, Calabretta B. 1995.Requirement of b-myb function for survival and differentiativepotential of human neuroblastoma cells. J Biol Chem 270:8540–8545.

Reiss K, Travali S, Calabretta B, Baserga R. 1991. Growth regulatedexpression of B-myb in fibroblasts and hematopoietic cells. J CellPhysiol 148:338–343.

Sala A, Calabretta B. 1992. Regulation of BALB/c 3T3 fibroblast prolifer-ation by B-myb is accompanied by selective activation of cdc2 andcyclin D1 expression. Proc Natl Acad Sci U S A 89:10415–10419.

Sala A, Watson R. 1999. B-Myb protein in cellular proliferation, tran-scription control, and cancer: latest developments. J Cell Physiol179:245–250.

Saville MK, Watson RJ. 1998. B-Myb: a key regulator of the cell cycle.Adv Cancer Res 72:109–140.

Tanaka Y, Patestos NP, Maekawa T, Ishii S. 1999. B-myb is required forinner cell mass formation at an early stage of development. J BiolChem 274:28067–28070.

Tybulewicz VL, Crawford CE, Jackson PK, Bronson RT, Mulligan RC.1991. Neonatal lethality and lymphopenia in mice with a homozy-gous disruption of the c-abl proto-oncogene. Cell 65:1153–1163.

Ziebold U, Bartsch O, Marais R, Ferrari S, Klempnauer KH. 1997. Phos-phorylation and activation of B-Myb by cyclin A-Cdk2. Curr Biol7:253–260.

195CONDITIONAL ALLELE OF THE B-myb GENE