Gene Technology - 2020 06 - DNA Sequencing 1szilagyl.web.elte.hu/Gene Technology-2020/PDF/06... ·...

Gene Technology - 2020 106 - DNA Sequencing

Peptide sequencingEdman degradation: Edman, P. et al.; (1950). "Method for determination

of the amino acid sequence in peptides". Acta Chem. Scand. 4: 283–293.

sequential labeling and cleavage of N-terminal residue withoutdisrupting peptide bond between other a.a. residues

Gene Technology - 2020 06 - DNA Sequencing 2

procedure can then be repeated again to identify the next amino acidstep-by step yield 90-95 %problems with long streches ofidentical a.a.-smaximum length: 30-50 a.a.

This approach is not suitable forsequencing nucleic acids

https://doi.org/10.3891/acta.chem.scand.04-0283

Peptide sequencer


First generation DNA sequencing

• 3’ or 5’ P32 labeled template, strand separation

• partial, specific modification of bases,

G dimethylsulfate (N7-methylation)

Pu formic acid

Py hydrazin

C hydrazin + NaCl

cleavage of phosphodiester bond at modified bases: hot piperidin

separation of fragments by PAGE

• SV40 (5243 bp)

4Gene Technology - 2020 06 - DNA Sequencing

Does not requries previous sequence information!!!

Maxam & Gilbert method


ENZYMATIC (dideoxy) METHODFrederick Sanger 13 August 1918 – 19 November 2013 1951-52 determination of amino acid sequence of insulin

Nobel Prize in chemistry 1958: for his work on the structure of proteins, especially that of insulin

1977 DNA sequencingNobel Prize in chemistry 1980: Walter Gilbert and Sanger shared

half of the chemistry prize "for their contributions concerning the determination of base sequences in nucleic acids"


ENZYMATIC (dideoxy) METHOD

template + primer + DNA polymerase + dNTP/ddNTP ( 1 %)template: single or double stranded DNA, PCR product labeling: primer (5’, [-32P]ATP)

during polymerization ([-35S]dATP)Enzyme: Sequenase (T 7 pol), Taq pol (processivity is important)polymerization: 4 parallel reactions (four ddNTPs)electrophoresis: denaturing PAGE (3 kV, 7M urea, 70 °C)

the product is double strandedoriginal template strand interferes separation

autoradiographymanual evaluation



„Manual” sequencing


Automated fluorescent sequencing

based on enzymatic method

labeling: primer or dNTP

ddNTP 4 different colors: BigDye

polymerization: cyclic sequencing

(linear template amplification)

1 primer, AmpliTaq polymerase

electrophoresis: capillary electrophoresis

synthetic polymer gel (400-700 bases)

online detection (laser)

automatic digital read-out (free software: Chromas)

ABI Prism 310, 373, 377 (PE Biosystems)

integrated sequencing systems (10 kb-1 Mb/day)


Automated fluorescent sequencing


14CHROMASGene Technology - 2020 06 - DNA Sequencing

Whole genome sequencing

• Chromosome walking / primer walking

• Requires cloning long, contiguous DNA Gene Technology - 2020 1506 - DNA Sequencing

By Commins, J., Toft, C., Fares, M. A. - "Computational Biology Methods and Their Application to the Comparative Genomics of Endocellular Symbiotic Bacteria of Insects." Biol. Procedures Online (2009).

Whole genome shotgun sequencing


Assembly of the reads


By Commins, J., Toft, C., Fares, M. A. - "Computational Biology Methods and Their Application to the Comparative Genomics of Endocellular Symbiotic Bacteria of Insects." Biol. Procedures Online (2009).

Hierachical shotgun sequencing


By Becchamm - Own work, CC BY-SA 3.0, https://commons.wikimedia.org/w/index.php?curid=17509620

Assemblig the tiling pathend-reads: short sequences at the 5’ and 3’ ends of a DNA fragment

which are unique enough that they (theoretically) exist together only once in a genome

contig: a continuous sequence of DNA assembled from overlappingframents

scaffold:

tiling path:


Next generation sequencing


22

Margulies2005-454 Supplement


http://szilagyl.web.elte.hu/SH-2020/Classical%20papers/margulies2005-454.pdfhttp://szilagyl.web.elte.hu/SH-2020/Classical%20papers/Supplement%20for%20454.pdf

Steps of the sequencing process• Generation of DNA fragments (nebulizer)

fragment size range: 50-900 bp (mean: 325 bp) fragments blunt-ended and phosphorylated (polishing)T4 DNA polymerase, E. coli DNA polymerase (Klenow fragment),T4 polynucleotide kinase

• Ligation of adapters – binding to beads and sequencing oligogeneration single strands with different sequences at the endsone end allows annealing to complementary oligos immobilized on beadsother end binds sequencing oligo

• Emulsion PCR for amplification on the beads

• Sequencing by synthesis in picoliter volume well

• Lumimetric detection of pyrophosphate release


24

• DNA Capture Beads

• N-hydroxysuccinimide ester (NHS)-activated

Sepharose HP

• (5’-Amine-hexa-ethyleneglycol spacers

CCATCTGTTGCGTGCGTGTC-3’)

• hybridization at limiting dilution (A seq.)

only ONE copy of DNA/bead

• Amplification in emulsion (ePCR)

• 0.625 µM forward (complemenary to B)

(5’ - CGTTTCCCCTGTGTGCCTTG-3’)

• 0.039 µM reverse (complemenary to A)

(5’-CCATCTGTTGCGTGCGTGTC-3’)

• „asymmertic” PCR – reverse oligo bound to beads!

ONE MILLION copies/bead

Ligation of different adapters to the ends of fragment

A: CCATCTGTTGCTGCGTGTCCCATCTGTTCCCTCCCTGTCTCAG

B: /5BioTEG/CCTTTCCCCTGTGTGCCTTGCCTATCCCCTGTTGCGTGTCTCAG


Avidin / Streptavidin

Steps of the sequencing process• Generation of DNA fragments (nebulizer)

fragment size range: 50-900 bp (mean: 325 bp)

fragments blunt-ended and phosphorylated (polishing) T4 DNA polymerase, E. coli DNA polymerase (Klenow fragment) T4 polynucleotide kinase

• Ligation of adapters – binding to beads and sequencing oligogeneration single strands with different sequences at the endsone end allows annealing to complementary oligos immobilized on beads

other end binds sequencing oligo

• Emulsion PCR for amplification on the beads

• Sequencing by synthesis in picoliter volume well

• Lumimetric detection of pyrophosphate release


Emulsion PCR• Amplification mix contains

– dNTP, buffer, forward and reverse primer

– Hi-Fi Taq polymerase, thermostable pyrophosphatase

– 1.5 M DNA capture beads – containing single template chain

• Formation of water in oil emulsion

• PCR reaction: amplification 40 cycle

• Breakage of the emulsion

• Second-strand removal, enrichment of beads


Preparation for sequencing

• 44 mm in diameter

• 55 mm in depth

• 75 pl

• 480 wells/mm2

• 1.6 million wells

27

DNA capture beads (25 mm) containingannealed sequencing primer + Bst DNA Polymerase Large Fragment + SSB protein

Dynal enzyme beadsUltraGlow Luciferase and Bst ATP sulfurylasewere prepared as biotin carboxyl carrier protein (BCCP) fusions


PicoTiterPlate

Pyrosequencing• Bases (TACG) are flown sequentially and always in the same

order (100 times for a large FLX run) across the PicoTiterPlateduring a sequencing run

• An incorporated nucleotide complementary to the template strand generates pyrophosphate.

• A coupled enzyme reaction transforms PPi to ATP

• Firefly luciferase is a light-emitting enzyme catalyses the oxidation of firefly luciferin, requiring oxygen and ATP.

• The light signal is recorded by the CCD camera

• The signal strength is proportional to the number of nucleotide incorporated


Principle of pyrosequencing


Apyrase added after each cycle

dATP is also a substrate for luciferase

Adventages of Roche 454

• long read lengths (700 bp)

• fast operation

• high accuracy

Disadvantages of Roche 454

• error rate increases with theincrease of the length ofpolybase

• high cost

• low throughput

• low scalability


production discontinued in October 2016

Life Technologies - Ion torrentsequencing

32

Ion torrent


../Videos/Ion Torrent next-gen sequencing technology - YouTube.mp4

Life Technologies - Ion torrentsequencing

• Sample preparation similar to 454 – based on PCR amplification

• Sequencing by synthesis – sequential additon of dNTP-s

• detection of released H+ - CMOS transformed into miniaturepH meter

33

Ion torrent


../Videos/Ion Torrent next-gen sequencing technology - YouTube.mp4

Sequencing by ligation – AppliedBiosystems


Sequencing by ligation – Applied BiosystemsLigation of adapter sequences

Hybridization to beads

Emulsion PCR

Remove empty beads

Beads are attached to glass plate


Sequencing by ligationComponents of the sequencing reactions1. Template (PCR amplified on the beads)

2. Primers complementary to P1

3. 8 nt long probes with dye at 5’ end

4. Ligase

Structure of the probes (16 altogether)

Color coding of 16 probes


Steps in sequencing by ligation

1. Primer binds to templatestrands

2. Probe hybridization and ligation

3. Fluorescence measurement

4. Dye end (3) nucleotidescleaved (phosphorothioate; silver or mercury salt)

5. Steps 1-4 repeated 6+ times

6. The synthesized strandswashed away

Process completed 5 times, each time newprimer - offset by -1 base


Sequencing by ligation

After 5 ligation cycle we have information on every 5th base!

Repeat the process 4 times, with primers offset by 1 base:


Data analysis

We know that the last base of P1 adapter is TThe first base of probe ligated in the 2nd roud (n-1) must be complementary to T = A

The first read of probe n-1 is orange

If first base A and color is orange: second base of the probe is G

The first base of the template is C

A base and a color define the next base in the sequence!SoLiD


../Videos/SOLiD DNA Sequencing.mp4

Pacific Biosciences - SMRT



• Single molecule real time sequencing

• Phospholinked fluorescent nucleotides – polymerase cleavesoff label

• Zero Mode Waveguide – nanophotonic visualization chamber– illuminated volume 20 zeptoliter (10-21)

• single polymerase molecule bound to the bottom ofthechamber - real time sequence reading

• Possibility to detect methylated bases

42

SMRT


../Videos/Single Molecule Real Time Sequencing - Pacific Biosciences - YouTube.mp4

Epigenetic analysis by SMRT


Helicos - tSMS


Helicos - tSMS• True single molecule sequencing – no PCR amplification

• Immobilized oligoT on chip

• polyA tailing of fragmented (~100 -200 base) DNA – last A fluorescent

• Polymerization using virtual terminator nucleotides

• Paralell reading billions ofsequences

• One day – 1000 $ genome

• Bankruptcy in 2012


• Q1 pyrophosphatase???

• A1

• Q2 how to get rid of empty beads?

• A2

• DROPLET DIGITAL PCR VIRTUAL SYMPOSIUM, 5 NOVEMBER 2020

• Live from 11:00-17:00 CETBio-Rad’s Droplet Digital PCR System provides ultrasensitive and absolutenucleic acid quantification. This breakthrough technology is particularlyuseful for low-abundance targets, targets in complex backgrounds, allelicvariants (SNPs), and for monitoring subtle changes in target levels thatcannot be detected with real-time PCR.

• https://bio-rad.vfairs.com/en/#droplet-digital


https://bio-rad.vfairs.com/en/

Illumina sequencing

Illumina


../Videos/Illumina Sequencing by Synthesis (Now in 3D).mp4

Illumina sequencing

Ligation of different adaptors to endsof DNA fragments (150-200 bp)

Attachment to flowcell

Bridge amplification

Cluster formation

Sequencing with virtualterminator nucleotides

In one cycle 4 bases are addedtogether

After each cycle detection at4 channels

Illumina


../Videos/Illumina Sequencing by Synthesis (Now in 3D).mp4

Base reading in Illumina sequencer


4-channel base detection

Simplified base detection

• Rather than a separate dye for each base, 2-channel SBS uses a mix of dyes. Images are taken of each DNA cluster using red and green wavelength filter bands

• Clusters seen in red or green images are interpreted as C and T bases, respectively. Clusters observed in both red and green images are flagged as A bases (appearing as yellow clusters), while unlabeled clusters are identified as G bases.


Illumina


Oxford Nanopore Technologies

Nanopore Sequencing


Introduction to nanopore sensing

A nanopore: a nano-scale hole.

• Biological: a pore-forming protein (e.g. α-Hemolysin) in a membrane (e.g. lipid bilayer)

• Solid-state: in synthetic materials ( e.g. silicon nitride or graphene)

• Hybrid: formed by a pore-forming protein set in synthetic material


Nanopore sensing

•Disruption in current detected when analyte passes through the pore or near its aperture.

•Characteristic disruption indentifies the molecule in question.

Ionic current passed through membrane by setting a voltage across the membrane.


Nanopore DNA sequencing

• Strand sequencing:

– Sequencing in real-time as the intact DNA polymer passes through the nanopore.

• Exonuclease sequencing:

– Individual nucleotides pass through the nanoporeby the aid of processive exonuclease.

Oxford


../Videos/Movies - News - Oxford Nanopore Technologies.mp4

Oxford Nanopore


Strand Sequencing

Snapshot from movie at http://www.nanoporetech.comGene Technology - 2020 5906 - DNA Sequencing

Electron-based read out

Four different magnitudes of disruption which can be classified as C, G, A or T

Modified base, e.g. methylatedcytosine, can be directly distinguished from the four standard bases


Strand Sequencing

Snapshot from movie at http://www.nanoporetech.com

▪ Hairpin structure:

▪Sense and anti-sense sequencing

▪Advantages in Data Analysis


Exonuclease Sequencing

Snapshot from movie at http://www.nanoporetech.comGene Technology - 2020 6206 - DNA Sequencing

Exonuclease Sequencing

Snapshot from movie at http://www.nanoporetech.com

▪ Adapter molecule (cyclodextrin):

• Accuracy averaging 99.8%

• Identification of meC


Peptide sequencingEdman degradation: Edman, P. et al.; (1950). "Method for determination

of the amino acid sequence in peptides". Acta Chem. Scand. 4: 283–293.

sequential labeling and cleavage of N-terminal residue withoutdisrupting peptide bond between other a.a. residues


procedure can then be repeated again to identify the next amino acidstep-by step yield 90-95 %problems with long streches ofidentical a.a.-smaximum length: 30-50 a.a.

This approach is not suitable forsequencing nucleic acids

https://doi.org/10.3891/acta.chem.scand.04-0283

Working strategy

• GridION system

– Uses single-use, self-contained cartridge.

– Can be used as a single instrument: Node

– Can be used in a cluster, connected through network.

– Low power and space required.


Working strategy

• MinION: a miniaturised sensing instrument

– Portable.

– Field-deployable.

– Requires minimal sample prep.

– Compatible with blood serum, plasma and whole blood.

MinION


../Videos/MinION_ A Portable, Real-Time DNA_RNA Sequencing Device.mp4

Workflow versatility

• No fixed run time

– Can be run one or more nodes for minutes or days.

– Data analysis takes place in real time.

– Longer run enables collecting more data points.

• Run until... sufficient data

– The GridION system enables users to run an experiment until sufficient data has been collected to reach a predetermined experimental endpoint.


Advantages over present sequencing technologies

• No need for expensive and time-consuming mate pair library construction.

• Real-time sequencing strategy.

• No strand amplification needed.

• No bias due to sequencing amplification.

• Low cost: trying to fulfil the target of $1000 per human genome.

• Lager read size: read size is limited only by preparation.

• No requirement for large amounts of high-performance disk storage.

• Large-scale structural variation can be detected at lower depth of coverage.

• Enable long-range haplotyping.


Single cell sequencing


Gene Technology - 2020 06 - DNA Sequencing 1szilagyl.web.elte.hu/Gene Technology-2020/PDF/06... ·...

Documents

Transcript of Gene Technology - 2020 06 - DNA Sequencing 1szilagyl.web.elte.hu/Gene Technology-2020/PDF/06... ·...