Gene expression pattern Identification of maverick, a novel...
Transcript of Gene expression pattern Identification of maverick, a novel...
Gene expression pattern
Identi®cation of maverick, a novel member of the TGF-b superfamilyin Drosophila
Minh Nguyen, Louise Parker, Kavita Arora*
Department of Developmental and Cell Biology, University of California, Irvine, CA 92697, USA
Received 21 December 1999; received in revised form 17 March 2000; accepted 21 March 2000
Abstract
The transforming growth factor-b (TGF-b) superfamily of structurally related ligands regulates essential signaling pathways that control
many aspects of cell behavior in organisms across the phylogenetic spectrum. Here we report the identi®cation of maverick (mav), a gene that
encodes a new member of the TGF-b superfamily in Drosophila. Phylogenetic analysis and sequence comparison suggest that Mav cannot be
easily assigned to any one sub-family, since it is equally related to BMP, activin and TGF-b ligands. mav maps to the fourth chromosome and
is expressed throughout development. In situ hybridization experiments reveal the presence of maternally derived mav transcript in
precellular blastoderm embryos. Later in development, mav is expressed in a dynamic pattern in the developing gut, both in endodermal
and visceral mesodermal cells. In adult females, high levels of mav mRNA are present in late stage egg chambers. q 2000 Elsevier Science
Ireland Ltd. All rights reserved.
Keywords: Drosophila; Transforming growth factor-b; Bone morphogenetic proteins; Activin
1. Results and discussion
Based on sequence similarity the TGF-b superfamily can
be subdivided into three main groups: the prototypical TGF-
bs, activins and bone morphogenetic proteins (BMPs). Until
recently the only representatives of the TGF-b superfamily
in Drosophila were the BMP-related ligands, Decapentaple-
gic (Dpp), Screw (Scw) and Glass bottom boat (Gbb;
Padgett et al., 1987; Wharton et al., 1991; Doctor et al.,
1992; Arora et al., 1994). Genetic and functional studies
have established that these ligands are involved in critical
developmental events such as patterning of the body axes
and determination of cell fates, as well as regulation of cell
proliferation and apoptosis (Raftery and Sutherland, 1999).
More recently, an activin B ortholog and Myoglianin, a
ligand related to GDF8-Myostatin, were identi®ed in Droso-
phila, but the biological roles of these ligands are not known
(Kutty et al., 1998; Lo and Frasch, 1999). In this study we
report the identi®cation and expression pattern of Maverick
(Mav), a new BMP/TGF-b related ligand in Drosophila.
A BLAST search of the Berkeley Drosophila Genome
Project (BDGP) EST database for sequences sharing simi-
larity to the carboxyl-terminal ligand domain of Scw iden-
ti®ed two uncharacterized clones, CK00014 and CK00025,
that contained the same 1.3 kb insert (Fig. 1A). Sequence
analysis of CK00014 revealed that it encodes a 378 amino
acid peptide with signi®cant similarity to members of the
TGF-b superfamily. We have named this protein Maverick
(Mav). An approximately 1.1 kb PCR ampli®ed genomic
fragment corresponding to the open reading frame of
CK00014 was used to screen a lgt10 cDNA library derived
from imaginal discs. This resulted in the isolation of a 1.7 kb
mav cDNA, designated 6A1. Sequence analysis revealed
that 6A1 extends 440 nucleotides further 5 0 than
CK00014. BLAST searches with the entire 1.7 kb sequence
identi®ed six additional cDNA clones that originate 5 0 to
6A1, as well as a 17.6 kb genomic clone (AC014858)
containing the mav locus (Fig. 1A). The longest EST clones
LD13618 and LD22618 contain a common 2.7 kb insert.
Comparison of cDNA sequences with the genomic sequence
indicated that the mav locus encodes at least two alterna-
tively spliced transcripts. The transcript corresponding to
cDNAs LD22618, LD13618 and LD46352 is obtained by
splicing out a 108 nucleotide intron (Fig. 1A). In the alter-
natively spliced variant represented by 6A1, an additional
49 nucleotide intron is removed. Both introns are ¯anked by
consensus splice donor and acceptor sites, suggesting that
they represent authentic introns. Northern blot analysis of
adult male and female mRNAs detected an approximately
2.8 kb band (data not shown), suggesting that the cDNA
Mechanisms of Development 95 (2000) 201±206
0925-4773/00/$ - see front matter q 2000 Elsevier Science Ireland Ltd. All rights reserved.
PII: S0925-4773(00)00338-5
www.elsevier.com/locate/modo
* Corresponding author. Tel.: 11-949-824-1087; fax: 11-949-824-4709.
E-mail address: [email protected] (K. Arora).
clones LD13618, LD22618 are close to full length, assum-
ing the presence of a 50±100 nucleotide poly(A)1 tail.
Primer extension analysis using RNA from adult females
supports this assertion, since we detected a prominent tran-
scription start site 18 nucleotides upstream of the ®rst
nucleotide of LD13618 (Fig. 1B). The presence of a single
band on the Northern blot suggests that the alternatively
spliced mav transcripts may be of similar length, or that
the transcript corresponding to 6A1 is of low abundance.
In situ hybridization indicates that mav is located on the
fourth chromosome. Cross-hybridization to a cosmid contig
generated by the Canadian Drosophila Genome Project
allowed a more precise localization of mav to the cytoge-
netic region 102C. Given that chromosome four contains
M. Nguyen et al. / Mechanisms of Development 95 (2000) 201±206202
only 2% of the Drosophila euchromatin, it is striking that
mav is the third member of the TGF-b superfamily to map to
the same region, the other two being myoglianin (102C) and
dActivin (102F; Kutty et al., 1998; Lo and Frasch, 1999).
The longest mav isoform (Mav1) encodes a putative
protein 701 amino acids in length (Fig. 1C). Hydropathy
analysis showed that the ®rst in-frame Methionine is
followed by a stretch of hydrophobic amino acids indicative
of a signal sequence. In isoform 2 represented by 6A1,
initiation of translation would occur at Met 269 and retain
the same reading frame, to yield a predicted protein of 433
amino acids (Fig. 1C). Mav2 lacks a signal sequence
suggesting that this form of the protein may not be secreted.
The consensus multibasic proteolytic cleavage site (RKDK
at residues 586-89 in Mav1), would generate a mature
ligand of 112 amino acids (MassagueÂ, 1998).
Sequence comparisons and phylogenetic analysis of the
ligand domain of Mav suggests that this protein cannot be easily
assigned to either the TGF-b, the BMP or the activin subfami-
lies (Fig. 2). Mav shows the highest sequence conservation with
the BMP related ligands, human BMP3 (32% identity), human
GDF10 (31% identity), and mouse Nodal (29% identity). Inter-
estingly, Mav is only slightly less related to human TGF-b2 and
Activin A (28 and 23% identity respectively). Among the
Drosophila ligands, Mav shares the highest sequence identity
with Myoglianin (28%), and the BMPs, Dpp and Gbb (27%),
followed by Scw (21%). Mav is only 19% identical to dActivin.
Given that phylogenetic analysis places Mav in a cluster of
BMP ligands, it is interesting that the putative Mav ligand
domain contains nine invariant cysteine residues that are typical
of TGF-b and activin ligands (see Fig. 1C; Daopin et al., 1992;
Schlunegger and GruÈtter, 1992). One possible interpretation is
that Mav is part of an emerging group of BMP-like ligands that
contain nine cysteines, such as mammalian GDF8, GDF11 and
GDF15, as well as C. elegans Daf-7 (Ren et al., 1996). Further
investigations of Mav function may help in de®nitively assign-
ing it to a particular subfamily of ligands.
To gain an insight into the role of mav, we determined the
temporal and spatial distribution of the transcript (Fig. 3).
mav is expressed throughout embryonic and larval develop-
ment and persists until adulthood, as determined by RT-
PCR analysis (Fig. 3A). In situ hybridization showed that
mav mRNA is uniformly distributed throughout the embryo
at early syncitial blastoderm (stages 1±4), suggesting that it
is maternally contributed (Fig. 3B). Staining is also
observed in the pole cells. In post-cellular blastoderm
embryos at stage 5, mav mRNA is expressed ubiquitously
(Fig. 3C). During gastrulation (stages 6±8) and germ band
elongation (stages 9±11), mav transcripts can be detected at
low levels throughout the embryo. In addition, mav shows a
dynamic pattern of expression in both germ layers forming
the gut. mav mRNA is ®rst observed in the endoderm at late
stage 9 and early stage 10 in the hindgut and posterior
midgut primordia (Fig. 3D). Stage 11 embryos show stain-
ing in the foregut and anterior midgut primordia, as well as
in the developing posterior midgut and hindgut (Fig. 3E).
However by stage 12, mav message is restricted to a small
subset of cells in the hindgut and a section of the foregut
which eventually becomes part of the pharynx/esophagus
(Fig. 3G). In stage 13 and 14, after germ band retraction,
the visceral mesoderm that surrounds the anterior and
posterior midgut endoderm, expresses mav at high levels
(Fig. 3H). Expression in the gut persists throughout late
embryogenesis, albeit at lower levels (Fig. 3I). In addition
to the gut, mav transcripts are also detected in discrete
segmental patches of cells that are most obvious at stage
11 (Fig. 3F). This staining appears to be restricted to the
dorso-lateral epidermal region. Finally, high levels of mav
mRNA are seen during late stages of oogenesis. In stage 10
egg chambers mav is expressed in the nurse cells and subse-
quently found uniformly distributed in the oocyte (Fig. 3J).
The distribution of mav transcript overlaps signi®cantly
with the expression patterns of the type II receptor Punt,
and the receptor regulated Smad, dSmad2 (Childs et al.,
1993; Letsou et al., 1995; Brummel et al., 1999), raising
the possibility that they are involved in Mav signaling.
In conclusion, we have identi®ed a novel member of the
TGF-b superfamily in Drosophila. Phylogenetic analysis and
sequence comparison precludes the assignment of Mav to a
speci®c subfamily. Thus, Mav may be an orphan molecule or
the prototypic member of a new subfamily of ligands.
2. Materials and methods
2.1. Cloning and sequencing of mav cDNA
Primers QK3 (5 0CCTACTACGTGGCGAA3 0) and QK4
(5 0AGAATAATTCGTTAGAGAAAG3 0), ¯anking the ORF
of the EST CK00014 were used to amplify a genomic DNA
M. Nguyen et al. / Mechanisms of Development 95 (2000) 201±206 203
Fig. 1. (A) Molecular organization of the mav genomic region and cDNAs. A restriction map of the region containing the mav locus is shown. (C, ClaI; E,
EcoRI; H, HindIII; P, PstI). The locations of primers used are marked. The cDNAs analyzed in this study are shown to scale. The closed boxes denote an ORF,
while the stippled regions represent 5 0 and 3 0 untranslated regions. Two alternatively spliced transcripts derive from the mav locus. cDNAs LD13618, LD22618
and LD46352 correspond to a transcript that contains a single 108 nucleotide intron and encodes a protein of 701 residues. An alternatively spliced transcript,
represented by 6A1, contains an additional 49 nucleotide intron and results in a protein of 433 amino acids. (B) Primer extension analysis using the mavPE
primer detects a transcriptional start site (marked with an arrow), 18 nucleotides upstream of the start of the LD13618 cDNA. The ®rst four lanes on the left
indicate a DNA sequencing ladder using the same primer. (C) Sequence of the near full-length mav cDNA and deduced amino acid sequence (Genbank
accession no. AF252386). The ®rst methionine of Mav 1 (Met 1) and the hydrophobic stretch of amino acid residues following it are underlined. The
proteolytic site (RKDK, residues 586±589) is boxed and the nine invariant cysteines are encircled. The ®rst in-frame ATG of the isoform Mav 2 (Met 269) is
highlighted in gray. The 49 nucleotides comprising the alternatively spliced intron are underlined. A potential poly adenylation signal and a poly(A)1 addition
site are in bold letters.
fragment for cDNA library screens. Clone 6A1 as well as two
shorter clones were obtained from 200 000 plaques screened.
cDNA clones LD22618, LD13618 and LD46352, were
obtained from Genome Systems. The entire mav cDNA
sequence was derived from sequencing cDNAs 6A1 and
CK00014 in their entirety, and the 5 0 sequence of LD13618
past the region of overlap with 6A1. All 5 cDNAs have iden-
tical 3 0 ends although they differed in the length of the
poly(A)1 tail. Restriction mapping and sequencing of PCR
ampli®ed DNA was used to con®rm that LD22618,
LD13618 and LD46352, contain sequences corresponding to
the ®rst intron.
2.2. Primer extension analysis
Primer extension analysis was performed as described in
Stathakis et al. (1999) using the primer mavPE
(5 0GATCACAGTTCCTCGAAAATGTG3 0) located 68
nucleotides from the 5 0 end of LD13618.
M. Nguyen et al. / Mechanisms of Development 95 (2000) 201±206204
Fig. 2. (A) Amino acid sequence alignment of Mav. The ligand domains of Mav, human BMP3 (Genbank accession no. 115072), human GDF10 (Genbank
accession no. 1705471), human TGF-b2 (Genbank accession no. 557563), and human Activin A (Genbank accession no. 124279) were compared using the
Clustal program. Identical residues are boxed in black. Residues in gray represent similarities. (B) The dendogram illustrates the phylogenetic relationships
among the ligand domains of proteins in the TGF-b superfamily. The % amino acid identity between Mav and other ligands is listed. The accession numbers
for the ligands are as follows: BMP2 (115068), BMP4 (1070540), Dpp (118409), BMP10 (3873291), BMP9 (5932438), GDF5 (631181), BMP5 (115075),
BMP6 (115076), BMP7 (115078), BMP8 (461635), Gbb (283697), Scw (600163), GDF1 (4503967), Vg1 (137969), BMP3 (115072), GDF10 (4826740),
Nodal (423520), ActivinA (124279), ActivinB (106726), ActivinC (5031795), dActivin (AF054822), GDF11 (5031613), GDF8 (2623582), Myoglianin
(AF132814), TGFb1 (224622), TGFb4 (2501178), TGFb2 (557563), TGFb3 (339552), GDF15 (6753968), Daf7 (1684866), MIS (127109), GDNF (729567).
2.3. RT-PCR analysis
Poly(A)1 RNA was isolated from yw ¯ies using
RNAeasy columns and the oligotex mRNA Midi Kit
(Qiagen), and cDNA prepared with the First Strand cDNA
Synthesis Kit (Amersham Pharmacia Biotech). The Mav
speci®c primers QK3 and QK4 ampli®ed a 1068 bp frag-
ment present in both alternatively spliced forms, and were
used to detect overall levels of mav expression. Primers
PACAI1 (5 0CCAGGGATTTGCGTGCAACTGCTGGT-
GCTATTC3 0) and PACAT2 (5 0ATTTGAAAGGGC-
TCCAACGGCTGCTCCTACACG3 0) ¯anking an intron in
M. Nguyen et al. / Mechanisms of Development 95 (2000) 201±206 205
Fig. 3. (A) RT-PCR analysis demonstrates that mav transcript is expressed throughout development as well as in adults. The top panel shows mav expression
while the bottom panel detects the expression of the a-catenin control. RNA samples corresponding to different stages of development are marked. (B±J)
Spatial and temporal distribution of mav transcript. Lateral views of embryos are shown, oriented anterior to the left, except where noted. (B) Pre-cellular
blastoderm embryo showing maternal contribution of mav. Staining can also be seen in the pole cells. (C) Stage 5 embryo showing uniform distribution of mav
at cellular blastoderm stage. (D) Low levels of zygotic expression are seen throughout a stage 9 embryo, while the hindgut and posterior midgut primordia
express mav at higher levels. (E) In a stage 11 embryo mav is expressed in the foregut and anterior midgut primordia, in addition to the posterior and hindgut
primordia. (F) A segmental-repeat pattern of epidermal expression can be seen in a late stage 11 embryo. (G) At stage 12 the gut speci®c expression is restricted
to a subset of cells in the foregut and hindgut. Epidermal cells continue to express mav in a segmental pattern. (H) Dorsal view of a stage 13 embryo showing
expression in the visceral mesoderm and in the epidermis. (I) In a stage 17 embryo staining is limited to the larval gut. (J) A stage 10 ovariole showing high
levels of expression in the nurse cells and uniform transcript distribution in the oocyte.
a-catenin (Genbank accession no. D13964) were used both
as a positive control and to rule out genomic DNA contam-
ination.
2.4. In situ hybridization
Embryos and ovaries were collected from yw ¯ies. DIG-
labeled SP6 sense and T7 anti-sense riboprobes were gener-
ated from Mav cDNA clone 6A1. In situ hybridization was
performed as described in Tautz and Pfei¯e (1989), except
that hybridization was carried out at 558C for 60 h, followed
by 6£12 h washes in hybridization buffer, also at 558C.
Embryos and ovarioles were mounted in canada balsam/
methyl salicylate (GMM) for observation and photography.
In situ hybridization to salivary gland chromosomes was
carried out using standard protocols.
Acknowledgements
We would like to thank the Canadian Drosophila Genome
Project for help with mapping the mav gene to the fourth
chromosome contig. We are grateful to Dean Stathakis and
Rahul Warrior for their thoughtful contributions to the work
presented in this manuscript. This research was supported
by an NIH-RO1 grant to K.A. (GM55442) and a Searle
Scholar Award from the Kinship Foundation.
References
Arora, K., Levine, M., O'Connor, M., 1994. The screw gene encodes a
ubiquitously expressed member of the TGF-b family required for speci-
®cation of dorsal cell fates in the Drosophila embryo. Genes Dev. 8,
2588±2601.
Brummel, T., Abdollah, S., Haerry, T.E., Shimell, M.J., Merriam, J.,
Raftery, L., Wrana, J.L., O'Connor, M.B., 1999. The Drosophila activin
receptor Baboon signals through dSmad2 and controls cell proliferation
but not patterning during larval development. Genes Dev. 13, 98±111.
Childs, S.R., Wrana, J.L., Arora, K., Attisano, L., O'Connor, M.B., Massa-
gueÂ, J., 1993. Identi®cation of a Drosophila activin receptor. Proc. Natl.
Acad. Sci. USA 90, 9475±9479.
Daopin, S., Piez, K.A., Ogawa, Y., Davies, D.R., 1992. Crystal structure of
transforming growth factor-b2: an unusual fold for the superfamily.
Science 257, 369±373.
Doctor, J.S., Jackson, P.D., Raksha, K.E., Visalli, M., Hoffmann, F.M.,
1992. Sequence, biochemical characterization, and developmental
expression of a new member of the TGF-b superfamily in Drosophila
melanogaster. Dev. Biol. 151, 491±505.
Kutty, G., Kutty, R.K., Samuel, W., Duncan, T., Jaworski, C., Wiggert, B.,
1998. Identi®cation of a new member of transforming growth factor b
superfamily in Drosophila: the ®rst invertebrate activin gene. Biochem.
Biophys. Res. Commun. 246, 644±649.
Letsou, A., Arora, K., Wrana, J.L., Simin, K., Twombly, V., Jamal, J.,
Staehling-Hampton, K., Hoffman, F.M., Gelbart, W.M., Massague, J.,
O'Connor, M.B., 1995. Dpp signaling in Drosophila is mediated by the
punt gene product: a dual ligand binding type II receptor of the TGF-b
receptor family. Cell 80, 899±908.
Lo, P.C.H., Frasch, M., 1999. Sequence and expression of myoglianin, a novel
Drosophila gene of the TGFb superfamily. Mech. Dev. 86, 171±175.
MassagueÂ, J., 1998. TGFb signal transduction. Annu. Rev. Biochem. 67,
753±791.
Padgett, R.W., St. Johnston, R.D., Gelbart, W.M., 1987. A transcript from a
Drosophila pattern gene predicts a protein homologous to the trans-
forming growth factor-(beta) family. Nature 325, 81±84.
Raftery, L.A., Sutherland, D.J., 1999. TGFb family signal transduction in
Drosophila development: from Mad to Smads. Dev. Biol. 210, 251±
268.
Ren, P., Lim, C., Johnsen, R., Albert, P.S., Pilgrim, D., Riddle, D.L., 1996.
Control of C. elegans larval development by neuronal expression of a
TGFb homolog. Science 274, 1389±1391.
Schlunegger, M.P., GruÈtter, M.G., 1992. An unusual feature revealed by the
crystal structure at 2.2 AÊ resolution of human transforming growth
factor-b2. Nature 358, 430±434.
Stathakis, D.G., Udar, N., Sandgren, O., Andreasson, S., Bryant, P.J.,
Small, K., Forsman-Semb, K., 1999. Genomic organization of human
DLG4, the gene encoding post synaptic density 95. J. Neurochem. 73,
2250±2265.
Tautz, D., Pfei¯e, C., 1989. A non-radioactive in situ hybridization method
for the localization of speci®c RNAs in Drosophila embryos reveals
translational control of the segmentation gene hunchback. Chromosoma
98, 81±85.
Wharton, K.A., Thomsen, G.H., Gelbart, W.M., 1991. Drosophila 60A
gene, a new TGF-b family member is closely related to human bone
morphogenetic proteins. Proc. Natl. Acad. Sci. USA 88, 9214±9218.
M. Nguyen et al. / Mechanisms of Development 95 (2000) 201±206206