Biology of Human TumorsSee related commentary by Welsh et al., p. 6230

Galectin-1 Mediates Radiation-Related Lymphopenia andAttenuates NSCLC Radiation Response

Peiwen Kuo1, Scott V. Bratman1, David B. Shultz1, Rie von Eyben1, Cato Chan1, Ziwei Wang2, Carmen Say1,Aparna Gupta1, Bill W. Loo Jr1, Amato J. Giaccia1, Albert C. Koong1, Maximilian Diehn1, and Quynh-Thu Le1

AbstractPurpose: Radiotherapy can result in lymphopenia, which has been linked to poorer survival. Here, we

test the hypothesis that radiotherapy-induced lymphopenia is mediated by a tumor-secreted factor,

Galectin-1 (Gal-1), which possesses T-cell proapoptotic activities.

Experimental Design: Matched Gal-1 wild-type (WT) or null mice were implanted with Lewis lung

carcinoma (LLC-1) that either expressed Gal-1 or had Gal-1 stably downregulated. Tumors were irradiated

locally and circulating Gal-1 and T cells weremeasured. Tumor growth, lungmetastasis, intratumoral T-cell

apoptosis, and microvessel density count were quantified. Thiodigalactoside (TDG), a Gal-1 inhibitor, was

used to inhibit Gal-1 function in another group of mice to validate the observations noted with Gal-1

downregulation. Lymphocyte counts, survival, and plasma Gal-1 were analyzed in cohorts of radiotherapy-

treated lung [non–small cell lung cancer (NSCLC)] and head and neck cancer patients.

Results: LLC irradiation increased Gal-1 secretion and decreased circulating T cells in mice, regardless

of host Gal-1 expression. Inhibition of tumor Gal-1 with either shRNA or thiodigalactoside ablated

radiotherapy-induced lymphopenia. Irradiated shGal-1 tumors showed significantly less intratumoral

CD8þ T-cell apoptosis and microvessel density, which led to marked tumor growth delay and reduced

lungmetastasis compared with controls. Similar observations were made after thiodigalactoside treatment.

Radiotherapy-induced lymphopenia was associated with poorer overall survival in patients with NSCLC

treatedwith hypofractionated radiotherapy. PlasmaGal-1 increasedwhereas T-cell decreased after radiation

in another group of patients.

Conclusions: Radiotherapy-related systemic lymphopenia appeared to be mediated by radiotherapy-

induced tumor Gal-1 secretion that could lead to tumor progression through intratumoral immune

suppression and enhanced angiogenesis. Clin Cancer Res; 20(21); 5558–69. �2014 AACR.

IntroductionRadiotherapy-related lymphopenia is a persistent occur-

rence that has been frequently observedwith radiotherapy todifferent sites, including brain, thorax, abdomen, and pelvis(1–5). More importantly, radiotherapy-induced lymphope-nia has been shown to be a negative prognostic factor invarious cancers, including high-grade glioma, sarcomas, andcarcinomas of the lung, colon, breast, and pancreas (1–4).The causes of radiotherapy-induced lymphopenia and itsassociation with poor prognosis are largely unknown.

Galectin-1 is the prototype member of the Galectinsuperfamily, characterized by high-affinity binding tob-galactosides through a well-conserved carbohydrate rec-ognition domain (CRD). In cancer, Gal-1 also plays acritical role in altering the fate and phenotype of T cells tosuppress their antitumor functions and create an immune-privileged tumor microenvironment, which are well docu-mented in melanoma, lymphoma, lung, and breast cancersyngeneic models (7–10). Importantly, tumor rejectionmediated by Gal-1 inhibition requires intact CD4þ andCD8þ T-cell immunity (7). We have previously shown thatGal-1 promotes tumor growth and metastasis, in part,through intratumoral T-cell modulation. Notably, tumor-derived Gal-1, as opposed to host, drives disease progres-sion throughmediating the apoptosis of CD4þ and CD8þ Tcells within the tumor, stymieing antitumor immunity (9).

We hypothesized that Gal-1 may be a mediator ofradiotherapy-induced lymphopenia and its poor progno-sis. Using a syngeneic mouse tumor model, we show thattumor irradiation increases plasma Gal-1 and inducessignificant depletion of circulating T lymphocytes in atumor-specific Gal-1 manner. This function was disrupted

1Department of Radiation Oncology, Stanford University School of Med-icine, Stanford, California. 2University of California, San Diego School ofMedicine, La Jolla, California.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

Corresponding Author: Quynh-Thu Le, Stanford University, 875 BlakeWilbur Drive, Room CCG228 MC 5847, Stanford, CA 94305-5847. Phone:650-498-5032; Fax: 650-725-8231; E-mail: qle@stanford.edu

doi: 10.1158/1078-0432.CCR-14-1138

�2014 American Association for Cancer Research.

ClinicalCancer

Research

Clin Cancer Res; 20(21) November 1, 20145558

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

by Gal-1 knockdown or thiodigalactoside. Gal-1 secretionfrom the tumor was associated with large tumor growthand development of spontaneous pulmonary metastasis.Tumor irradiation resulted in a small delay in tumorregrowth but no impact on lung metastasis, whichimproved significantly with either Gal-1 downregulationor inhibition. This was associated with more infiltratingintratumoral CD8þ T cells, less intratumoral CD4þ andCD8þ T-cell apoptosis, and lower microvessel density.Clinically, we noted that lymphopenia occurred in acohort of early-stage non–small cell lung cancer (NSCLC)patients treated with small-field, hypofractionated radio-therapy alone, and that a large decrease in lymphocyteswas associated with reduced survival. Finally, circulatingGal-1 increased while T lymphocytes dropped in associ-ation with radiation in patients with head and neckcancer (HNC). These data suggest that tumor Gal-1 secre-tion is a driver of radiotherapy-related lymphopenia andtargeting Gal-1 is a novel and intriguing approach towardimproving radiotherapy response in NSCLC.

Materials and MethodsCell lines and generation of stable Gal-1 knockdownLewis lung carcinoma (LLC-1) was obtained from the

American Type Culture Collection (ATCC). LKR13 murinelung adenocarcinoma cell line derived from KrasLA1 mice(11) was a generous gift from Alejandro Sweet-Cordero(Department of Pediatrics, Stanford University Schoolof Medicine, Stanford, California). Cells were culturedin DMEM (LLC-1) or RPMI (LKR13) with 10% fetal calfserum, penicillin (100 U/mL), and streptomycin (0.1 mg/mL) at 37�C and 5% CO2 in air. Cell lines were not

independently validated in our laboratory. To generatestable Gal-1 knockdowns, LLC-1 and LKR13 cells weresubject to lentivirus transduction with scrambled or Gal-1 pLKo.1 shRNAs, CCTAAGGTTAAGTCGCCCTC GCTCG-AGCGAGG GCGACTTAACCTTAGG or CCGGCCTACA-CTTCAATCCTCGCTTCTCGAGAAGCGAGGATTGAAGTG-TAGGTTTTT (Thermo Scientific Open Biosystems) as pre-viously described (9).

Western blottingLysates were probed with goat anti-Gal-1 primary

(1:1,000; R&D Systems), secondary anti-goat-horseradishperoxidase (HRP; 1:10,000; Zymed), mouse anti-b-actinprimary (1:1,000; Sigma-Aldrich), and anti-mouse-HRPsecondary (1:10,000; Invitrogen) antibodies. SecretedGal-1 in serum-freemedia was collected fromLLC-1, LKR13Scr, and shGal-1 cells, concentrated (EMD Millipore), andthereafter volumes were normalized by cell number.

Mice and tumor modelsC57BL/6 mice were obtained from The Jackson Labo-

ratory and bred with Lgals1-null (Gal-1�/�) mice fromthe Consortium for Functional Glycomics (ScrippsResearch Institute, La Jolla, CA) to generate wild-type(WT) littermates (9). Genotyping by PCR WT forwardprimer: GACCCCATCCCTACACCCCAG; Gal-1-null for-ward primer: CTATCAGGACATAGCGTTGG; and com-mon antisense primer: AAACTTCAGCCGGGAGAAAGG(9). WT and Gal-1�/� mice (8–10-weeks old) receivedsubcutaneous inoculation of LLC scramble or shGal-1cells (2 � 105) on the flank. Once tumors reachedapproximately 150 mm3, mice were placed in lead shield-ing jigs and exposed tumors received 20 Gy irradiationusing a 250 kVp orthovoltage therapeutic X-ray machine(Philips). Tumors were caliper measured and volume wascalculated as [(width)2 � length]/2.

Thiodigalactoside treatmentThiodigalactoside was injected intratumorally in mice

(120 mg/kg) 1 week before radiation and every 2 to 3 daysthereafter.

Isolation of splenocyte and whole blood T cellsSplenocytes were isolated from spleen of 8- to 10-week-

oldC57BL/6WT andGal-1�/�mice. After filtration and redblood cell lysis (Sigma), splenocytes underwent densitycentrifugation (Cedarlane) and resuspension at 1 to 2 �106 cells/mL in RPMI containing 5 mg/mL concanavalin A(Sigma), 55 mmol/L betamercaptoethanol (Gibco), anddithiolthreitol (1.1 mmol/L). Peripheral blood from ret-ro-orbital eye blood was collected in EDTA tubes and RBCswere lysed (Sigma-Aldrich).

In vitro T-cell apoptosis and TUNEL stainingLymphocytes were plated at 1 to 2� 106 cells/mL for 24

hours followed by treatment with rGal-1 (10 mg/mL;Sigma) for 24 to 48 hours. TUNEL (terminal deoxynu-cleotidyltransferase–mediated dUTP nick end labeling)-

Translational RelevanceOur identification of Gal-1 as a modulator of radia-

tion-related systemic lymphopenia provides an excitingnew path in cancer therapy with Gal-1 as a target tocombine with radiation treatment. Radiation-relatedlymphopenia is frequently observed with fractionatedexternal beam radiotherapy and is associated withreduced survival. In particular, patients receiving radio-therapy for non–small cell lung cancer (NSCLC) didsignificantly worse than their matched counterparts ifthey exhibited lymphopenia. Targeting the mechanismsunderlying this phenomenon, currently elusive, couldimprove curability. This is the first study to not onlyshow that radiation enhances Gal-1 secretion inNSCLC,but also that a tumor-secreted factor can significantlyinfluence the level of circulating T lymphocyte aftertumor irradiation while augmenting tumor growth andmetastasis. Our results suggest that combining Gal-1blockade with radiotherapy can enhance radiation effec-tiveness in NSCLC through the prevention of radiation-related lymphopenia and immune suppression withinthe tumor microenvironment.

Galectin-1 and Radiation-Related Lymphopenia

www.aacrjournals.org Clin Cancer Res; 20(21) November 1, 2014 5559

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

FITC staining was performed using the Apo-Direct Kit(BD Biosciences).

Flow cytometryLymphocyte subsets were stained with Pacific Blue anti-

mouse CD3e rat IgG (clone 500A2), PE anti-mouse CD4 ratIgG (clone RM4–5), and Alexa Fluor-647 anti-mouse CD8arat IgG (clone 53–6.7), at 4�C for 45 minutes in stainingbuffer (BD Biosciences). Cell acquisition was performedwith the FACSDiva software on a LSRII flow cytometer (BDBiosciences) and analyzed with FlowJo software (TreeStarInc.).

ImmunohistochemistryLung metastasis was quantified by H&E staining (13).

Two sections 100 mm apart were used for metastasis quan-tification, with at least 5mice per group. Fixed sections werestainedwith goat anti-CD31 (1:100, cloneM-20; SantaCruzBiotechnology Inc.) followed by secondary anti-goat detec-tion by DAB (Vector Laboratories; ref. 9).

ImmunofluorescenceFrozen tissue sections were incubatedwith CD4 andCD8

primary (1:100; BD Biosciences) and Alexa Fluor-594 anti-rat secondary antibodies (1:200; Invitrogen; ref. 12). Slideswere labeled with TUNEL-FITC (Roche Applied Science)and mounted in DAPI (Vector Laboratories). Immunoflu-orescence images were acquired using a Zeiss LSM510 laserscanning confocalmicroscope, using 40x/0.95NA and 63x/1.4 NA Plan Apochromat objectives.

Galectin-1 ELISAWhole blood from retro-orbital bloods were collected in

BD Microtainer tubes with EDTA and centrifuged at 3,000rpm for 10 minutes. Plasma was diluted and subject tomouseGalectin-1 ELISA per themanufacturer’s instructions(R&D Systems).

Patient populationPatients with early-stage NSCLC included in our analysis

were diagnosed between 1999 and 2013 with inoperabledisease, received only SABR (no chemotherapy), and hadpre- and postradiation lymphocyte values up to 38 monthsafter treatment. Patients with HNC in our study were diag-nosed between 2007 and 2013 and received radiation withcetuximab or cisplatin. Because some patients had multiplepostradiation lymphocyte counts, we calculated the maxi-mum lymphocyte change as difference between the pre-radiotherapy value and the lowest postradiotherapy value.

Statistical analysisPatient survival analysis was performed using Cox pro-

portional hazards model with the maximum drop in abso-lute lymphocyte counts between before and after radiother-apy as the only predictor. Four quartiles of the maximumdrop in absolute lymphocyte counts before and after radio-therapy were plotted for the indicated endpoints. Overallsurvival (OS)was defined as the time from treatment date to

death. Distant progression-free survival (DPFS)was definedas the time from treatment to documented first distantrelapse or death, local progression-free survival (LPFS) asthe time from treatment to documented first local relapse ordeath, and regional progression-free survival (RPFS) as thetime from treatment to documented first regional nodalrelapse or death. In all other cases, quantifications weresubject to two-tailed, unpaired Student t test to analyzestatistical differences between groups. Data are expressed asmean � SE. A P value of <0.05 was considered significant.

ResultsGal-1’s secretion is enhanced by radiation and inducesT-cell apoptosis in vitro

Gal-1 secretion increased significantly after radiotherapyin several different tumor cell lines, including two murineNSCLC cell lines. This increase of Gal-1 secretion was notedas early as 3 hours in LLC-1. Intracellular level of Gal-1 didnot change, suggesting that the bulk of newly synthesizedGal-1 proteins were secreted after radiotherapy (Fig. 1A).Similar to others (7, 9, 10), we found that rGal-1 inducedapoptosis of concanavalin A–activated lymphocytes isolat-ed from mouse spleen in a dose-dependent manner (Fig.1B). This effect was abrogated by a Gal-1–specific antibody(anti-Gal1) or thiodigalactoside, a Gal-1 competitive inhib-itor (Fig. 1C)whenT cellswere exposed toGal-1–containingconditioned media. In addition to T lymphocytes, rGal-1can also cause apoptosis in CD19þ B cells (assessed byTUNEL) though to a lesser extent (data not shown). Gal-1 isexpressed inmemory B cells and has been shown to regulateapoptosis through Bcl2 signaling (14).

Tumor-secreted Gal-1 reduces circulating helper andcytotoxic T cells after tumor irradiation

On the basis that radiation enhances the secretion of Gal-1, which has proapoptotic function in T cells, we evaluatedthe role of Gal-1 in radiotherapy-related lymphopenia. Toaddress this, we examined the levels of circulatingGal-1 andT lymphocytes in the following four host and LLC-1 tumorcombinations to differentiate between host and tumor Gal-1 contribution to radiation-related lymphopenia: WT/Scr(both host- and tumor-expressed Gal-1), WT/shGal-1 (onlyhost-expressed Gal-1), Gal-1�/�/Scr (only tumor-expressedGal-1), and Gal-1�/�/shGal-1 (neither host- nor tumor-expressedGal-1).Once tumors reached a volumeof approx-imately 150 mm3, 20 Gy of radiation was delivered in asingle fraction at the tumor site (Supplementary Fig. S1).

Local tumor irradiation significantly increased the level ofcirculating Gal-1 only in Gal-1–expressing tumors (�1.5 inWT host and �2.9 Gal-1�/� host) but not in Gal-1 down-regulated tumors (Fig. 2A). These data indicated that radio-therapy increased Gal-1 secretion from the tumor that couldbe measured in the plasma. In parallel to the increase ofplasmaGal-1, therewas a significant decrease in circulating Tcells in WT mice bearing Gal-1–secreting tumors (WT/Scr),32.9% (P¼ 0.026) for CD3þmature T cells and 31.7% (P¼0.033) for CD3þ8þ cytotoxic T cells, 2 weeks after tumorirradiation. There was also a decrease in CD4þ T helper cells

Kuo et al.

Clin Cancer Res; 20(21) November 1, 2014 Clinical Cancer Research5560

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

but the reduction did not reach statistical significance(28.2%; P ¼ 0.09; Fig. 2B–D). In contrast, CD4þ andCD8þ T lymphocyte levels did not decrease significantlyafter irradiationof shGal-1 tumors implanted inGal-1WTorGal-1�/� mice (WT/shGal-1 and Gal-1�/�/shGal-1). Fur-thermore, we observed a significant decrease in the CD3þ

and CD8þ T cells (29.4%, P ¼ 0.02 and 34.4%, P ¼ 0.02,respectively) but not CD4þ T cells (12.9%; P¼ 0.48) in Gal-1�/� mice bearing Gal-1–secreting tumors (Gal�/�/Scr),suggesting that radiotherapy-related lymphopenia occurredindependently of host Gal-1 status (Fig. 2B–D).To ensure that the noted effect was due to Gal-1 secretion

from radiotherapy rather than from Gal-1 secretion fromgrowing tumors during the 2 weeks of observation, we alsoanalyzed circulating T cells inWTmice, implantedwithGal-1–secreting tumors that were not irradiated and allowed togrow for 2 weeks after reaching approximately 150 mm3.Without tumor irradiation, therewas a small decrease in thelevel of circulating CD3þ, CD4þ, and CD8þ T cells (18.1%,18.05%, and 6.60%, respectively) but none of the changesreached statistical significance (Fig. 2E). Similarly, day 28terminal blood frommice in Fig. 2E showed a 2-fold higherplasma Gal-1 level in the irradiated group compared with

the non-irradiated mice, despite larger tumors in the non-irradiated group, suggesting that radiotherapy induced Gal-1 secretion into the blood (Fig. 2F). These data suggestedthat Gal-1–containing tumors did release a low basal levelof Gal-1 into the blood that caused a small drop in circu-lating lymphocytes, and that this effect was significantlyaugmented by tumor irradiation.

We also evaluated the effect of Gal-1 secretion on com-mon lymphoid progenitors or nesting mature T cells in thebone marrow. There was no change in these cell popula-tions with radiation and there was no change in Gal-1expression on the surface of these cells (Supplementary Fig.S2). To ensure that there was no difference in inherentsensitivity to radiation or rGal-1 between lymphocytes fromWT and Gal-1�/� mice, we also tested these effects in vitro;no difference was noted between the two T-cell populations(Supplementary Fig. S3).

To corroborate our previous findings with the shGal-1inhibition, we also evaluated the effect of inhibiting Gal-1pharmacologically with the competitive inhibitor, thiodi-galactoside (Fig. 2G). Thiodigalactoside is a naturally occur-ring thioglycoside that is highly stable in vivo, and binds tothe CRD of Gal-1, thereby preventing ligand interactions.

Figure 1. Gal-1 is induced byradiation and mediates T-cellapoptosis in vitro. A, immunoblotsshowing intracellular and secretedGal-1 in LLC-1 and LKR13 mouseNSCLC cell lines at the indicatedtime points before and afterexposure to ionizing radiation(6 Gy). Mean � SE are shown foreach condition performed intriplicate. B, apoptosis oflymphocytes after treatment withrecombinant Gal-1. Thepercentage of TUNEL-FITC–positive, apoptotic lymphocytesafter treatment with 500 ng/mL,5 mg/mL, and 10 mg/mLrecombinant Gal-1 for 48 hours isshown. C, the percentage ofapoptotic T lymphocytes afterculturing for 48 hours in LLC-1scramble conditioned medium inRPMI (1:2 ratio; �1.2 ng/mL Gal-1)with IgG (10 mg/mL), anti-Gal-1antibody (10 mg/mL), orthiodigalactoside (100 mmol/L).Representative histograms at left.Mean � SE are graphed (N ¼ 3).Experiments were performed atleast twice with similar results.�, P < 0.05.

Galectin-1 and Radiation-Related Lymphopenia

www.aacrjournals.org Clin Cancer Res; 20(21) November 1, 2014 5561

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

Kuo et al.

Clin Cancer Res; 20(21) November 1, 2014 Clinical Cancer Research5562

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

We performed intratumoral thiodigalactoside injections inGal-1 WT mice implanted with LLC-1 scramble tumors toinhibit Gal-1 and examined changes in the abundance ofcirculating CD3þ, CD4þ, and CD8þ lymphocytes beforeand after tumor irradiation. Thiodigalactoside treatmentbefore radiotherapy resulted in a small, nonsignificantincrease of total, CD4þ, and CD8þ T cells, suggesting thatbasal Gal-1 release from the tumor caused some circulatingT-cell death, and this was blocked by thiodigalactosideinjection. More importantly, radiation resulted in a signif-icant drop of circulating CD3þ (51.2%; P ¼ 0.006), CD4þ

(42.2%; P ¼ 0.005), and CD8þ (43.5%; P ¼ 0.008) lym-phocytes, which was rescued with thiodigalactoside treat-ment. Altogether, our data suggest that Gal-1 was secretedinto the blood by the tumor after radiation, resulting inlymphopenia that could be abrogated by Gal-1 inhibition.

Gal-1modulates tumor radiation response through themodulation of tumor T-cell apoptosis andangiogenesisIn light of our observation that Gal-1mediates radiother-

apy-related lymphopenia, which is associated with worseoutcomes in the clinic, we hypothesized that Gal-1 reducedtumor response to radiotherapy and enhanced tumormetastasis and that these effects could be minimized withGal-1 downregulation or inhibition. In vitro, Gal-1 down-regulation in LKR-13 lung cancer cellsmoderately enhancedradiation cell killing under either normoxia or severe hyp-oxia, as assessed by clonogenic survival curves (Supplemen-tary Fig. S4A and S4B). To investigate Gal-1 effect on tumorradiosensitivity in vivo, we implanted LLC-1 scramble andshGal-1 tumors in Gal-1 WT C57Bl/6 mice and irradiatedthe tumors with 20Gy in a single fraction, after allowing thetumors to reach a volume of approximately 150 mm3.Tumor growth was monitored and upon sacrifice, lungmetastases, intratumoral T-cell infiltration, and apoptosis,as well as, microvessel density count, were quantified. Asexpected, either downregulation of Gal-1 alone or radiationalone resulted in similar decreases in tumor growth(Fig. 3A). However, the combination of radiation andGal-1 downregulation nearly abolished tumor growth(mean, 1.16� 0.97 fold volume increase when normalizedto tumor volume on day of irradiation) during the 2 weeksof observation (P¼ 0.02; Fig. 3A). This observationwas alsomade with LKR13 tumors in vivo (Supplementary Fig. S4C).Radiation alone did not affect the number of spontaneouslung metastasis (Fig. 3B). Downregulation of Gal-1 signif-icantly decreased the number of lungmetastases, whichwas

further reducedwith the addition of local field radiotherapy(P < 0.05).

Similar results for tumor growth were observed when weinhibited Gal-1 with intratumoral thiodigalactoside injec-tion. Thiodigalactoside injection alone or radiation alonereduced tumor growth to a similar extent and the combi-nation of radiation and thiodigalactoside yielded the slow-est growth rate (P¼ 0.05; Fig. 3C). Again, tumor irradiationalone did not reduce lung metastases compared with thenonirradiated control (Fig. 3D). Intratumoral thiodigalac-toside injection resulted in a nonsignificant reduction in thenumber of lung metastasis. However, the combination ofthiodigalactoside and radiation resulted in a significantdecrease in lungmetastases (�40%) comparedwith control(P ¼ 0.037).

Mechanistically, downregulation of Gal-1 increasedCD8þ but not CD4þ T-cell tumor infiltration (Fig. 4A andB). Gal-1 depletion combined with radiation increasedtumor infiltration by CD8þ T cells even further (Fig. 4B).Notably, Gal-1 knockdown reduced apoptosis of bothintratumoral CD4þ and CD8þ T-cell subsets (Fig. 4C andD). Gal-1 inhibition by knockdown and thiodigalactosidealso reduced tumor angiogenesis, which was further atten-uated when combined with radiation (Fig. 4E and F).

Radiotherapy-related lymphopenia is associated withreduced survival in early-stage NSCLC treated withhypofractionated radiotherapy

The study cohort consisted of 20 patients with stage I–IINSCLC treated definitively with small-field hypofractio-nated stereotactic ablative radiotherapy alone. Supplemen-tary Table S1 summarizes the patient characteristics. Themajority of patients, 15 out of 20 (75%), experienced a dropin absolute lymphocyte count during the first year and themean maximum decrease for the entire group was 0.4 �0.22 � 103/mL. Figure 5A shows the mean absolute lym-phocyte counts before (pre-SABR) and after SABR (post-SABR), when the counts were at their lowest within the firstyear. The decrease was statistically significant (P ¼ 0.025).Univariate Cox proportional hazards analysis showed thatthe degree of drop in absolute lymphocyte count (split byquartile) was associated with worse OS (P ¼ 0.037; HR,1.148; Fig. 5B), disease-free survival (DFS; P ¼ 0.033; HR,1.134; Fig. 5C), DPFS (P ¼ 0.023; HR, 1.159; Supplemen-tary Fig. S5A), and LPFS (P ¼ 0.049; HR, 1.129; Supple-mentary Fig. S5B). It was also associated with a trend forworse RPFS (P ¼ 0.056; HR, 1.126; Supplementary Fig.S5C). These findings revealed that radiotherapy-related

Figure 2. Tumor-secreted Gal-1 facilitates radiation-related T lymphopenia. Four different host/tumormouse groups, WT/Scr, WT/shGal-1, Gal-1�/�/Scr, andGal-1�/�/shGal-1 and twodifferent timepoints [before radiation (Pre IR) and2weeksafter radiation (Post-IR)] wereused in experiments presented inFig. 3A–D.A, ELISA quantification of plasma Gal-1 for each host/tumor group before and after radiotherapy (N ¼ 5 to 6 mice/group). The percentage of circulatingtotal mature T cells (CD3þ; B), T helper cells (CD3þ CD4þ; C), and cytotoxic T cells (CD3þ CD8þ; D) for each group before and after radiotherapy(N ¼ 6 to 7 mice/group). E, terminal circulating CD3þ, CD4þ, and CD8þ T cells in WT/Scr mice with or without tumor irradiation, showing that radiotherapyis important in causing a decrease in T lymphocytes (N ¼ 5 mice/group). F, terminal plasma Gal-1 ELISA from the mice in E. Inhibition of Gal-1 bythiodigalactoside (TDG) attenuates radiation-related T lymphopenia. G, percentage of CD3þ, CD3þCD4þ, and CD3þCD8þ circulating T cells in mice treatedwith intratumoral thiodigalactoside (120 mg/kg) or PBS vehicle injections before and after 20 Gy tumor radiation is graphed (N ¼ 5 to 6 mice/group).Data represent the mean � SE; �, P < 0.05.

Galectin-1 and Radiation-Related Lymphopenia

www.aacrjournals.org Clin Cancer Res; 20(21) November 1, 2014 5563

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

lymphopenia also occurred in SABR using very small fieldsin one to four fractions and was prognostic for tumorcontrol and survival in early-stage NSCLC.

Because plasma samples from these 20 patients withNSCLC were not available for Gal-1 measurement, wemeasured circulating Gal-1 and T lymphocytes in a groupof patients with HNC treated with radiotherapy with eitherconcomitant cetuximab or cisplatin (N ¼ 24). Patientcharacteristics for this group are shown in SupplementaryTable S2. We observed a significant decrease in lymphocytecount (0.88 � 0.18 � 103/mL; P < 0.001) and increase inplasma Gal-1 (5.89 � 4.3 ng/mL; P ¼ 0.05) after treatment(Fig. 5D and E). The degree of radiotherapy-induced lym-phopenia was not significantly different between HNCtreated with radiotherapy combinedwith cisplatin or cetux-imab (Supplementary Fig. S5D). To date, we only notedthree failures in the patients with HNC with a medianfollow-up of 11.2 months; such few number of eventsprecludes accurate survival time analysis. However, therewas a trend for larger lymphocyte drop (1.2 vs. 0.8 � 103

/mL) and a higher rise in Gal-1 level (14.1 vs. 4.7 ng/mL) in

patients who failed compared with those who did not,although the difference did not reach statistical significancedue to the small number of patients (SupplementaryFig. S5E).

Our findings indicate that in addition to proangiogenicfunction, Gal-1–mediated intratumoral T-cell apoptosisand peripheral T-cell depletion, which increase after radi-ation, facilitate radiation resistance and poor prognosiswith SABR-treated NSCLC. Figure 6 summarizes our pro-posed mechanism.

DiscussionRadiation, which is major treatment modality for solid

tumors, is a modulator of the antitumor immuneresponse; yet, its stimulatory activity can be counteractedby radiotherapy-induced lymphopenia, which is associ-ated with worse treatment response. In this study, weidentified Gal-1 as a mediator of radiotherapy-drivenlymphopenia and attenuator of tumor radiation response.Targeting Gal-1 prevents intratumoral and systemic

Figure 3. Gal-1 mediates tumor radiation response in vitro and in vivo and promotes lung metastases. A, tumor growth curves for Gal-1 WT C57Bl/6 miceimplanted with scramble (Scr) or Gal-1 knockdown LLC-1 tumor cells (shGal-1) with and without radiation. Twenty Gy of ionizing radiation was delivered in asingle fraction (bolt). Tumor volumes were normalized to size on day of radiation (N ¼ 7 to 10 mice/group; P ¼ 0.02). B, spontaneous metastasesquantified from hematoxylin and eosin–stained lungs from mice in A (P < 0.05). Representative light microscopy images at right (�40 objective). C, tumorgrowth curves forGal-1WTmice implantedwith scramble LLC-1 and treatedwith intratumoral thiodigalactoside (TDG) or PBS injection on the days indicated.Irradiated mice receiving PBS (PBS IR) and thiodigalactoside (TDG IR) received a single dose of 20 Gy ionizing radiation at the indicated time (bolt).Tumor volumes normalized to size onday of radiation (N¼ 5mice/group;P¼ 0.05). D, lungmetastases ofmice fromC is shown (P¼0.037). Data represent themean � SE.

Kuo et al.

Clin Cancer Res; 20(21) November 1, 2014 Clinical Cancer Research5564

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

immunosuppression, supporting antitumor immune res-ponses after radiotherapy.The clinical impact of radiotherapy-induced lympho-

penia has only been systematically studied recently. Onepossible mechanism for radiotherapy-related lymphope-nia is direct irradiation of T lymphocytes as they enterradiation fields. The proportion of irradiated circulatinglymphocytes increased with greater fractions and slower

dose rates (16). On the other hand, direct irradiation-induced lymphocyte killing is unlikely responsible forlymphopenia observed in SABR-treated early-stageNSCLC. These patients receive hypofractionated therapy,which encompasses high dose delivered in a few fractions,limiting lymphocyte exposure to radiation as they circu-late through the small treatment fields. Instead, in SABR-treated early-stage NSCLC, alternative mechanisms such

Figure 4. Gal-1 induces intratumoral T-cell apoptosis and attenuates T-cell infiltration andmicrovessel formation. A, CD4þ T-cell infiltration of scr and shGal-1tumors, with or without radiation, quantified as counts per field of view (10 random fields at�200 magnification; scale bar, 100 mm, n¼ 5 tumors per group).B, CD8þ T-cell infiltration of scr and shGal-1 tumors, with or without radiation, quantified as counts per field of view (10 random fields at�200 magnification;scale bar, 100 mm; n ¼ 5 tumors per group; P < 0.05). C and D, percentage of TUNEL-positive CD4þ and CD8þ T cells within Scr and shGal-1 tumors,with or without radiation, is graphed and representative images are at right (scale bar, 50 mm; n ¼ 5 tumors per group; P ¼ 0.01. E, microvessel densitycounts of CD31-stained tumors of the indicated Gal-1 status/treatment combinations (N ¼ 5 tumors per group; P < 0.05). F, microvessel density counts ofCD31-stained tumors collected from PBS and thiodigalactoside (TDG)-treated mice, with and without radiation (N ¼ 5 mice per group; P < 0.05).Representative images are shown in the right. Data represent mean � SE. �, P < 0.05.

Galectin-1 and Radiation-Related Lymphopenia

www.aacrjournals.org Clin Cancer Res; 20(21) November 1, 2014 5565

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

as secreted cytokines (with Gal-1 being of such cytokines)may drive this phenomenon.

Radiation-related lymphopenia is also often persistent,extending frommonths toyears after radiotherapy (1–3,12).This cannot be explained by radiation destruction of thebonemarrowwhen treatment sites do not encompass activemarrow. The half-lives of CD4þ (87 days), CD8þ T cells (77days; ref. 17), and Gal-1 (20 hours; ref. 13) are not longenough to explain persistent lymphopenia exceeding a yearafter radiation(1,3,12).Our assessmentof thebonemarrowniche also revealed that radiotherapy-induced tumor Gal-1secretion did not affect common lymphoid progenitors ornesting mature T cells. Interestingly, a study conducted byEllsworth and colleagues revealed that in patients with high-

grade glioma treated with radiotherapy and temozolomide,patients with radiotherapy-related lymphopenia had lowerlevels of IL-7, a cytokine involved in T-cell homeostaticproliferation, and IL15, which is responsible for CD8þ T-cell survival. The reduction of these cytokines prevented acompensatory response to treatment-related lymphopenia,allowing the depletion of lymphocytes to endure (18). T-cellhomeostatic factors can therefore contribute to the persis-tence of this phenomenon.

Although we first noted that hypoxia increased Gal-1secretion, we also found that radiation exposure had thesame effect in multiple cell lines, suggesting that Gal-1secretion can be driven by different stressors (Supplemen-tary Fig. S6). Although upregulation of Gal-1 by radiation

Figure 5. Relationship between survival and the degree of radiation-mediated drop in lymphocytes counts in 20 patients with early-stage NSCLC treated withSABR. Mean [� 95% confidence interval (CI)] preradiation and post-SABR absolute lymphocyte counts are graphed for the entire group (P¼ 0.025). Survivalcurves based on Cox regression of OS (P ¼ 0.037; B) and DFS (P ¼ 0.033; C), stratified by the maximum drop in absolute lymphocyte counts beforeand after radiotherapy. Patients were split by quartiles. The OS HR of 1.148 and DFS HR of 1.134 indicate that at any specific time t, a patient with a0.1 unit increase in the maximum drop in absolute lymphocyte count before and after radiotherapy will have an increased risk of 14.8% of death or13.4% of experiencing progression or death. D, HNC plasma Gal-1 increase after treatment (radiotherapy combined with cisplatin or cetuximab) isgraphed (N ¼ 24; P ¼ 0.05). E, decrease in absolute lymphocytes after treatment in HNC is shown (N ¼ 24). Mean (�95% CI) is shown (P < 0.001).

Kuo et al.

Clin Cancer Res; 20(21) November 1, 2014 Clinical Cancer Research5566

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

has been observed in cultured cell lines by others (19–21),we are the first to show that localized tumor radiationresulted in ameasurable rise inplasmaGal-1 in vivo.Becausewe did not have plasma samples frompatients withNSCLC,we measured Gal-1 level in patients with HNC, who gen-erally have larger tumor volumes, hence potentially moredetectable change of Gal-1 with radiation. In addition, wehavepreviously shown thatHNCproducedGal-1 that couldbe detected in the tumor stroma (22). Indeed, we detected asignificant increase in plasma Gal-1 after radiation in thesepatients with a concomitant drop in T lymphocytes. There-fore, radiotherapy-induced secretion of Gal-1 can bedetected in both mouse and human plasma.Most notably, we found that Gal-1 drives radiotherapy-

induced depletion of circulating T cells. Gal-1 is also pro-duced by tumor-associated endothelial cells (21); however,our tumor model, which controls for host Gal-1 withGal1�/� mice, suggests that tumor Gal-1 alone is respon-sible for the drop in circulating T cells following radiother-apy.Gal-1–mediated T-cell suppression at the periphery hasbeen shown in other contexts, including themaintenance ofcentral T-cell tolerance (23). Here, we found that tumor-secreted Gal-1 also drives the depletion of peripheral T cellsafter radiotherapy.In lung cancer, Gal-1 expression is associated with

increased tumor size, nodal metastasis, and decreased sur-vival (24, 25). Gal-1 promotes distantmetastasis and down-regulation of Gal-1 substantially reduced the developmentof spontaneous lungmetastasis, an effect exclusive to immu-nocompetent hosts (9). In addition, Gal-1–positive lungmetastases showed more CD3þ T-cell apoptosis within themetastatic site (26). Although local field radiotherapycaused some shrinkage of the primary tumor, it did not

affect the number of lung metastasis, which could beexplained by radiotherapy stimulation of Gal-1 secretion.Interestingly, thiodigalactoside treatment alone inourmod-el did not significantly affect lung metastasis, contradictoryto Gal-1 genetic inhibition and is potentially due to the factthat thiodigalactoside is a less efficient inhibitor of Gal-1than shRNA and we used local rather than systemic thio-digalactoside administration-. When Ito and Ralph (26)used intravenous administration of thiodigalactoside in abreast cancer model, they showed that systemic thiodiga-lactoside treatment reduced lung metastasis. Here, com-bined thiodigalactoside and radiotherapy, however, signif-icantly reduced the number of lung metastasis by 40%,indicating that combining a Gal-1 inhibitor and radiationcan minimize both tumor growth and dissemination.

In this study, we provide evidence that tumors shedmoreGal-1 into the blood after radiotherapy, causing greatersystemic lymphopenia as a bystander phenomenon. Lesscirculating lymphocytes would result in fewer lymphocytesavailable to infiltrate the tumor, further suppressing theantitumor response, promoting more aggressive tumorgrowth and spread. This was supported by our observationthat Gal-1 depletion alone increased intratumoral CD8þ Tcells compared with scramble tumors (9, 27, 28) and thatcombined Gal-1 downregulation and radiation increasedtumor CD8þ T-cell infiltration even further.

A complex relationship exists between radiotherapy andthe immune system. Radiotherapy can enhance the antitu-mor immune response, acting indirectly on the tumorthrough the host immune system (29, 30). Radiotherapyincreases the peptide repertoire, enhancing cytokines andcomponents of the antigen presentation pathway to pro-mote recruitment and tumor lysis by CD8þ T cells (31–33).

Figure 6. Proposed mechanism for radiotherapy-induced Gal-1 secretion as a potential cause of the poor prognosis linked to radiotherapy-relatedlymphopenia. Radiation-related lymphopenia is associated with worse outcomes in patients with SABR-treated, early-stage NSCLC. This may be due totumor-associated Gal-1 upregulation by radiation, leading to lower circulating T cells, intratumoral T-cell viability, andmicrovessel formation, which facilitatetumor growth.

www.aacrjournals.org Clin Cancer Res; 20(21) November 1, 2014 5567

Galectin-1 and Radiation-Related Lymphopenia

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

Despite its immune-stimulating effects, radiotherapy doesnot result in protective immunity in the clinic becauserelapse occurs. Our observations support that Gal-1 worksin opposition of these cytokines, to disrupt accumulation offunctional intratumoral effector T cells locally and from theperiphery through radiotherapy-related immunosuppres-sion. Combined, these functions, andGal-1 involvement intumor immune surveillance, can explain for poor prognosisrelated to Gal-1–mediated systemic lymphopenia.

Our identification of Gal-1 as a modulator of radiation-related lymphopenia provides an exciting new path incancer immunotherapy with Gal-1 as a target to combinewith radiation treatment. It also provides a rapid biologicread out in the clinic to track the success of anti-Gal-1therapy. Future efforts devoted to improving radiotherapyrequire maximizing the antitumor immune response (34),and we are currently exploring Gal-1 immunomodulatoryeffects as they relate to immune checkpoint proteins andtumor immunity. Targeting theGal-1–N-Glycan interactionhas been shown to promote vascular normalization and T-cell recruitment to the tumor (35). This may be one of themechanisms by which Gal-1 modulate tumor aggres-siveness.Our continued investigation focuses on themolec-ular pathways involved in Gal-1 modulation of the tumormicroenvironment, including its effect on angiogenesis, toimprove the antitumor immune response with radiothera-py. Gal-1 blockade is currently achieved with neutralizingantibodies as well as peptide and synthetic small-moduleinhibitors (36–39). Altogether, our future work will focus

on the best way to inhibit Gal-1 function in combinationwith radiotherapy to improve curability in NSCLC.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: P. Kuo, A.J. Giaccia, A.C. Koong, M. Diehn, Q.-T. LeDevelopment of methodology: P. Kuo, Q.-T. LeAcquisitionofdata (provided animals, acquired andmanagedpatients,provided facilities, etc.): P. Kuo, S.V. Bratman, D.B. Shultz, C. Chan,Z. Wang, C. Say, B.W. Loo Jr, Q.-T. LeAnalysis and interpretation of data (e.g., statistical analysis, bio-statistics, computational analysis): P. Kuo, S.V. Bratman, R. von Eyben,A. Gupta, A.C. Koong, M. Diehn, Q.-T. LeWriting, review, and/or revision of the manuscript: P. Kuo, D.B. Shultz,B.W. Loo Jr, A.C. Koong, M. Diehn, Q.-T. LeAdministrative, technical, or material support (i.e., reporting or orga-nizing data, constructing databases): P. Kuo, Z. Wang, C. Say, A. Gupta,Q.-T. LeStudy supervision: A.C. Koong, Q.-T. Le

AcknowledgmentsThe authors thank Alejandro Sweet-Cordero for providing LKR13 cells

and mice.

Grant SupportThis work was supported by grants from the NIH (R01CA161585, 5P01

CA067166–15).The costs of publication of this article were defrayed in part by the

payment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received May 5, 2014; revised July 24, 2014; accepted August 11, 2014;published OnlineFirst September 4, 2014.

References1. Balmanoukian A, Ye X, Herman J, Laheru D, Grossman SA. The

association between treatment-related lymphopenia and survival innewly diagnosed patients with resected adenocarcinoma of the pan-creas. Cancer Invest 2012;30:571–6.

2. Grossman SA, Ye X, Lesser G, Sloan A, Carraway H, Desideri S, et al.Immunosuppression in patients with high-grade gliomas treated withradiation and temozolomide. Clin Cancer Res 2011;17:5473–80.

3. Campian JL, Ye X, Brock M, Grossman SA. Treatment-related lym-phopenia in patients with stage III non–small-cell lung cancer. CancerInvest 2013;31:183–8.

4. Campian J, Sarai G, Ye X, Marur S, Grossman SA. The associationbetween severe treatment-related lymphopenia and progression freesurvival in patients with newly diagnosed squamous cell head andneck cancer. HeadNeck 2013. Oct 31. doi: 10.1002/hed.23535. [Epubahead of print].

5. Standish LJ, Torkelson C, Hamill FA, YimD, Hill-Force A, Fitzpatrick A,et al. Immune defects in breast cancer patients after radiotherapy.J Soc Integr Oncol 2008;6:110–21.

6. RabinovichGA,Ramhorst RE,RubinsteinN,CoriglianoA,DaroquiMC,Kier-Joffe EB, et al. Induction of allogenic T-cell hyporesponsivenessby galectin-1-mediated apoptotic and non-apoptotic mechanisms.Cell Death Differ 2002;9:661–70.

7. RubinsteinN, AlvarezM, Zwirner NW, ToscanoMA, Ilarregui JM,BravoA, et al. Targeted inhibition of galectin-1 gene expression in tumor cellsresults in heightened T cell-mediated rejection; A potential mechanismof tumor-immune privilege. Cancer Cell 2004;5:241–51.

8. van der Leij J, van den Berg A, Harms G, Eschbach H, Vos H, Zwiers P,et al. Strongly enhanced IL-10 production using stable galectin-1homodimers. Mol Immunol 2007;44:506–13.

9. Banh A, Zhang J, Cao H, Bouley DM, Kwok S, Kong C, et al. Tumorgalectin-1 mediates tumor growth and metastasis through regulationof T-cell apoptosis. Cancer Res 2011;71:4423–31.

10. Dalotto-Moreno T, Croci DO, Cerliani JP, Martinez-Allo VC, Dergan-Dylon S, Mendez-Huergo SP, et al. Targeting galectin-1 overcomesbreast cancer-associated immunosuppression and prevents meta-static disease. Cancer Res 2013;73:1107–17.

11. WislezM,SpencerML, Izzo JG, JuroskeDM,BalharaK,CodyDD, et al.Inhibitionofmammalian target of rapamycin reverses alveolar epithelialneoplasia induced by oncogenic K-ras. Cancer Res 2005;65:3226–35.

12. Wild AT, Hiniker SM, Chang DT, Tran PT, Khashab MA, Limaye MR,et al. Re-irradiation with stereotactic body radiation therapy as a noveltreatment option for isolated local recurrence of pancreatic cancerafter multimodality therapy: experience from two institutions. J Gas-trointest Oncol 2013;4:343–51.

13. ChoM,CummingsRD.Galectin-1, a beta-galactoside-binding lectin inChinese hamster ovary cells. II. Localization and biosynthesis. J BiolChem 1995;270:5207–12.

14. Tabrizi SJ, Niiro H, Masui M, Yoshimoto G, Iino T, Kikushige Y, et al. Tcell leukemia/lymphoma 1 and galectin-1 regulate survival/cell deathpathways in human naive and IgMþ memory B cells through alteringbalances in Bcl-2 family proteins. J Immunol 2009;182:1490–9.

15. Sorger D, Patt M, Kumar P, Wiebe LI, Barthel H, Seese A, et al.[18F]Fluoroazomycinarabinofuranoside (18FAZA) and [18F]Fluoro-misonidazole (18FMISO): a comparative study of their selective uptakein hypoxic cells and PET imaging in experimental rat tumors. Nucl MedBiol 2003;30:317–26.

16. Yovino S, Kleinberg L, Grossman SA, Narayanan M, Ford E. Theetiology of treatment-related lymphopenia in patients with malignantgliomas: modeling radiation dose to circulating lymphocytes explainsclinical observations and suggestsmethods ofmodifying the impact ofradiation on immune cells. Cancer Invest 2013;31:140–41.

17. Hellerstein M, Hanley MB, Cesar D, Siler S, Papageorgopoulos C,Wieder E, et al. Directlymeasured kinetics of circulating T lymphocytesin normal and HIV-1–infected humans. Nat Med 1999;5:83–9.

Clin Cancer Res; 20(21) November 1, 2014 Clinical Cancer Research5568

Kuo et al.

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

18. Ellsworth S, Balmanoukian A, Kos F, Nirschl CJ, Nirschl TR, GrossmanSA, et al. Sustained CD4 T cell–driven lymphopenia without a com-pensatory IL-7/IL-15 response among high-grade glioma patientstreated with radiation and temozolomide. Oncoimmunology 2014;3:e27357.

19. Strik HM, Schmidt K, Lingor P, Tonges L, Kugler W, Nitsche M, et al.Galectin-1 expression in human glioma cells: modulation by ionizingradiation and effects on tumor cell proliferation and migration. OncolRep 2007;18:483–8.

20. Huang EY, Chen YF, Chen YM, Lin IH, Wang CC, SuWH, et al. A novelradioresistant mechanism of galectin-1 mediated by H-Ras-depen-dent pathways in cervical cancer cells. Cell Death Dis 2012;3:e251.

21. Upreti M, Jamshidi-Parsian A, Apana S, Berridge M, Fologea DA,Koonce NA, et al. Radiation-induced galectin-1 by endothelial cells:a promising molecular target for preferential drug delivery to the tumorvasculature. J Mol Med 2013;91:497–506.

22. Le QT, Kong C, Lavori PW, O'Byrne K, Erler JT, Huang X, et al.Expression and prognostic significance of a panel of tissue hypoxiamarkers in head-and-neck squamous cell carcinomas. Int J RadiatOncol Biol Phys 2007;69:167–75.

23. Sotomayor CE, RabinovichGA.Galectin-1 induces central and periph-eral cell death: implications in T-cell physiopathology. Dev Immunol2000;7:117–29.

24. Szoke T, Kayser K, Baumhakel JD, Trojan I, Furak J, Tiszlavicz L, et al.Prognostic significance of endogenous adhesion/growth-regulatorylectins in lung cancer. Oncology 2005;69:167–74.

25. Szoke T, Kayser K, Trojan I, Kayser G, Furak J, Tiszlavicz L, et al. Therole of microvascularization and growth/adhesion-regulatory lectins inthe prognosis of non-small cell lung cancer in stage II. Eur J Cardi-othorac Surg 2007;31:783–7.

26. Ito K, Ralph SJ. Inhibiting galectin-1 reduces murine lung metastasiswith increased CD4(þ) and CD8 (þ) T cells and reduced cancer celladherence. Clin Exp Metastasis 2012;29:561–72.

27. Ito K, Scott SA, Cutler S, Dong LF, Neuzil J, Blanchard H, et al.Thiodigalactoside inhibits murine cancers by concurrently blockingeffects of galectin-1 on immune dysregulation, angiogenesisand protection against oxidative stress. Angiogenesis 2011;14:293–307.

28. Soldati R, Berger E, Zenclussen AC, Jorch G, Lode HN, Salatino M,et al. Neuroblastoma triggers an immunoevasive program involving

galectin-1-dependent modulation of T cell and dendritic cell compart-ments. Int J Cancer 2012;131:1131–41.

29. Park B, YeeC, LeeKM. The effect of radiation on the immune responseto cancers. Int J Mol Sci 2014;15:927–43.

30. Gameiro SR, Jammeh ML, Wattenberg MM, Tsang KY, Ferrone S,Hodge JW. Radiation-induced immunogenic modulation of tumorenhances antigen processing and calreticulin exposure, resulting inenhanced T-cell killing. Oncotarget 2014;5:403–16.

31. Lugade AA, Moran JP, Gerber SA, Rose RC, Frelinger JG, Lord EM.Local radiation therapy of B16 melanoma tumors increases the gen-eration of tumor antigen-specific effector cells that traffic to the tumor.J Immunol 2005;174:7516–23.

32. Lugade AA, Sorensen EW, Gerber SA, Moran JP, Frelinger JG, LordEM. Radiation-induced IFN-gamma production within the tumormicroenvironment influences antitumor immunity. J Immunol 2008;180:3132–9.

33. Liang H, Deng L, Burnette B, Weichselbaum RR, Fu YX. Radiation-induced tumor dormancy reflects an equilibrium between the prolif-eration and T lymphocyte-mediated death of malignant cells. Oncoim-munology 2013;2:e25668.

34. Lawrence YR, Dicker AP. Radiation therapy and the immune system:learning to live together. Future Oncol 2014;10:777–80.

35. Croci DO, Cerliani JP, Dalotto-Moreno T, Mendez-Huergo SP, Mas-canfroni ID, Dergan-Dylon S, et al. Glycosylation-dependent lectin-receptor interactions preserve angiogenesis in anti-VEGF refractorytumors. Cell 2014;156:744–58.

36. Dings RP, van der Schaft DW, Hargittai B, Haseman J, Griffioen AW,Mayo KH. Anti-tumor activity of the novel angiogenesis inhibitoranginex. Cancer Lett 2003;194:55–66.

37. Thijssen VL, Postel R, Brandwijk RJ, Dings RP, Nesmelova I, Satijn S,et al. Galectin-1 is essential in tumor angiogenesis and is a target forantiangiogenesis therapy.ProcNatlAcadSciUSA2006;103:15975–80.

38. Dings RP,MillerMC, Nesmelova I, Astorgues-Xerri L, Kumar N, SerovaM, et al. Antitumor agent calixarene 0118 targets human galectin-1 asan allosteric inhibitor of carbohydrate binding. J Med Chem 2012;55:5121–9.

39. ZucchettiM, Bonezzi K, Frapolli R, Sala F, Borsotti P, ZangariniM, et al.Pharmacokinetics and antineoplastic activity of galectin-1-targetingOTX008 in combination with sunitinib. Cancer Chemother Pharmacol2013;72:879–87.

www.aacrjournals.org Clin Cancer Res; 20(21) November 1, 2014 5569

Galectin-1 and Radiation-Related Lymphopenia

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138

2014;20:5558-5569. Published OnlineFirst September 4, 2014.Clin Cancer Res   Peiwen Kuo, Scott V. Bratman, David B. Shultz, et al.   Attenuates NSCLC Radiation ResponseGalectin-1 Mediates Radiation-Related Lymphopenia and

  Updated version

  10.1158/1078-0432.CCR-14-1138doi:

Access the most recent version of this article at:

  Material

Supplementary

  http://clincancerres.aacrjournals.org/content/suppl/2014/09/05/1078-0432.CCR-14-1138.DC1

Access the most recent supplemental material at:

   

   

  Cited articles

  http://clincancerres.aacrjournals.org/content/20/21/5558.full#ref-list-1

This article cites 38 articles, 9 of which you can access for free at:

  Citing articles

  http://clincancerres.aacrjournals.org/content/20/21/5558.full#related-urls

This article has been cited by 6 HighWire-hosted articles. Access the articles at:

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.org

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/20/21/5558To request permission to re-use all or part of this article, use this link

on April 25, 2021. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 4, 2014; DOI: 10.1158/1078-0432.CCR-14-1138