Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org...
-
Upload
vivien-murphy -
Category
Documents
-
view
222 -
download
0
description
Transcript of Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org...
Functions
GenomeEntire set of DNA in each cell of an orgNormally one circular chromosome in
prokaryotes
Binary FissionSingle chromosome replicatesOne pulls awayMembrane & wall separate cell
Human Genome
Haploid(n)
Diploid(2n)
6,000,000,000 base pairs longSomatic cells’ DNA is split into 46
chromosomes23 are maternal23 are paternal
Gametes have ½ the DNA which is split into 23 chroms
Human Genome ( )♂Human Genome ( )♀
1 2 3 4 5 6 7 8
9 10 11 12 13 14 15 16
X21 2219 2017 18 Y
Human ChromosomeA length of DNA
Each has a homologous chromosome
♀ ♂Homologous Pair
CENTROMERES
A length of DNAEach has a homologous
chromosome1000’s of genes1,000,000’s of base pairsCombined with proteins
Homologous Pair ♀ ♂
ATCGCGGCATTATATACGGCGCCGTA
Human Chromosome
Each chromosome replicates to form identical chromatids
Attached by centromeres
Chromosome Replication
Cell Cycle
Identical distribution of replicated DNA into nuclei of 2
daughter cells
Splitting of the rest of the cell
Late InterphaseCentrosomes replicate
ProphaseChromosomes supercoilNucleoli disappearSpindle forms
Spindle Elongation
Prometaphase Nuc envelope breaks downmtubules from opposite poles
attach to kinetochores
MetaphaseSpindle fibers force chroms
to metaphase plate
AnaphaseChromatids migrate toward
opposite polesNonkinetochore mtubules
elongate cell
Anaphase Chromatid may “walk” along
mtubule toward pole
TelophaseCell continues elongationNuclear envelopes reformDNA uncoils
Cytokinesis (animal) Microfilaments
constrict cell to form cleavage furrow
Membrane pinches off
Cytokinesis (Plant)
Cellulose vesicles gather in the middle of the cell forming the cell plate
Mitotic Review