ORIGINAL PAPER

Functional Analysis of Cotton DELLA-Like Genesthat are Differentially Regulated during Fiber Development

Wei Wen & Baiming Cui & Xiaoling Yu & Qiang Chen &

Yinying Zheng & Yiji Xia & Ming Peng

Published online: 28 January 2012# Springer-Verlag 2012

Abstract DELLA proteins act as repressors in the gibberellin(GA) signaling pathway. GA could relieve this repression bytriggering DELLA protein degradation via the ubiquitin–pro-teasome pathway. In this study, we cloned four genes fromallotetraploid cotton that encode DELLA-like proteins whosefunctions have not been characterized previously. These fourgenes were designated as GhGAI3a, GhGAI3b, GhGAI4a,and GhGAI4b. The deduced proteins encoded by these genescontain all domains present in typical DELLA proteins. Se-quence analysis showed that GhGAI3a belongs to the D sub-genome, whereas GhGAI3b belongs to the A sub-genome.The results from the analysis of their expression patterns inallotetraploid cotton showed that their expression was regu-lated during the fiber initiation and elongation stages.GhGAI3a was expressed at a high level at the fiber initiationstage; however, its transcript level was significantly reduced infiber cells during the early fiber elongation stage. To test thefunction of GhGAI3a, we generated transgenic Arabidopsis

lines that carried a construct in which expression ofGhGAI3awas under the control of the cauliflower mosaic virus 35Spromoter. The transgenic Arabidopsis lines exhibited smallerleaves and shorter stems and stamens. In addition, theGhGAI3a overexpression lines showed a defect in GA-induced hypocotyl elongation. These results suggest thatGhGAI3a acts as a repressor of the GA signaling pathway.

Keywords Cotton fiber . Gibberellin signaling . DELLAprotein . Transgenic Arabidopsis

Introduction

Cotton is an important economic crop (Meng et al. 2010;Wang et al. 2011; Zhang et al. 2011b). Its fiber is usedextensively in various textile industries and other commodityproduction (Lee et al. 2007; Barthelson et al. 2010). The mostimportant goal in cotton production is to increase fiber yieldand quality by increasing fiber numbers per ovule and fiberlength (Seagull and Giavalis 2004).

Fiber development can be divided into four stages: initia-tion, elongation, secondary cell wall biosynthesis, and matu-ration (John and Crow 1992; Zhang et al. 2011a). Theinitiation stage is from -3DPA (days post-anthesis) to 3DPAand determines the fiber numbers per ovule. The elongationstage is from 5DPA to 20DPA and determines fiber length(Lee et al. 2007). Many studies aimed to reveal factors thataffect the fiber growth and development have demonstratedthat various phytohormones are involved in these processes,which include auxin, gibberellin, brassinosteroid, and ethylene(Shi et al. 2006; Yang et al. 2006; Lee et al. 2007; Luo et al.2007; Xiao et al. 2010; Zeng et al. 2011). Many proteins havebeen found to play important roles in fiber development,including several MYB transcription factors (Pu et al. 2008),

Wei Wen and Baiming Cui contributed equally to this work.

W. Wen :X. Yu :Q. Chen :M. Peng (*)Institute of Tropical Bioscience and Biotechnology,Chinese Academy of Tropical Agricultural Sciences,No. 4, XueYuan Road, Long Hua District,Haikou, Chinae-mail: mmpeng_2000@yahoo.com

W. Wen :X. Yu :Q. Chen :M. PengCollege of Agriculture, Hainan University,Danzhou, China

B. Cui :Y. Zheng :M. PengCollege of Life Sciences, Xinjiang Shihezi University,Xinjiang, China

Y. XiaDepartment of Biology, Hong Kong Baptist University,Hong Kong, China

Plant Mol Biol Rep (2012) 30:1014–1024DOI 10.1007/s11105-012-0412-z

calmodulin and caldesmon (Taliercio and Boykin 2007),arabinogalactan proteins (Ji et al. 2003; Li et al. 2010), andactin (Li et al. 2005). Saturated very-long-chain fatty acidsmay be involved in maximizing the extensibility of cottonfibers (Qin et al. 2007). The importance of gibberellins in fiberinitiation and elongation has been revealed by several studiesusing in vivo hormone measurement, exogenous treatment ofovules with the hormone, and overexpressing GA biosynthesisgene GhGA20ox1 in cotton (Beasley and Ting 1974; Chen etal. 1996; Gokani and Thaker 2002; Seagull and Giavalis 2004;Xiao et al. 2010). However, the detailed molecular mechanismabout GA-regulated fiber initiation and elongation remains tobe defined.

The GA signal pathway is conserved among different plantspecies (Richards et al. 2001; Fleet and Sun 2005). DELLAproteins play an important role in the GA signaling pathwayby acting as repressors (Richards et al. 2001; Fleet and Sun2005). Binding of the GA receptor GID1 with GA triggersDELLA protein degradation via the ubiquitin–proteasomepathway (Ueguchi-Tanaka et al. 2005; Nakajima et al. 2006;Willige et al. 2007), thereby activating GA-mediated physio-logical and developmental processes (Richards et al. 2001;Sun and Gubler 2004).

DELLA proteins are a sub-family of GRAS proteins(Pysh et al. 1999; Bolle 2004) and have been identified

in many plant species, such as GAI, RGA, RGL1,RGL2, and RGL3 in Arabidopsis thaliana (Peng et al.1997; Silverstone et al. 1998; Lee et al. 2002; Wen andChang 2002; Piskurewicz and Molina 2009), SLR1 inOryza sativa L. (Ikeda et al. 2001), SLN1 in Hordeumvulgare L. (Chandler et al. 2002), D8 in Zea mays L.(Peng et al. 1999), Rht in Triticum aestivum L. (Peng etal. 1999), MdRGL2a in Malus domestica Borkh. (Fosteret al. 2007), and VvGAI in Vitis vinifera L. (Boss andThomas 2002). All of these DELLA proteins containseveral highly conserved domains, such as DELLA andVHYNP domains, NLS, an LXXLL motif, an LHR do-main, and an SH2 domain (Peng et al. 1997; Peng et al.1999; Richards et al. 2001; Itoh et al. 2002; Hussain etal. 2005). DELLA proteins suppress elongation of stemsand hypocotyls as well as expansion of leaves and affectdevelopment of flowers (Peng et al. 1997; Silverstone et al.1998; Peng et al. 1999; Ikeda et al. 2001; Boss and Thomas2002; Chandler et al. 2002; Lee et al. 2002; Wen and Chang2002; Foster et al. 2007; Piskurewicz and Molina 2009). Twocotton DELLA-like proteins, GhRGL and GhSLR1b, havepreviously been studied (Aleman et al. 2008; Liao et al. 2009).Overexpression of these cotton DELLA-like proteins inArabidopsis leads to growth retardation (Aleman et al. 2008;Liao et al. 2009).

Table 1 Primer sequences forcloning and qRT-PCR Primer names Sequences (5′-3′) Used for

DE3.1s CGCTCGCTCACTCTCTTTCTC Cloning of GhGAI3

DE3.2s GAATCATGGTGCTGTACGACTC Cloning of GhGAI3

DE3.2r GGAGAGTATCCTATGCTGGGAA Cloning of GhGAI3

DE4.51s TGCTAGATCTGCCCCTTCTTTCA Cloning of GhGAI4

DE4.52s GAATCATGTTGCGGTACGACTCCA Cloning of GhGAI4

DE4.3 TTACCCTGCCCCTACTATGAAG Cloning of GhGAI4

GhRGLF AATGACCGGAATTGGACCACCTCA GhRGL qRT-PCR

GhRGLR TTCGGGTTCGAGATCGGCTAAACT GhRGL qRT-PCR

GhSLR1bF AGCTTGAGCAGTTGGAGGAGGTTA GhSLR1b qRT-PCR

GhSLR1bR AAGAAACGAATCATCCAACGCCGC GhSLR1b qRT-PCR

GhGAI3aF CCGCTTACTCGGGTCTGATCTA GhGAI3a qRT-PCR

GhGAI3aR CTAGAAAACCGGGTTGGTTGTG GhGAI3a qRT-PCR

GhGAI3bF TACTCGGGTCTGATCCGAATC GhGAI3b qRT-PCR

GhGAI3bR AAAACCGGGCTGGTTGTG GhGAI3b qRT-PCR

GhGAI4aF CGGGTTTAGGGCATTGCG GhGAI4a qRT-PCR

GhGAI4aR CGCGATGAGAGGGCTGC GhGAI4a qRT-PCR

GhGAI4bF TCCTCCTCGTCCAAGCCAC GhGAI4b qRT-PCR

GhGAI4bR ATAACCAGCACCGGCGAGTAG GhGAI4b qRT-PCR

GhHistone3F TCAAGACTGATTTGCGTTTCCA GhHistone3 qRT-PCR

GhHistone3R GCGCAAAGGTTGGTGTCTTC GhHistone3 qRT-PCR

GhGAI3aF TTCACCGCTTACTCGGGTCT GhGAI3a qRT-PCR

GhGAI3aR TGGTTGTGGTTTGCTTCTTGTT GhGAI3a qRT-PCR

UBQ11F GCAGATTTTCGTTAAAACC UBQ11 qRT-PCR

UBQ11R CCAAAGTTCTGCCGTCC UBQ11 qRT-PCR

Plant Mol Biol Rep (2012) 30:1014–1024 1015

In this study, we cloned four additional DELLA-likesequences from cotton. These genes are named as GhGAI3a,GhGAI3b, GhGAI4a, and GhGAI4b. The expression pro-files of these genes during fiber development were analyzed.

Overexpression of GhGAI3a in Arabidopsis was found tocause a phenotype similar to defects in the GA signalingpathway, suggesting that GhGAI3a might act as a repressorof the GA pathway.

1016 Plant Mol Biol Rep (2012) 30:1014–1024

Materials and Methods

Plant Materials

Allotetraploid cotton (Gossypium hirsutum L. cv. Xinluzao13) was planted in field in March in Hainan province,China. Cotton seedlings used for RNA extraction wereprepared by growing in pots for 14 days in a greenhouse.Arabidopsis (the Columbia ecotype) plants were grown inpots at 22°C with a photoperiod of 16 h of light and 8 h ofdark in growth chambers. The wild diploid cottons includedin the study are the cottons with the A genome (G. arboreum,G. herbaceum, G. africanum) and the cottons with the Dgenome (G. raimondii, G. thurberi, G. davidsonii, G.gossypioides).

Cloning and Sequence Analysis of GAIs from AllotetraploidCotton and Wild Diploid Cotton Species

EST sequences in cotton whose encoded proteins share highhomology with known DELLA proteins were obtained bysearching the cotton EST database with the DELLA proteinsequences from Arabidopsis as the queries. 3′RACE was usedto clone the complete coding region cDNA sequences of theGhGAI genes with RNA isolated from -3DPA ovules of Xin-luzao 13 plants. The primer sequences are listed in the primerinformation table (Table 1). 3′RACE was performed by usingthe 3′-Full RACE kit (TaKaRa, Dalian) according to the man-ufacturer’s instruction. The genomic sequences of GhGAIswere cloned with the primers DE3.2 s and DE3.2r forGhGAI3sand DE4.52 s and DE4.3 for GhGAI4s. The GAI3s and GAI4sgenomic sequences from different wild diploid cottons wereamplified by PCR with the primers which were used to clonethe GhGAI3 and GhGAI4 genomic sequences (Table 1). Se-quence analysis and phylogenetic tree construction were per-formed by using Vector NTI 9.0 (Invitrogen, CA).

Expression Profile Analysis of the DELLA-Like Genesin Xinluzao 13 Cotton Plants

Roots, hypocotyls, and leaves were collected from cottonseedlings grown for 14 days in greenhouse. For analyzingthe expression patterns of these genes during fiber develop-ment, ovules and fibers at different days pre- and post-anthesiswere collected from the cotton plants grown in field. Theovules and fiber tissues used for RNA extraction include thefollowing: -5~-1DPA ovules, 0–3 DPA ovules which containinitiating fiber cells, 4–25DPA ovules in which fiber cells wereremoved, and 4–15DPA fibers. The pre-anthesis ovules werecollected at different stages based on the length of the alabas-trums. The alabastrums with a length of 1.0–1.2 cm werechosen as -5DPA samples, 1.3–1.5 cm as -3DPA samples,and more than 1.7 cm as -1DPA samples (Wen et al. 2011).

Total RNA was extracted from these tissues and used inquantitative real time RT-PCR (q-PCR) analysis for detec-tion of the transcript levels of GhGAI3s and GhGAI4s.GhHistione3 was used as a reference gene for normalization(Tu et al. 2007). The primers and probes used in q-PCRwere listed in Table 1. The primers for detecting expressionlevels of GhRGL and GhSLR1b were based on the previousreport (Aleman et al. 2008). The primer sequences ofGhHistone3F and GhHistone3R were also based on theprevious report (Tu et al. 2007). q-PCR was performed byusing Stratagene’s 3005P instrument with SYBR Premix ExTaq™ Kit (TakaRa, Dalian). The reaction conditions fordetecting transcript levels of GhGAI4b, GhSLR1a, andGhSLR1b were as follows: 95°C for 30 s, followed by 40cycles of 95°C for 5 s and 60°C for 20 s. For detecting theother transcripts, the only difference is the temperature andduration for the extension step: For GhGAI3a, it was 64°Cfor 40 s; for GhGAI3b, 64°C for 20 s; for GhGAI4a, 56°Cfor 20 s. There were three replicates for each treatment.

Transformation of GhGAI3a into Arabidopsis

The GhGAI3a genomic sequence was inserted downstreamof the CaMV35s promoter in the binary vector pBI121, andthe construct was transformed into Arabidopsis using Agro-bacterium tumifaciens strain GV3101. Positive transgeniclines were selected on the 1/2 MS medium with 50-mg/Lkanamycin. Five independent transgenic lines wereobtained, and PCR was performed to further verify thepresence of 35S::GhGAI3a in these transgenic Arabidopsis.

Phenotype Analysis of Transgenic Arabidopsis

The phenotype analysis was performed on T4 and later gen-erations of the transgenic Arabidopsis. The lines were grownunder 16-h light/8-h dark. Plant rosette radii were measuredfor 22-day-old plants, and plant height was measured using

�Fig. 1 Sequence alignment of the DELLA proteins from cotton andother plant species. Conserved domains among the DELLA proteins areunderlined, which included the DELLA domain (I), the VHYNP domain(II), the valine-rich regions (III and V), the nuclear-localization signal(IV), the LXXLL motif (VI), and the SH2-like domain (VII). Predictedpotential phosphorylation sites of serine and threonine residues aremarked with the asterisks and the black squares, respectively. Potentialphosphorylation sites of tyrosine are indicated by triangles. The dia-monds indicate the phosphate group binding site of phosphotyrosine toarginine, and the filled circles indicate leucine heptad repeats. TheDELLA proteins in the alignment: six Gossypium hirsutum sequences:GhGAI3a (HM034760), GhGAI3b (HM034763), GhGAI4a(HM034761), GhGAI4b (HM034762), GhRGL (DQ006269), GhSLR1b(AY208992); three Arabidopsis thaliana sequences: AtRGA (Y11336),AtGAI (Y15193); and one each fromOryza sativaOsSLR1 (AB262980)and Malus x domestica MdRGL3b (DQ007888)

Plant Mol Biol Rep (2012) 30:1014–1024 1017

50-day-old plants. Total RNAwas extracted from 50-day-oldplants using RNeasy Kit (Qiagen, Dusseldorf). Reverse tran-scription was performed by AMV reverse transcriptase(TaKaRa, Dalian). The cDNAs were used as templates todetermine the GhGAI3a expression level in different trans-genic lines by q-PCR. UBQ11 was chosen as the referencegene for normalization (Tyler et al. 2004). The primers used indetermining GhGAI3a levels in the transgenic Arabidopsisplants by q-PCR were listed in Table 1. The instrument andreaction conditions are the same as that for the q-PCR analysisofGhGAIs in cotton plants. There were five replicates for eachtreatment.

The hypocotyl growth experiments were performed onArabidopsis seedlings growing on the 1/2 MS medium withor without 100-μM GA3. The seeds of different Arabidopsislines were placed on plates with the medium after steriliza-tion, and the plates were kept under darkness at 4°C for4 days for vernalization. The seeds were germinated underlight for 24 h for germination synchronization (Alabadi et al.2004). The germinating seedlings were then grown under a

photoperiod of 16-h light/8-h dark for 7 days, and the lengthof hypocotyl was measured under a microscope. The statisticalanalysis on the difference in the hypocotyl length betweentransgenic lines and wild-type plants was performed with thePaired-Samples T test in SPSS (SPSS, Chicago).

Results

Cloning of GhGAIs

There exist at least sevenDELLA-like genes in cotton (Yang etal. 2006). Two of them (GhRGL and GhSLR1b) have beencharacterized previously (Aleman et al. 2008; Liao et al. 2009).Another two cotton DELLA-like sequences have been depos-ited to the GenBank database (GenBank accession numbersFJ974046 and FJ974047), but their functions have not beencharacterized. Based on the sequences of these two genes, weobtained their cDNA clones from RNA isolated from theXinluzao 13 cultivar by using 3′RACE. The cDNA clones fall

Fig. 2 A phylogenetic tree of the DELLA proteins from cotton andother plant species.Numbers indicate the branch length. DELLA proteinsin the phylogenetic tree: Arabidopsis thaliana: AtRGA (Y11336), AtGAI(Y15193), AtRGL1 (NM_105306), AtRGL2 (NM_111216), AtRGL3(NM_121755); Hordeum vulgare: Sln1 (AF460219); Vitis vinifera:VvGAI (F378125); Lycopersicon esculentum: LeGAI (AY269087); Zea

mays: Zmd8 (AJ242530); Oryza sativa: OsSLR1 (AB262980); Triticumaestivum: TsRht-D1a (AJ242531); Malus x domestica: MdRGL3b(DQ007888); Gossypium hirsutum: GhGAI3a (HM034760), GhGAI3b(HM034763), GhGAI4a (HM034761), GhGAI4b (HM034762), GhRGL(DQ006269), GhSLR1b (AY208992)

Table 2 Sequences alignments of GhGAI3a and GhGAI3b with GAI3s from wild diploid cottons

G. arboreumGAI3*

G. herbaceumGAI3*

G. AfricanumGAI3*

G. raimondiiGAI3#

G. davidsoniiGAI3#

G. gossypioidesGAI3#

G. thurberiGAI3#

GhGAI3a 97.3 97.3 97.3 98.4 99.8 99.6 99.6

GhGAI3b 100 100 100 98.2 97.4 97.3 97.3

Asterisks indicate GAIs from the AA-genome cotton species, and hash sign indicates GAIs from the DD-genome cotton species

1018 Plant Mol Biol Rep (2012) 30:1014–1024

into four closely related sequences which we namedGhGAI3a, GhGAI3b, GhGAI4a, and GhGAI4b (GenBankaccession numbers are HM034760~HM034763). GhGAI3a,GhGAI3b, GhGAI4a, and GhGAI4b encode proteins with547, 541, 535, and 538 amino acids, respectively. The de-duced amino acid sequences of GhGAI3a and GhGAI3b areover 96% identical, and similarly, GhGAI4a and GhGAI4bare 96% identical. The GhGAI3s and the GhGAI4s are 81–86% identical at the amino acid level. These four GhGAIsshare approximately 45% sequence identify with the other twocotton DELLA-like proteins GhSLR1b and GhRGL. We alsocloned their genomic sequences by PCR (GenBank accessionnumbers are GQ290636~GQ290639). The alignments betweenthe cDNA sequences and genomic sequences (date not shown)indicate that these genes contain no intron like the DELLAgenes from other plant species (Peng et al. 1997; Silverstone etal. 1998; Wen and Chang 2002; Tyler et al. 2004).

Like other DELLA sub-family proteins, these four GhGAIscontain the DELLA and VHYNP domains that are importantfor protein stability in response to GA, NLS, and the LXXLLmotif that target proteins to the nucleus, the poly Val/Ser/Thr

motifs, and the LHR and SH2 domains which function asregulatory domains (Fig. 1). Figure 2 shows the result ofphylogenetic tree analysis with DELLA proteins from differentplant species.

Origins of GhGAIs

Approximately 95% of cotton fiber worldwide is producedfrom the allotetraploid species G. hirsutum (Lee et al. 2007).This species was originated by a cross between two diploidspecies with an AA genome and a DD genome, respectively.The diploid cotton species with the A genome produce longlint fibers, and those with the D genome produce shorter lintfibers (Lee et al. 2007). The allotetraploid cotton producesmore abundant and higher quality fibers than the AA- andDD-genome cottons (Lee et al. 2007). To reveal the possibleorigins of GhGAI3s and GhGAI4s, we cloned GAI3s andGAI4s from three AA-genome cotton species and four DD-genome cotton species by PCR with the primers based onthe sequences of GhGAI3s and GhGAI4s. Only a single

Table 3 Sequence alignments of GhGAI4a and GhGAI4b with GAI4s from wild diploid cottons

G. arboreumGAI4*

G. herbaceumGAI4*

G. AfricanumGAI4*

G. raimondiiGAI4#

G. davidsoniiGAI4#

G. gossypioidesGAI4#

GhGAI4a 99.8 95.9 95.9 97.8 97.8 96.7

GhGAI4b 96.7 98.9 98.9 98.5 98.5 98.5

Asterisks indicate GAIs from the AA-genome cotton species, and hash sign indicates GAIs from the DD-genome cotton species

Fig. 3 A phylogenetic tree ofGhGAIs from the allotetraploidcotton and GAIs from the wilddiploid cotton species. a Aphylogenetic tree of GhGAI3sfrom allotetraploid cotton andGAI3s from the wild diploidcottons species. b Aphylogenetic tree of GhGAI4sfrom allotetraploid cotton andGAI4s from wild diploid cottonspecies. Asterisks indicate GAIsfrom the AA-genome cottonspecies, and hash sign indicatesGAIs from the DD-genomecotton species

Plant Mol Biol Rep (2012) 30:1014–1024 1019

Fig. 4 The expression patternsof GhGAIs in allotetraploidcotton. The results of q-PCRanalysis to determine expres-sion profiles of GhGAI3a (a),GhGAI3b (b), GhGAI4a (c),GhGAI4b (d), GhRGL (e), andGhSLR1b (f) in ovules and fibercells during fiber developmentas well as in some vegetativetissues. The error bars indicatestandard deviation. DPA dayafter anthesis, DPAF from fibersat the different days after an-thesis, DPAO the ovules at thedifferent days after anthesis

1020 Plant Mol Biol Rep (2012) 30:1014–1024

GAI3 gene and a single GAI4 gene were obtained from eachwild diploid cotton species.

Amino acid sequence comparison (Tables 2 and 3) showsthat GhGAI3a shares over 99.6% identity to GAIs from threediploid wild species with the D genome and 97% identify withGAIs from the A genome species. GhGAI3b shares 100%identify with GAIs from the species with the A genome and97% identity with GAIs from the species with the D genome.The result indicates that allotetraploid cotton obtainedGhGAI3afrom the D genome species, whereasGhGAI3b was from the Agenome. The phylogenetic tree analysis also indicates thatGhGAI3b falls into the same cluster with its homologous genesfrom the AA-genome cotton species, and GhGAI3a is clusteredwith the homologous genes from the DD-genome cotton species(Fig. 3a). The sequence comparison does not reveal obviousindication on the origin of GhGAI4a and 4b.

Expression Profiles of GhGAIs, GhRGL, and GhSLR1bin Cotton

We determined expression profiles of GhGAIs during thewhole fiber developmental processes using q-PCR. We alsoincluded the other two cotton DELLA-like genes GhRGL andGhSLR1b in the analysis to obtain more detailed expressionprofiles for these two genes than previously reported (Alemanet al. 2008; Liao et al. 2009). The expression levels ofGhGAIs, GhRGL, and GhSLR1b in some vegetative tissueswere also determined.

The results of q-PCR showed that the four GhGAIs wereexpressed in all of the tissues examined. The expressionpatterns of GhGAI3a and GhGAI3b were largely similar.They were expressed at high levels in roots, hypocotyls,and leaves. In ovules and fibers, their expression levels were

Fig. 5 Phenotype analysis ofthe Arabidopsis transgenic linesoverexpressing GhGAI3a. aThe plant statues of theGhGAI3a overexpression linesand control Arabidopsis plants.b The GhGAI3a transcriptlevels of the transgenic linesand control plants. RNA wasisolated from leaves of theselines, and the transcript levelswere determined by q-PCR. cThe flower and silique mor-phology of the GhGAI3a over-expression lines and controlplants. d The rosette radii of thetransgenic lines and controlplants. The rosette sizes weremeasured with 22-day-oldplants. Asterisks indicate a sig-nificant difference (P<0.01).WT wild type, pBI121 thetransgenic line carrying theempty vector, 3a-1~3a-5 ho-mozygote progenies of the fiveindependent 35S::GhGAI3atransgenic Arabidopsis lines.Bar01 mm

Plant Mol Biol Rep (2012) 30:1014–1024 1021

highest during the fiber initiation stage. Their transcriptlevels dropped in the 4DPA fibers and then gradually in-creased again in the fibers during the elongation stages;however, their transcript levels in ovules (without fibers)remained low during these stages (Fig. 4a, b). The expres-sion levels of GhGAI4a and GhGAI4b gradually increasedduring the fiber initiation stage and were higher during fiberelongation stage. The GhGAI4a expression level was low inthe vegetative organs (Fig. 4c), whereas GhGAI4b had thehighest expression level in 20DPA ovules and hypocotyls(Fig. 4d). These results suggest that these DELLA-likegenes are involved in fiber and ovule development as wellas in vegetative growth in cotton. GhRGL was expressed atthe highest level in hypocotyls and petals and had a highexpression level in 10DPA and 15DPA fibers during fiberelongation (Fig. 4e). GhSLR1b had the highest expressionlevel in 15DPA fiber and a very low expression level duringthe fiber initiation stage (Fig. 4f).

Overexpression of GhGAI3a in Arabidopsis Repressedthe Growth of Transgenic Plants

GhGAI3a shares 100% identity with a cotton sequencenamed GAI (Yang et al. 2006). It was previously reported thatthis gene was differentially expressed in ovules during thefiber initiation stage between wild-type allotetraploid cottonand the N1N1 fiberless mutant (Yang et al. 2006). However,its function has not been characterized. We generated trans-genic Arabidopsis lines that express the GhGAI3a gene underthe control of the cauliflower mosaic virus 35S promoter(35S) and used the transgenic Arabidopsis lines to assesspossible function of this DELLA-like gene.

Five transgenic lines were obtained and analyzed for thisstudy. These five lines were designated as 3a-1, 3a-2, 3a-3, 3a-4, and 3a-5. Non-transgenic wild-type plants and Arabidopsisplants transformed with the empty vector (pBI121) were usedas controls. Among the 35S::GhGAI3a lines, 3a-1 and 3a-3showed a dwarf statue. The radii of their rosettes were smaller

than the control plants (Fig. 5d). After bolting, these two linesshowed shorter stems and reduced apical dominance (Fig. 5a).q-PCR analysis revealed that these two transgenic lines accu-mulatedmuch higher levels of theGhGAI3a transcripts than theother three lines (3a-2, 3a-4, and 3a-5) (Fig. 5b). The latter threelines showed little morphological difference from thewt and thepBI121 control plants (Fig. 5a, c). In addition, the 3a-1 linewhich exhibited the more extreme dwarf phenotype than that of3a-3 also showed a higher level of GhGAI3a transcript than3a-3. These results suggest that the degree of dwarfism iscorrelated with the expression levels of GhGAI3a in the trans-genic Arabidopsis. TheGhGAI3a overexpression lines 3a-1 and3a-3 also hadmuch shorter stamens than control plants (Fig. 5c).Both of these overexpression lines were highly sterile, with amore severely reduced seed setting in 3a-1 than 3a-3 (Fig. 5c).

The transgenic lines were further analyzed to reveal theeffect of GhGAI3a overexpression on Arabidopsis develop-ment. To determine whether the GhGAI3a overexpressionlines show a reduced response to GA, we compared thehypocotyl length of the transgenic Arabidopsis seedlings withcontrol seedlings after GA3 treatment. Without GA3 treat-ment, the overexpression lines 3a-1 and 3a-3 showed 26.8%and 30.0% reduction in hypocotyl length, respectively, com-pared with control seedlings (p<0.01). The GA treatmentincreased the hypocotyl length of the control seedlings by136% (Fig. 6a, b). However, GA3-induced elongation of thehypocotyls in the GhGAI3a overexpression lines was signifi-cantly compromised: The hypocotyl length was 27.5% and86.5% longer in the GA-treated 3a-1 and 3a-3 lines, respec-tively, compared with the untreated seedlings (Fig. 6a, b).

Discussion

GAs are known to play a role in regulating fiber growth incotton (Beasley and Ting 1974; Chen et al. 1996; Gokani andThaker 2002; Seagull and Giavalis 2004; Xiao et al. 2010).DELLA proteins could function as a repressor in the GA-

a b

0

0.1

0.2

0.3

0.4

0.5

0.6

WT pBI121 3a-3 3a-1

hypo

coty

l len

gth

cm

MS

MS+GA

1022 Plant Mol Biol Rep (2012) 30:1014–1024

Fig. 6 The effect of GhGAI3a overexpression on hypocotyl elongation. a and b are comparison of hypocotyl length of the 35S::GhGAI3a lines andcontrol plants. Shown are 7-day-old seedlings grown on the MS medium under light with or without the GA3 treatment (b). Bar01 mm

mediated control of fiber growth. There are at least sevenDELLA-like proteins in cotton (Yang et al. 2006). We clonedfour DELLA-like genes (GhGAI3a, GhGAI3b, GhGAI4a,GhGAI4b) from allotetraploid cotton. Functions of theseDELLA-like genes have not been studied before. Expressionof these genes was found to be regulated during fiber initiationand elongation, suggesting that they could be involved in fiberdevelopment.

Allotetraploid cotton was originated from an inter-speciescross between a wild diploid cotton species with the Dgenome and a wild diploid cotton species with the A ge-nome. The wild species with the A genome but not thosewith D genome produce long fibers. The mechanism under-lying the difference in fiber production between these spe-cies remains elusive. Sequence comparison suggests thatGhGAI3a and GhGAI3b are evolutionally orthologous. Inthe allotetraploid cotton, GhGAI3a is apparently from the Dgenome, whereas GhGAI3b is from the A genome. GhGAI3aand GhGAI3b share a very high sequence identity (97.3%),and GhGAI3a and GhGAI3b showed very similar expressionpatterns. These results suggest that they might have retainedthe similar function. If so, they are apparently not responsiblefor the strikingly different fiber length between the cottonspecies with the A genome and the D genome. The genes thatmight play direct roles in controlling the different fiber elon-gation traits between the A genome species and the D genomespecies remain to be identified.

GhGAI3a showed a relatively high level of expression inthe ovules that undergo fiber initiation (-5~4DPA). Its tran-script level was strongly down-regulated in fiber cells duringthe early fiber elongation stage. This phenomenon mightsuggest that GhGAI3a needs to be suppressed for fiber elon-gation. GhGAI3b was also down-regulated during fiber elon-gation. The other four GhGAIs genes showed differentexpression patterns from GhGAI3s in allotetraploid cotton.GhGAI4a,GhGAI4b,GhRGL, andGhSLR1b have the highestexpression level during the elongation stage. The differentexpression patterns between GhGAI3s, GhGAI4s, GhRGL,and GhSLR1b indicate that they might play different roles infiber development and vegetative growth.

Transgenic Arabidopsis plants carrying the 35S::GhGAI3aconstruct exhibited growth retardation with smaller leaves,shorter stems, shorter stamens, and reduced apical domi-nance. In addition, the transgenic Arabidopsis showed adefect in GA-induced elongation of hypocotyls. Thesephenotypes mimic the mutants defective in GA-biosynthesisand signaling (Sun 2008). These results indicate thatGhGAI3a might act as a repressor of the GA signaling path-way when it is overexpressed in Arabidopsis, suggestingsignificant conservation of DELLA proteins fromArabidopsisto cotton. It remains to be elucidated whether any of theDELLA proteins acts as a repressor in GA-mediated fiberdevelopment in cotton.

Acknowledgements We would like to thank Prof. Kunbo Wang(Institute of Cotton Research, Chinese Academy of AgriculturalSciences) and Shaohui Li (Hainan Wild Cotton Plantation) for providingthe wild diploid cotton seeds. This work was supported by the NationalBasic Research 973 Program of China (grant # 2004CB117307 and2010CB126600 to M.P.) and the National Transgenic Animals & PlantsResearch Initiative (grant # 2009ZX08005-027B to M.P.).

References

Alabadi D, Gil J, Blazquez M, Garcia-Martinez J (2004) Gibberellinsrepress photomorphogenesis in darkness. Plant Physiol 134:1050–1057

Aleman L, Kitamura J, Abdel-mageed H, Lee J, Sun Y, Nakajima M,Ueguchi-Tanaka M, Matsuoka M, Allen RD (2008) Functionalanalysis of cotton orthologs of GA signal transduction factorsGID1 and SLR1. Plant Mol Biol 68:1–16

Barthelson RA, Qaisar U, Galbraith DW (2010) Functional analysis ofthe Gossypium arboreum genome. Plant Mol Biol Rep 28:334–343

Beasley CA, Ting IP (1974) The effects of plant growth substances onin vitro fiber development from unfertilized cotton ovules. Am JBot 61:188–194

Bolle C (2004) The role of GRAS proteins in plant signal transductionand development. Planta 218:683–692

Boss PK, Thomas MR (2002) Association of dwarfism and floralinduction with a grape ‘green revolution’ mutation. Nature 416:847–850

Chandler PM, Marion-Poll A, Ellis M, Gubler F (2002) Mutants at theSlender1 Locus of Barley cv Himalaya. Molecular and physio-logical characterization. Plant Physiol 129:181–190

Chen JG, Du XM, Zhao HY, Zhou X (1996) Fluctuation in levels ofendogenous plant hormones in ovules of normal and mutantcotton during flowering and their relation to fiber development.J Plant Growth Regul 15:173–177

Fleet DM, Sun TP (2005) A DELLAcate balance: the role of gibberellinin plant morphogenesis. Curr Opin Plant Biol 8:77–85

Foster T, Kirk C, Jones WT, Allan AC, Espley R, Karunairetnam S,Rakonjac J (2007) Characterisation of the DELLA subfamily inapple (Malus x domestica Borkh.). Tree Genet Genomes 3:187–197

Gokani SJ, Thaker VS (2002) Role of gibberellic acid in cotton fibredevelopment. J Agric Sci 138:255–260

Hussain A, Cao D, Cheng H, Wen Z, Peng J (2005) Identification ofthe conserved serine/threonine residues important for gibberellin-sensitivity of Arabidopsis RGL2 protein. Plant J 44:88–99

Ikeda A, Ueguchi-TanakeM, Sonoda Y, KitanoH, KoshiokaM, FutsuharaY, Matsuoka M, Yamaguchi J (2001) Slender rice, a constitutivegibberellin response mutant, is caused by a null mutation of theSLR1 gene, an ortholog of the height-regulating gene GAI/RGA/RHT/D8. Plant Cell 13:999–1010

Itoh H, Ueguchi-Tanaka M, Sato Y, Ashikari M, Matsuoka M (2002)The gibberellin signaling pathway is regulated by the appearanceand disappearance of SLENDER RICE1 in nuclei. Plant Cell14:57–70

Ji SJ, Lu YC, Feng JX, Wei G, Li J, Shi YH (2003) Isolation andanalyses of gene preferentially expressed during early cotton fiberdevelopment by subtractive PCR and cDNA array. Nucleic AcidsRes 31:2534–2543

John ME, Crow LJ (1992) Gene expression in cotton (Gossypiumhirsutum L.) fiber: cloning of the mRNAs. Proc Natl Acad Sci89:5769–5773

Plant Mol Biol Rep (2012) 30:1014–1024 1023

Lee S, Cheng H, King KE, Wang W, He Y, Hussain A, Lo J, HarberdNP, Peng J (2002) Gibberellin regulates Arabidopsis seed germi-nation via RGL2, a GAI/RGA-like gene whose expression is up-regulated following imbibition. Genes Dev 16:646–658

Lee JJ, Woodward AW, Chen ZJ (2007) Gene expression changes andearly events in cotton fibre development. Ann Bot 100:1391–1401

Li XB, Fan XP, Wang XL, Cai L, Yang WC (2005) The cotton ACTIN1gene is functionally expressed in fibers and participates in fiberelongation. Plant Cell 17:859–875

Li Y, Liu D, Tu L, Zhang X, Wang L, Zhu L, Tan J, Deng F (2010)Suppression of GhAGP4 gene expression repressed the initiationand elongation of cotton fiber. Plant Cell Rep 29:193–202

Liao WB, Ruan MB, Cui BM, Xu NF, Lu JJ, Peng M (2009) Isolationand characterization of a GAI/RGA-like gene from Gossypiumhirsutum. Plant Growth Regul 58:35–45

Luo M, Xiao Y, Li X, Lu X, Deng W, Li D, Hou L, Hu M, Li Y, Pei Y(2007) GhDET2, a steroid 5a-reductase, plays an important role incotton fiber cell initiation and elongation. Plant J 51:419–430

Meng XP, Li FG, Liu CL, Zhang CJ, Wu ZX, Chen YJ (2010) Isolationand characterization of an ERF transcription factor gene from cotton(Gossypium barbadense L.). Plant Mol Biol Rep 28:176–183

Nakajima M, Shimada A, Takashi Y, Kim YC, Park SH, Ueguchi-Tanaka M, Suzuki H, Katoh E, Luchi S, Kobayashi M, Maeda T,Matsuoka M, Yamaguchi I (2006) Identification and characteriza-tion of Arabidopsis gibberellin receptors. Plant J 46:880–889

Peng J, Carol P, Richards DE, King KE, Cowling RJ, Murphy GP,Harberd NP (1997) The Arabidopsis GAI gene defines a signalingpathway that negatively regulates gibberellin responses. GenesDev 11:3194–3205

Peng J, Richards DE, Hartley NM, Murphy GP, Devos KM, Flintham JE,Beales J, Fish LJ, Worland AJ, Pelica F, Sudhakar D, Christou P,Snape JW, Gale MD, Harberd NP (1999) “Green revolution” genesencodemutant gibberellin responsemodulators. Nature 400:256–261

Piskurewicz U, Molina LL (2009) The GA-signaling repressor RGL3represses testa rupture in response to changes in GA and ABAlevels. Plant Signal Behav 4:63–65

Pu L, Li Q, Fan X, Yang W, Xue Y (2008) The R2R3 MYB transcrip-tion factor GhMYB109 is required for cotton fiber development.Genetics 180:811–820

Pysh LD, Wysocka-Diller JW, Camilleri C, Bouchez D, Benfey PN(1999) The GRAS gene family in Arabidopsis: sequence charac-terization and basic expression analysis of the SCARECROW-LIKE genes. Plant J 18:111–119

Qin YM, Hu CY, Pang Y, Kastaniotis AJ, Hiltunen KJ, Zhu YX (2007)Saturated very-long-chain fatty acids promote cotton fiber andArabidopsis cell elongation by activating ethylene biosynthesis.Plant Cell 19:1–13

Richards DE, King KE, Ait-ali T, Harberd NP (2001) How gibberellinregulates plant growth and development: a molecular geneticanalysis of gibberellin signaling. Annu Rev Plant Physiol PlantMol Biol 52:67–88

Seagull RW, Giavalis S (2004) Pre- and post-anthesis application ofexogenous hormones alters fiber production in Gossypium hirsu-tum L. cultivar Maxxa GTO. The. J Cotton Sci 8:105–111

Shi YH, Zhu SW, Mao XZ, Feng JX, Qin YM, Zhang L, Cheng J,Wei LP, Wang ZY, Zhu YX (2006) Transcriptome profiling,

molecular biological, and physiological studies reveal a majorrole for ethylene in cotton fiber cell elongation. Plant Cell18:651–664

Silverstone AL, Ciampaglio CN, Sun TP (1998) The Arabidopsis RGAgene encodes a transcriptional regulator repressing the gibberellinsignal transduction pathway. Plant Cell 10:155–169

Sun TP (2008) Gibberellin metabolism, perception and signaling path-ways in Arabidopsis. The Arabidopsis book. The American So-ciety of Plant Biologists, Rockville

Sun TP, Gubler F (2004) Molecular mechanism of gibberellin signalingin plants. Ann Rev Plant Biol 55:197–223

Taliercio EW, Boykin D (2007) Analysis of gene expression in cottonfiber initials. BMC Plant Biol 7:1–13

Tu LL, Zhang XL, Liu DQ, Jin SX, Cao JL, Zhu LF, Deng FL, Tan JF,Zhang CB (2007) Screening of reference genes for quantitativereal time PCR in the process of fiber development and somaticembryo generation. Sci Rep 52:2379–2385

Tyler L, Thomas SG, Hu J, Dill A, Alonso JM, Ecker JR, Sun TP (2004)DELLA proteins and gibberellin-regulated seed germination andfloral development in Arabidopsis. Plant Physiol 135:1008–1019

Ueguchi-TanakaM, Ashikari M, NakajimaM, Itoh H, Katoh E, KobayashiM, Chow T, Hsing Y, Kitano H, Yamaguchi I, Matsuoka M (2005)Gibberellin insensitive Dwarf1 encodes a soluble receptor for gibber-ellin. Nature 437:693–698

Wang XQ, Ren GF, Li XM, Tu JL, Lin ZX, Zhang XL (2011) Devel-opment and evaluation of intron and insertion–deletion markersfor Gossypium barbadense. Plant Mol Biol Rep. doi:10.1007/s11105-011-0369-3

Wen CK, Chang C (2002) Arabidopsis RGL1 encodes a negativeregulator of gibberellin responses. Plant Cell 14:87–100

Wen W, Chen Q, Sun HY, Cui BM, Peng M (2011) Determination ofcollection standard of cotton ovules on different days beforeflowering. J Anhui Agric Sci 5:2611–2612

Willige BC, Ghosh S, Nill C, Zourelidou M, Dohmann EMN, Maier A,Schwechheimer C (2007) TheDELLAdomain ofGA INSENSITIVEmediates the interaction with the GA INSENSITIVE DWARF1Agibberellin receptor of Arabidopsis. Plant Cell 19:1209–1220

Xiao YH, Li DM, Yin MH, Li XB, Zhang M, Wang YJ, Dong J, ZhaoJ, Luo M, Luo XY, Hou L, Hu L, Pei Y (2010) Gibberellin 20-oxidase promotes initiation and elongation of cotton fibers byregulating gibberellin synthesis. J Plant Physiol 167:829–837

Yang SS, Cheung F, Lee JJ, HaM,Wei NE, Sze S, Stelly DM, Thaxton P,Triplett B, Town CD, Chen ZJ (2006) Accumulation of genome-specific transcripts, transcription factors and phytohormonal regu-lators during early stages of fiber cell development in allotetraploidcotton. Plant J 47:761–775

Zeng QW, Qin S, Song SQ, Zhang M, Xiao YH, Luo M, Hou L, Pei Y(2011) Molecular cloning and characterization of a cytokinindehydrogenase gene from upland cotton (Gossypium hirsutumL.). Plant Mol Biol Rep. doi:10.1007/s11105-011-0308-3

Zhang F, Liu X, Zuo KJ, Zhang JQ, Sun XF, Tang KX (2011a)Molecular cloning and characterization of a novel Gossypiumbarbadense L. RAD-like gene. Plant Mol Biol Rep 29:324–333

Zhang X, Zhen JB, Li ZH, Kang DM, Yang YM (2011b) Expressionprofile of early responsive genes under salt stress in upland cotton(Gossypium hirsutum L.). Plant Mol Biol Rep 29:626–637

1024 Plant Mol Biol Rep (2012) 30:1014–1024