For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For...
Transcript of For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For...
![Page 1: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/1.jpg)
For Peer Review O
nly
The LysR-type transcription factor PacR is a global regulator
of photosynthetic carbon assimilation in Anabaena
Journal: Environmental Microbiology and Environmental Microbiology Reports
Manuscript ID: EMI-2014-1511.R1
Manuscript Type: EMI - Research article
Journal: Environmental Microbiology
Date Submitted by the Author: 22-Jan-2015
Complete List of Authors: Picossi, Silvia; Consejo Superior de Investigaciones Científicas, Instituto de Bioq´uímica Vegetal y Fotosíntesis Flores, Enrique; Consejo Superior de Investigaciones Científicas, Instituto de Bioq´uímica Vegetal y Fotosíntesis Herrero, Antonia; Consejo Superior de Investigaciones Científicas, Instituto de Bioquímica Vegetal y Fotosíntesis
Keywords: bacteria, environmental signal/stress responses, gene expression/regulation
Wiley-Blackwell and Society for Applied Microbiology
![Page 2: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/2.jpg)
For Peer Review O
nly
1
The LysR-type transcription factor PacR is a global regulator of photosynthetic 1
carbon assimilation in Anabaena 2
3
Silvia Picossi, Enrique Flores and Antonia Herrero* 4
5
Instituto de Bioquímica Vegetal y Fotosíntesis, Consejo Superior de Investigaciones 6
Científicas and Universidad de Sevilla, Américo Vespucio 49, E-41092, Seville, Spain. 7
8
9
*Corresponding author. Tel.: +34 954489522. Fax: +34 954460165. E-mail address: 10
12
Keywords: ChIP; Cyanobacteria; Oxygenic phototrophy; Photoprotection; RuBisCo 13
14
Running title: Photosynthetic carbon assimilation regulator 15
16
Accession link to data: 17
http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=afcxwkacxpydfax&acc=GSE58861 18
19
20
21
22
Page 1 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 3: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/3.jpg)
For Peer Review O
nly
2
Summary 23
Cyanobacteria perform water-splitting photosynthesis and are important primary 24
producers impacting the carbon and nitrogen cycles at global scale. They fix CO2 25
through ribulose bisphosphate carboxylase/oxygenase (RuBisCo) and have 26
evolved a distinct CO2 concentrating mechanism (CCM) that builds high CO2 27
concentrations in the vicinity of RuBisCo favoring its carboxylase activity. 28
Filamentous cyanobacteria such as Anabaena fix CO2 in photosynthetic 29
vegetative cells, which donate photosynthate to heterocysts that rely on a 30
heterotrophic metabolism to fix N2. CCM elements are induced in response to 31
inorganic carbon limitation, a cue that exposes the photosynthetic apparatus to 32
photodamage by over-reduction. An Anabaena mutant lacking the LysR-type 33
transcription factor All3953 grows poorly and dies under high light. The rbcL 34
operon encoding RuBisCo is induced upon carbon limitation in the wild type but 35
not in the mutant. ChIP-Seq analysis was used to globally identify All3953 targets 36
under carbon limitation. Targets include, besides rbcL, genes encoding CCM 37
elements, photorespiratory pathway, photosystem- and electron transport-38
related components, and factors, including flavodiiron proteins, with a 39
demonstrated or putative function in photoprotection. qRT-PCR analysis of 40
selected All3953 targets showed regulation in the wild type but not in the mutant. 41
All3953 (PacR) is a global regulator of carbon assimilation in an oxygenic 42
photoautotroph. 43
44
45
Page 2 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 4: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/4.jpg)
For Peer Review O
nly
3
Introduction 46
As the organisms that developed oxygenic photosynthesis, cyanobacteria have played 47
a crucial role in Earth's history and the evolution of life in our planet. Indeed, the 48
production of O2 as a result of cyanobacterial activity was responsible for the oxidation 49
of the Earth's atmosphere about 2.5-2.3 billion years ago (Lyons et al., 2014). 50
Furthermore, all the extant plastids of eukaryotic algae and plants are of cyanobacterial 51
origin. Cyanobacteria were the first organisms to link the activity of the two types of 52
photosystems (PSI and PSII), which allowed the generation of high electrochemical 53
potential, and to combine them with a H2O-splitting complex. Nowadays, most 54
cyanobacteria are phototrophs relying on oxygenic photosynthesis to generate ATP 55
and reducing equivalents for the fixation of CO2 and the assimilation of inorganic 56
nitrogen. Indeed, they are responsible for an important fraction of the primary 57
productivity in the Earth's oceans, where they are important CO2 and N2 fixers, thus 58
impacting the C and N cycles at a global scale (Knoll 2008; Price et al., 2008). 59
The enzyme responsible for the bulk of CO2 fixation in the biosphere is ribulose-60
1,5-bisphosphate carboxylase/oxygenase (RuBisCo), which has a relatively low affinity 61
for CO2 and, moreover, it can also accept O2 as a substrate. Compensating for this 62
relatively low performance, RuBisCo is considered the most abundant enzyme on 63
Earth. As a carboxylase, RuBisCo catalyzes the first step of the Calvin-Benson-64
Bassham (CBB) cycle, i.e., the incorporation of atmospheric CO2 into ribulose-1,5-65
bisphosphate to give two molecules of 3-phosphoglycerate. As an oxygenase, it 66
catalyzes the incorporation of O2 into ribulose-bisphosphate, which produces 2-67
phosphoglycolate that leads to photorespiration with a subsequent loss of fixed C and 68
energy. To increase the efficiency of CO2 fixation, cyanobacteria have developed a 69
distinct CO2 concentrating mechanism (CCM) constituted by inorganic carbon (Ci) 70
transporters that incorporate bicarbonate and CO2 into the cell, and a proteinaceous 71
compartment, the carboxysome, where RuBisCo, together with carbonic anhydrase, is 72
Page 3 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 5: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/5.jpg)
For Peer Review O
nly
4
confined (Price et al., 2008; Cameron et al., 2014). Three high-affinitiy bicarbonate 73
transporters (the ABC-type Cmp, also called BCT1, and the Na+-dependent BicA and 74
SbtA), and two CO2 transporters (the high-affinity NDH-I3 and the low-affinity NDH-I4) 75
have been identified in different cyanobacteria (see Price, 2011). Through CCM, Ci in 76
the form of CO2 can concentrate in the vicinity of cyanobacterial RuBisCo, to allow high 77
specific activity for production of 3-phosphoglycerate to levels much higher than in 78
plants (Cameron et al., 2014). Indeed, components of cyanobacterial CCM have been 79
transformed in tobacco, with the result of improved specific activity of CO2 fixation, 80
which represents a step towards improved photosynthesis in plants (Lin et al., 2014). 81
In unicellular cyanobacteria, CCM elements are regulated by Ci availability. 82
Especially genes encoding Ci transporters are induced, whereas the structural genes 83
for carboxysome components and the rbcL/S genes encoding RuBisCo are only 84
moderately responsive (see Price et al., 2008; Cameron et al., 2014). In chemotrophic 85
bacteria the process of CO2 fixation and the response to Ci limitation are usually 86
controlled by LysR-type transcriptional regulators (LTTRs). The genes encoding the 87
enzymes of the CBB cycle are usually found in clusters regulated by CbbR factors, 88
which constitute a sub-family of LTTRs (Gibson and Tabita, 1996). In unicellular 89
cyanobacteria, a number of CbbR homologs have been characterized. CmpR is an 90
activator of the cmp genes (Nishimura et al., 2008), whereas CcmR (aka NdhR) acts as 91
a transcriptional repressor of multiple genes encoding other Ci transporters (e.g., Figge 92
et al., 2001; Wang et al., 2004). A third type of CbbR-like protein, the activator of the 93
RuBisCo genes, has not yet been identified in cyanobacteria. 94
Filamentous heterocyst-forming cyanobacteria, of which Anabaena sp. PCC 95
7120 (hereafter Anabaena) is a model organism, additionally have the capacity for cell 96
differentiation to turn some O2-evolving photosynthetic cells of the filament into 97
heterocysts, which are heterotrophic cells especialized in the fixation of atmospheric 98
N2. Thus, Anabaena is a truly pluricellular bacterium with different cell types specialized 99
in different nutritional tasks that exchange nutrients and regulators and contribute to 100
Page 4 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 6: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/6.jpg)
For Peer Review O
nly
5
the performance of the filament as the organism unit (see Flores and Herrero, 2010). 101
Nitrogen assimilation and heterocyst differentiation in Anabaena are regulated by the 102
global transcription factor NtcA, which responds to the cellular C-to-N ratio, and the 103
heterocyst-specific transcription factor HetR (see Herrero et al., 2013). The Anabaena 104
genomic sequence includes three genes annotated as CbbR-like LTTRs (Kaneko et 105
al., 2001). Of these, all0862 has been identified as cmpR, and its product activates the 106
expression of the cmp operon (alr2877-alr2880) and the cmpR gene itself in response 107
to Ci limitation (López-Igual et al., 2012). Notably, this regulation is effected in 108
combination with NtcA, thus revealing a mode of co-regulation by C and N availability 109
(López-Igual et al., 2012). Furthermore, in Anabaena the rbcLXS operon encoding 110
RuBisCo, which is moderately induced under Ci limitation (López-Igual et al., 2012), is 111
repressed in the heterocysts (Madan and Nierzwicki-Bauer, 1993), a regulation likely 112
exerted by NtcA (Ramasubramanian et al., 1994; Picossi et al., 2014). 113
Here we have identified the CbbR-homolog All3953 as the activator of the 114
RuBisCo-encoding operon in Anabaena. We have determined the All3953 regulon by 115
ChIP-Seq, which has revealed that All3953 is a global regulator for Ci assimilation 116
genes and genes involved in protection of the photosynthetic apparatus against 117
oxidative damage that are regulated by Ci availability. 118
119
Results 120
All3953, an RbcR-like factor in Anabaena sp. PCC 7120 121
To gain insight into the LTTR All3953 in Anabaena, the expression of the all3953 gene 122
under different growth conditions was analyzed by northern blot. Three bands of 123
hybridization corresponding to transcripts of ca. 1.9, 1.6 and 1.3 kb, respectively, which 124
appeared similarly represented before and after Ci limitation could be observed (Supp. 125
Fig. 1A). On the other hand, all3953 expression did not significantly respond to N 126
depletion (Supp. Fig. 1B). The latter result was consistent with previous global 127
Page 5 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 7: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/7.jpg)
For Peer Review O
nly
6
transcriptional studies (Ehira and Ohmori, 2006; Flaherthy et al., 2011) and with the 128
lack of binding associated to all3953 of the N-control transcriptional regulator NtcA 129
upon combined nitrogen depletion (Picossi et al., 2014). 130
131
Isolation and characterization of an all3953 mutant 132
To study the role of All3953, a mutant strain bearing an inactivated version of all3953 133
was constructed (see Experimental procedures). In strain CSS74 most of the all3953 134
gene was deleted and the C.S3 gene cassette (encoding Sm/Sp resistance) was 135
introduced to facilitate segregation and maintenance of the mutation in Anabaena 136
(Supp. Fig. 2A). As a control, strain CSS77 bearing the C.S3 gene cassette in the 137
Anabaena plasmid alpha was also constructed. For cis complementation, a wild-type 138
version of all3953 was transferred to strain CSS74 in an integrative plasmid, 139
generating strain CSS74C (Supp. Fig. 2A). 140
Strain CSS74 exhibited poor growth under standard growth conditions with 141
ammonium as a nitrogen source, and it formed short filaments in liquid medium, 142
whereas strain CSS74C behaved similarly to CSS77 (not shown). To quantify the 143
deleterious effect of the all3953 mutation, growth rates were calculated in liquid 144
medium under different illumination and Ci-supply conditions. Growth rate of the control 145
strain CSS77 was highest (0.892 days-1) under high light (HL) and high carbon (HC), 146
and was about 30% lower under the other tested conditions (Fig. 1A). In contrast, 147
growth of strain CSS74 was severely affected under HL HC conditions (growth rate ca. 148
70% lower than that of the control) (Fig. 1A), under which it ended up dying after about 149
5 days (Fig. 1B). Under HL and low carbon (LC) or low light (LL) HC, the defect was 150
close to 30% with regard to the control, although after prolonged incubation the mutant 151
was more severely affected under HL LC. The defect was the smallest (ca. 15%) under 152
LL LC conditions (Fig. 1A,B). In solid medium, growth of strain CSS74 was similar, and 153
similar to that of the control, in the presence of ammonium, nitrate or no combined 154
Page 6 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 8: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/8.jpg)
For Peer Review O
nly
7
nitrogen under LL LC conditions, whereas under HL LC a severe growth defect was 155
observed with regard to the control with any of the tested nitrogen sources (not shown). 156
In summary, the lack of All3953 had a deleterious effect on growth, especially under 157
HL (and HC) conditions. 158
To further characterize the growth defect of the all3953 mutant, the rate of 159
oxygen evolution using CO2 as a final electron acceptor was measured under different 160
illumination conditions in the CSS74 mutant in relation to the control strain CSS77. 161
When exponentially-growing cells were incubated for 24 h under LL HC, the oxygen 162
evolution rate was slightly lower in strain CSS74 in comparison to CSS77 (88 and 163
105 µmol O2�[mg Chl]-1�h-1, respectively). Under HL the difference between the two 164
strains was larger (167, for CSS77, and 110, for CSS74, µmol O2�[mg Chl]-1�h-1). 165
166
Effect of all3953 mutation on rbcLXS expression 167
To test the effect of the all3953 mutation on the expression of the rbcLXS operon, 168
northern blot analysis was performed with RNA isolated from cells of the control and 169
mutant strains grown with HC and transferred to LC conditions. After 1 h incubation 170
with LC, a ca. 2-fold increase in the amount of the rbcLXS transcripts could be 171
observed in the control strain. No induction could be detected in the mutant (Fig. 2). In 172
the complemented strain CSS74C the expression of rbcLXS increased in LC similarly 173
to the control (Fig. 2). These results indicated that the induction of the rbcLXS operon 174
upon Ci deficiency was dependent on All3953 and that the defect in strain CSS74 was 175
exclusively due to the lack of All3953. 176
177
ChIP-Seq analysis of the All3953 targets 178
To determine the DNA targets of All3953 at a genomic level, we used chromatin 179
immunoprecipitation followed by high-throughput sequencing analysis. To this end, we 180
constructed a strain (CSS57) expressing from the all3953 promoter a version of 181
Page 7 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 9: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/9.jpg)
For Peer Review O
nly
8
All3953 C-terminally fussed to TAP-tag (Rigaut et al., 1999), as well as a control strain 182
(CSS68) expressing the TAP-tag alone under the control of the all3953 promoter 183
(Supp. Fig. 2B, see Experimental procedures). Immunoprecipitation was carried out 184
using cells of strains CSS57 and CSS68 grown with ammonium as the nitrogen source 185
under HC conditions and incubated for 3 h with ammonium under LC conditions. 186
The analysis of the sequences resulted in a total of 142 All3953 binding 187
regions, of which 127 were located in the chromosome, 10 in plasmid alpha, three in 188
plasmid beta and two in plasmid gamma. Each binding region was ascribed to one or 189
two genes according to the location (midpoint) of the region, and the relative location 190
with respect to the assigned gene was also indicated (Table 1 and Supp. Table 1). A 191
total of 175 genes were ascribed to the 142 binding regions. The binding regions were 192
mostly located upstream of the ascribed genes (72%), whereas 21% were intragenic 193
and 7% were located downstream of genes. The results of the ChIP-Seq analysis are 194
available at GEO accession number GSE58861 195
(http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc= GSE58861). 196
The 175 ascribed genes were classified according to their functional category 197
(Table 2). Remarkably, there were 19 genes encoding proteins related to 198
photosynthesis and respiration, and 21 genes encoding regulatory proteins, including 199
All7179, a SigB homolog. The rest were mostly genes encoding hypothetical or 200
unknown proteins (42%), but also genes encoding proteins involved in translation, in 201
biosynthesis of amino acids and cofactors, prosthetic groups and carriers, in transport, 202
and in other cellular processes. Table 3 highlights All3953-binding regions related to 203
photosynthesis and respiration among which, confirming our results of gene 204
inactivation, the gene encoding the large subunit of the RuBisCo (rbcL; binding region 205
#37) is included. The fact that a high number of genes involved in photosynthesis and 206
C fixation, including rbcL, were identified as targets of RbcR suggests that this protein 207
is a global transcription factor for photosynthetic C assimilation. 208
Page 8 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 10: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/10.jpg)
For Peer Review O
nly
9
A CisFinder analysis of the primary consensus motif was carried out based on 209
142 high-confidence ChIP-Seq peak sequences (Fig. 3A). The consensus motif found 210
has a dyad-symmetry architecture and matches the consensus of LysR-recognition 211
binding sites (RBS) (T-N11-A) (Maddocks and Oyston, 2008), as well as the consensus 212
binding sites proposed for CbbR factors (TNA-N7/8-TNA). The primary motifs identified 213
in the central 100 nt of the binding regions are indicated in Supp. Table 1 (for some 214
binding regions more than one motif have been identified). 215
216
Expression analysis of some All3953 targets in Anabaena 217
To corroborate our ChIP-Seq analysis and to support the notion that All3953 is indeed 218
a global regulator for C fixation genes, the expression levels of some of the 219
photosynthesis- and C-fixation-related target genes, its response to Ci limitation and its 220
dependence on All3953 was further analyzed by qRT-PCR (Fig. 4). Strains CSS77 and 221
CSS74 were grown in ammonium and HC under standard light conditions (80 222
µE�m-2�s-1) at 30ºC up to the exponential phase. They were then transferred to medium 223
with ammonium under LC conditions. As previously shown by northern analysis, 224
transcription levels of the all3953 gene did not significantly change after Ci deprivation 225
in the control strain CSS77. As expected, all3953 transcript levels were not detectable 226
in CSS74, corroborating that the all3953 mutation was segregated in this strain. The 227
rbcL gene (alr1524) was 4.6-fold induced at 3 h after transfer to LC in strain CSS77, 228
whereas no induction was observed in CSS74, thus corroborating the dependence on 229
All3953. Interestingly, under HC the expression of rbcL in the mutant was higher than 230
in the control strain, suggesting that besides as an activator under LC, All3953 could 231
be acting as a repressor of rbcL under HC conditions. 232
ORF all4446 (flv4) was highly induced (about 100-fold), and its level was 233
maximum 1 h after the shift to LC (Fig. 4). In the all3953 mutant, the basal transcription 234
of all4446 in HC was about 8-fold lower than in the control strain, and it was only 235
Page 9 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 11: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/11.jpg)
For Peer Review O
nly
10
slightly induced (2-fold) upon the shift to LC. all3891 (flv1A) was induced about 6-fold 3 236
h after the shift to LC in the control strain, whereas only a 2-fold induction was 237
observed in the all3953 mutant. all1304 (bicarbonate transporter homolog) and alr4156 238
(NdhF homolog) were both highly induced (up to 30- and 20-fold, respectively) upon 239
transfer of strain CSS77 to LC. In contrast, no induction of alr4156 and only a small 240
induction of all1304 took place in strain CSS74. Expression of alr4592 (psbAIII) 241
increased about 5-fold upon Ci deprivation in CSS77, but did not appreciably change in 242
CSS74. The alr0223 (NdhA homolog) gene was about 2-fold induced under Ci 243
deprivation in CSS77 but not in CSS74. Finally, the expression of alr1004 (alanine-244
glyoxylate aminotransferase) was repressed by 5-fold under LC conditions in CSSL77 245
but not in CSS74. These results confirm that expression of the above studied genes is 246
regulated, either positively or negatively, by All3953. 247
248
Discussion 249
We have identified the LTTR All3953 as the activator of the RuBisCo-encoding genes 250
in the cyanobacterium Anabaena sp. PCC 7120. All3953 appears to activate the rbcL 251
operon under Ci limitation and to repress it when Ci is abundant. An LTTR factor 252
regulating the expression of the rbcL operon has not, to our knowledge, been 253
described in any cyanobacterium. The expression of all3953 does not respond to Ci 254
limitation (Supp. Fig. 1) and, indeed, no binding region of All3953 was found ascribed 255
to all3953. Thus, the all3953 gene seems to belong to the non-autoregulated LTTRs. 256
All3953 shares 28 and 26% identical residues with NdhR from Synechocystis sp. PCC 257
6803 and Synechococcus sp. PCC 7002 (CcmR), respectively. 258
By ChIP-Seq analysis of a strain bearing a TAP-tagged version of All3953, we 259
have determined 142 All3953-bound regions at 3 h after transfer from high to low Ci 260
conditions, which have been assigned to 177 genes. Apart from genes encoding 261
unknown or hypothetical proteins, the larger category is of genes encoding regulatory 262
Page 10 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 12: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/12.jpg)
For Peer Review O
nly
11
proteins, including the transcriptional regulators Alr0353 (a LTTR) and All4500 (CRP-263
like), the two-component response regulator All3348, the two-component sensor 264
histidine-kinase All1145 and the group 2-sigma 70-type sigma factor All7179 (Supp. 265
Table 1). Interestingly, when comparing to Synechocystis sigma factors, All7179 266
(SigB4) is more similar to SigB, which along with SigD has been shown to be important 267
for PSII recovery in this unicellular cyanobacterium (Pollari et al., 2009). All3953 also 268
binds upstream of genes patS and hetN, whose products regulate heterocyst 269
differentiation (Supp. Table 1). The fact that All3953 binds to the promoter region of 270
genes encoding other regulatory proteins suggests a wide role of this protein in the 271
physiology of the organism. 272
In the promoter region of the rbcL operon we have found three putative binding 273
sites for All3953, Box I, Box II, and Box III (Fig. 3B) that resemble the consensus 274
recognition sequence found by Cisfinder analysis (Fig. 3A). It is conceivable that, like in 275
some other LTTRs these boxes combine repression and activation sites. In this regard, 276
binding of All3953 to Box III, overlapping gene promoter elements, could be related to 277
the repression of rbcL observed under high Ci (Fig. 4). On the other hand, as 278
mentioned above, the rbcL operon is repressed in heterocysts by the global 279
transcriptional regulator NtcA, for which a binding site is found overlapping the operon 280
TSP (Ramasubramanian et al., 1994; Picossi et al., 2014) (Figure 3B). It is conceivable 281
that NtcA binding in these differentiated cells interfere with All3952-mediated activation. 282
Besides being the activator of the RuBisCo genes, All3953 targets include 283
genes involved in other processes related to carbon assimilation, such as Ci transport 284
(all1304, encoding an homolog of the BicA bicarbonate transporter; alr4156 encoding a 285
homolog of the NdhF3 subunit of the NDH-13 CO2 uptake system; and alr0869 286
encoding a homolog of the NdhF4 subunit of the NDH-14 CO2 uptake system); 287
components of the carboxysome shell (all0868, putative ccmK) and 2-288
phosphoglycolate metabolism (alr1004 and alr2873, possibly related to 289
photorespiration [Eisenhut et al., 2008]). Notably, All3953 targets include also a 290
Page 11 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 13: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/13.jpg)
For Peer Review O
nly
12
number of genes encoding photosystem components, such as alr5154 (psaA, 291
encoding the PSI core protein PsaA), alr3727 (psbAII, encoding a component of form II 292
of the PSII core protein PsbA [D1]), alr4592 (psbAIII, encoding another component of 293
form II of PsbA) and alr1216 (PSII 12 kD extrinsic protein PsbU), and genes related to 294
PS activity. In the latter group are alr4149 (biliverdin reductase, putatively involved in 295
phycobilisome -PSII antenna- synthesis), and genes that can participate in 296
photosynthetic electron transfer, such as alr0223 and alr0348 (ndhA and ndhD, 297
subunits of other putative NADH dehydrogenases), alr1576 (dehydrogenase subunit), 298
all0737 (thioredoxin reductase), all1365 (CytM cytochrome), all4148 (ferredoxin I), 299
all3891 and all4446 (flavodiiron proteins Flv1A and Flv4, respectively). (Besides in CO2 300
uptake, NdhF3 and NdhF4 can also participate in electron transfer.) 301
Reports on gene expression regulation by Ci are scarce for Anabaena. 302
However, in the unicellular cyanobacterium Synechocystis sp. PCC 6803 303
transcriptomic analysis has already shown down-regulation of some genes encoding 304
polypeptides of PSI and PSII complexes as well as of phycobilisome components, 305
upon transfer to Ci limitation conditions, likely as an adaptation to lower assimilatory 306
power demand, and up-regulation of some PSII core polypeptides, interpreted as 307
adaptation to conditions of shortage of electron acceptors that could lead to 308
photodamage and increased turnover of PS core components (Wang et al., 2004). Our 309
analysis extends the array of photosynthetic genes responding to Ci limitation, 310
remarkably to include the core PSI reaction center psaA gene. Moreover, except for 311
alr1004 that responds negatively, all the Anabaena photosynthetic genes mentioned 312
above increase expression upon the shift to Ci limitation. 313
Noteworthy, for the majority of photosynthetic gene targets of All3953 in 314
Anabaena, a function in protection against reactive oxygen species, which can be 315
generated by Ci limitation or exposure to HL, has either been described or could be 316
predicted. Thus, the psbAII and psbAIII genes are induced under HL in the unicellular 317
Synechococcus sp. PCC 7942, and cells cultured under HL showed more form II, and 318
Page 12 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 14: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/14.jpg)
For Peer Review O
nly
13
less form I (encoded by psbAI), of D1 compared to cells under LL (Schaefer and 319
Golden, 1989). Regarding flavodiiron proteins genes, flv1A, flv3A, and specially flv2 320
and flv4 of Anabaena have been shown up-regulated in vegetative cells in low Ci, and 321
flv1A and flv3A also in high light, whereas flv1B and flv3B are expressed exclusively in 322
heterocysts (Ermakova et al., 2013). Whereas Flv1A and Flv3A appear involved in 323
photoreduction of oxygen to water by removing excess electrons from PSI through 324
NAD(P)H dehydrogenases, Flv2 and Flv4 could have a role in photoprotection of PSII 325
under low Ci (Ermakova et al., 2013). Regarding photorespiration, it has also been 326
considered to have a role in removal of excess O2 (Eisenhut et al., 2008). To the best 327
of our knowledge, the regulator responsible for the response to Ci availability of any 328
photosynthetic gene has not been identified in cyanobacteria (oxygenic phototrophs). 329
Our ChIP-Seq and expression analysis indicate that All3953 is a regulator of 330
photosynthetic genes in Anabaena. 331
The growth rate of Anabaena is highest under HL HC conditions (Fig. 1), 332
implying that this cyanobacterium has mechanisms to get profit of HC while 333
counteracting HL stress. The all3953 mutant strain CSS74 exhibited a growth defect in 334
all the conditions tested, but especially under HL, where it ends-up dying (Fig. 1). This 335
shares the idea that in Anabaena All3953 is required to cope with HL stress. The effect 336
of the lack of All3953 seems more detrimental in relation to impaired photoprotection 337
than to impaired Ci scavenging (preference of the mutant for LL LC over HL HC 338
conditions). Indeed, even in LL, the mutant seems to perform slightly better with LC 339
than with HC (Fig. 1). Although LC could suppose a limitation of electron acceptors, an 340
increased rate of photorespiration under LC together with the fact that some of the 341
All3953 targets that could cope with excess oxygen are residually induced upon the 342
transfer from HC to LC in the CSS74 mutant (Fig. 4) could contribute to the preference 343
of this strain for LC over HC, especially under HL. 344
Our results show that in Anabaena the responses to Ci availability include 345
regulation of genes encoding elements of CCM and RuBisCo, but also of 346
Page 13 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 15: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/15.jpg)
For Peer Review O
nly
14
photosynthetic genes to adjust generation of assimilatory power while preserving the 347
photosynthetic apparatus from oxidative damage, which is specially relevant in 348
oxygenic phototrophs. Because All3953 is a transcriptional regulator globally 349
coordinating these responses, we have named it PacR (Photosynthetic assimilation of 350
carbon Regulator). 351
352
Experimental procedures 353
Strains 354
Anabaena sp. strain PCC 7120 was grown photoautrophically at 30°C with illumination 355
(80 µE�m-2�s-1) in liquid BG110 medium (Rippka et al., 1979) supplemented with 3 mM 356
NH4Cl, 6 mM TES buffer and 10 mM NaHCO3 and bubbled with a mixture of CO2 and 357
air (1% v/v) (HC). Other conditions used were no NaHCO3 supplement and bubbling 358
with air (LC); 12 µE�m-2�s-1 (LL); 175 µE�m-2�s-1 (HL). For the mutants generated in this 359
work, antibiotics were used at the following concentrations: Sm, 2 µg ml−1; Sp, 360
2 µg ml−1; and Nm, 25 µg ml−1 for bubbled cultures; and Sm, 5 µg ml−1; Sp, 5 µg ml−1; 361
and Nm, 40 µg ml−1 for cultures in solid medium. 362
363
Strain construction 364
To construct a mutant of the all3953 gene, the 5' and 3' end of the gene, along with the 365
flanking regions, were PCR amplified using chromosomal DNA of PCC 7120 as the 366
template and primers all3953-14 (BglII) and all3953-15 (SalI), and primers all3953-16 367
(SalI) and all3953-17 (PstI), respectively (all primers are specified in Supp. Table 2). 368
The PCR products were digested with SalI and ligated. The resulting mixture was used 369
as a template for overlapping PCR with primers all3953-14 and all3953-17. The new 370
PCR product was digested with BglII and PstI and ligated to the BglII-PstI-digested 371
pRL271 (Black et al., 1993), obtaining plasmid pCSS161. Plasmid pCSS161 was 372
digested with SpeI and the 2-kb Smr Spr gene cassette C.S3, excised with XbaI from 373
Page 14 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 16: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/16.jpg)
For Peer Review O
nly
15
pCSE120 [S.K3/L.HEH2 (BamHI)/C.S3 (BamHI); nomenclature as in (Elhai and Wolk, 374
1988)], was inserted obtaining plasmid pCSS162. Plasmid pCSS162 was transferred to 375
strain PCC 7120 by conjugation (Elhai et al., 1997). Exconjugants resistant to Sm and 376
Sp, which had the ∆all3953::C.S3 construct integrated by double recombination were 377
selected, obtaining strain CSS74. The segregation of the mutation was tested by PCR 378
(Supp. Fig. 2) with primers all3953-14, all3953-15, all3953-17 and all3953-20. 379
To construct a control strain expressing Smr and Spr plasmid pCSS163, a 380
derivative of plasmid pCSEL24 (Olmedo-Verd et al., 2006) containing the C.S3 gene 381
cassette, was transferred to Anabaena by conjugation. Exconjugants that had the 382
pCSS163 integrated in the alpha plasmid of Anabaena were selected, obtaining the 383
strain CSS77 (Supp. Fig. 2). 384
To complement the all3953 mutation of strain CSS74, a DNA fragment 385
encompassing the whole all3953 gene and sequences upstream from it was amplified 386
by PCR using the primer pair all3953-24/all3953-25, both including EcoRI sites, and 387
strain PCC 7120 DNA as the template. This fragment was cloned in the EcoRI site of 388
the mobilizable Nmr encoding vector pRL424 (Elhai and Wolk, 1988) producing plasmid 389
pCSS164, which was transferred to strain CSS74 by conjugation followed by selection 390
for Nmr. The genomic structure of the exconjugants in the all3953 region (Supp. Fig. 2) 391
was corroborated by PCR. 392
To construct a strain expressing All3953-C-TAP, the all3953 gene (including the 393
upstream region) was PCR-amplified with primers all3953-11 and all3953-12 and DNA 394
of PCC 7120 as the template. The TAP-tag was PCR-amplified with primers TAPtag-1 395
and TAPtag-2 using DNA of plasmid pBS1479 as the template (Puig et al., 2001). The 396
two PCR products were digested with SalI and ligated, after which the ligation product 397
was used as the template for an overlapping PCR using primers all3953-11 and 398
TAPtag-2. The PCR product was digested with PstI and ligated to the mobilizable 399
vector pCSV3 (Valladares et al., 2011) digested with PstI, rendering plasmid pCSS107. 400
Page 15 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 17: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/17.jpg)
For Peer Review O
nly
16
To construct a control strain with the TAP-tag under the control of the all3953 401
promoter, a 0.4-kb region upstream of all3953 was PCR-amplified using primers 402
all3953-11 and all3953-18 and DNA of pCSS107 as the template. The PCR product 403
was digested with SalI and ligated to the PCR-amplified TAP-tag digested with SalI, 404
after which the ligation product was used as the template for an overlapping PCR using 405
primers all3953-11 and TAPtag-2. The PCR product was digested with PstI and ligated 406
to PstI-digested pCSV3 to give plasmid pCSS157. Plasmids pCSS107 and pCSS157 407
were transferred by conjugation to strain PCC 7120 and single Smr Spr recombinants 408
were selected, obtaining strain CSS57 and CSS68, respectively. Western blots using 409
Peroxidase-Anti-Peroxidase Soluble Complex (PAP, Sigma-Aldrich) were performed to 410
ensure that the two strains expressed the TAP-tag (Supp. Fig. 2B). 411
412
Chromatin immunoprecipitation 413
Cells of strains CSS57 growing exponentially (3-5 µg Chl�ml-1) in the light (80 414
µE�m-2�s-1) in medium supplemented with 2 µg�ml-1 Sm and Sp, in HC conditions were 415
incubated with LC for 3 h. Formaldehyde was then added to the cultures to a final 416
concentration of 1%, and the cultures were incubated for 15 min. Glycine was added at 417
125 mM final concentration and the incubation was continued for 5 min to stop the 418
fixing reaction. The cells were then filtered, washed with cold TBS (20 mM Tris-HCl, pH 419
7.4, 140 mM NaCl) and collected in tubes (25 ml of culture per tube). The pellets were 420
frozen in liquid nitrogen and stored at -20°C until used. Pellets corresponding to about 421
25 ml of culture were resuspended in 500 µl of lysis buffer (50 mM HEPES-KOH, pH 422
7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 423
supplemented with Mini EDTA-free protease inhibitor cocktail [Roche]) and, after 424
addition of 150 µl of glass beads (acid-washed, 425-600 µm [Sigma]), the cells were 425
broken in a multivortexer at 2,000 rpm for 1 h at 4°C. The cell lysates were collected by 426
centrifugation and the extracts were subjected to sonication to shear the DNA to about 427
300-bp fragments (60 cycles of 10 s, 20 s ice, 15% amplitude, in a Branson Digital 428
Page 16 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 18: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/18.jpg)
For Peer Review O
nly
17
Sonifier). After centrifugation to eliminate cell debris, the whole-cell extracts were 429
stored at −20°C or immediately used for immunoprecipitation. 430
Immunoprecipitation of DNA was carried out as described (Picossi et al., 2014), 431
with some modifications. Whole-cell extracts were prepared at 4 mg�ml-1 of total protein 432
with lysis buffer (in 500 µl total volume). A 50-µl sample was taken as the input sample, 433
and the extracts were incubated with 15 µl IgG-conjugated Dynabeads (about 6 µg 434
IgG) at 4ºC with rotation for 12-14h. The washes of the Dynabeads, as well as the 435
elution of the immunoprecipitated material, the crosslinking reversion and the isolation 436
of the DNA were performed as in (Picossi et al., 2014). 437
438
Massive sequencing of the immunoprecipitated DNA 439
Input and ChIP DNA samples were sent for sequencing to the Functional Genomics 440
Core Facility of the Institute for Research in Biomedicine, Barcelona (Spain). Next 441
generation sequencing was carried out using Illumina’s sequencing technology. ChIP 442
DNA Sample Prep Kit (Illumina) was used for library preparation. Libraries were loaded 443
at 8 pM concentration into the flow cell using the Cluster Station running recipe V7 with 444
the Single-Read Cluster Generation Kit v4 (all Illumina). The flow cell was loaded into 445
the Genome Analyzer II and samples were sequenced for 120 nucleotides from a 446
single end using the Sequencing Kit v5 and recipe v8 (all Illumina). Manufacturer’s 447
recommendations were strictly followed. Illumina sequencing data were pre-processed 448
with the standard Illumina pipeline version 1.5 and sequences were aligned to the PCC 449
7120 genome (http://genome.microbedb.jp/cyanobase/Anabaena) with the Bowtie 450
software 0.12.5 (Langmead et al., 2009). The analysis of the results were carried out 451
using the Triform algorithm (Kornacker et al., 2012) as in (Picossi et al., 2014). The 452
sequences in the ChIP samples of strain CSS68 (TAP control) were used as the 453
background of the sequences found for strain CSS57 (All3953-TAP), and thus to 454
determine the specific binding regions of All3953-TAP in the genome of Anabaena. 455
Page 17 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 19: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/19.jpg)
For Peer Review O
nly
18
The binding regions were visualized and analyzed using the UCSC Microbial Genome 456
Browser (Scheneider et al., 2006). They were ascribed to one or two genes, in case it 457
was not possible to ascribe them to only one, and classified as upstream of the gene, if 458
the midpoint of the binding region was located upstream of the start of the gene, 459
internal, if the midpoint of the binding region was inside the gene, or downstream, if the 460
midpoint of the binding region was located downstream of the end of the gene to which 461
it had been ascribed. 462
463
Northern and qRT-PCR analyses 464
Isolation of total RNA from Anabaena was done as described previously (Mohamed 465
and Jansson, 1989). Northern analysis was performed as described previously (López-466
Igual et al., 2012). 467
For qRT-PCR, 750 ng of DNA-free RNA samples were used for all the PCR 468
primer pairs. For the RT reaction, the Quantitech Reverse transcription kit (Qiagen), 469
with the Random Hexamer Primer mix (100 ng per sample) (Bioline) was used. The 470
cDNA produced was diluted 7.5 times to use 2 µl of cDNA per PCR reaction. PCR was 471
done using the Quantimix Easy SYG Kit (Biotools) (SYBR green I) in a iCycler iQ Multi-472
Color Real Time PCR Detection System (Bio-Rad). The abundance of a transcript in 473
the RNA sample was calculated as: abundance= 2^[Ct(sample)-Ct(control)], where the 474
RNA sample of the control strain CSS77 in HC condition (0) was used as the control. 475
476
Oxygen evolution 477
2-ml samples of exponentially grown cultures in HC LL or HC HL conditions were used 478
to measure O2 evolution with an O2 electrode calibrated with culture medium and 479
Na2S2O4 as the reducing agent. O2 production was measured in the light (400 480
µE�m-2�s-1) after a seven-minute incubation in the dark. 481
482
Page 18 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 20: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/20.jpg)
For Peer Review O
nly
19
Acknowledgments 483
This work was supported by grants BFU2010-17980 and BFU2013-44686-P from the 484
Spanish government, co-financed by FEDER. The authors are grateful to K. Kornacker 485
for carrying out the Triform and CisFinder analyses, and to H. Auer and I. Pons, from 486
the Functional Genomics Core Facility of the IRB, Barcelona (Spain); to F. Monje-487
Casas and Yagut Allahverdiyeva-Rinne for critical reading of the manuscript and to M. 488
J. Huertas and A. Torrado for help with O2 production measurements. 489
490 REFERENCES 491 492 Black, T.A., Cai, Y., and Wolk C.P. (1993) Spatial expression and autoregulation of 493
hetR, a gene involved in the control of heterocyst development in Anabaena. Mol 494 Microbiol 9: 77-84. 495
Cameron, C.J., Sutter, M., and Kerfeld, C.A. (2014) The carboxysome: Function, 496 structure and cellular dynamics. The Cell Biology of Cyanobacteria, eds. Flores E, 497 Herrero A (Caister Academic Press, Norfolk), pp. 171-188. 498
Ehira, S., and Ohmori, M, (2006) NrrA, a nitrogen-responsive response regulator 499 facilitates heterocyst development in the cyanobacterium Anabaena sp. strain PCC 500 7120. Mol Microbiol 59: 1692-1703. 501
Elhai., J., Vepritskiy, A., Muro-Pastor, A.M., Flores, E, and Wolk, C.P. (1997) Reduction 502 of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain 503 PCC 7120. J Bacteriol 179: 1998-2005. 504
Eisenhut, M., Ruth, W., Haimovich, M., Bauwe, H., Kaplan, A., and Hagemann, M. 505 (2008) The photorespiratory glycolate metabolism is essential for cyanobacteria and 506 might have been conveyed endosymbiotically to plants. Proc Natl Acad Sci USA 507 105: 17199-17204. 508
Elhai, J., and Wolk, C.P. (1988) A versatile class of positive-selection vectors based on 509 the nonviability of palindrome-containing plasmids that allows cloning into long 510 polylinkers. Gene 68: 119-138. 511
Ermakova, M., Battchikova, N., Allahverdiyeva, Y., and Aro, E.M. (2013) Novel 512 heterocyst-specific flavodiiron proteins in Anabaena sp. PCC 7120. FEBS Lett 587: 513 82-7. 514
Figge, R.M., Cassier-Chauvat, C., Chauvat, F., and Cerff, R. (2001) Characterization 515 and analysis of an NAD(P)H dehydrogenase transcriptional regulator critical for the 516 survival of cyanobacteria facing inorganic carbon starvation and osmotic stress. Mol 517 Microbiol 39: 455-68. 518
Flaherty, B.L., Van Nieuwerburgh, F., Head, S.R., and Golden, J.W. (2011) Directional 519 RNA deep sequencing sheds new light on the transcriptional response of Anabaena 520 sp. strain PCC 7120 to combined-nitrogen deprivation. BMC Genomics 12: 332. 521
Flores, E., and Herrero, A. (2010) Compartmentalized function through cell 522 differentiation in filamentous cyanobacteria. Nat Rev Microbiol 8: 39-50. 523
Gibson, J.L., and Tabita, F.R. (1996) The molecular regulation of the pentose 524 phosphate pathway in proteobacteria and cyanobacteria. Arch Microbiol 166: 141-525 150. 526
Herrero, A., Picossi, S., and Flores, E. (2013) Gene Expression during heterocyst 527 differentiation. Adv Bot Res 65: 281-329. 528
Page 19 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 21: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/21.jpg)
For Peer Review O
nly
20
Kaneko, T., Nakamura, Y., Wolk, C.P., Kuritz, T., Sasamoto, S., and Watanabe, A. 529 (2001) Complete genomic sequence of the filamentous nitrogen-fixing 530 cyanobacterium Anabaena sp. strain PCC 7120. DNA Res 8: 205-213. 531
Knoll, A.H. (2008) Cyanobacteria and Earth history. The Cyanobacteria: Molecular 532 Biology, Genomics and Evolution, eds. Herrero A, Flores E (Caister Academic 533 Press, Norfolk), pp. 1-19. 534
Kornacker, K., Rye, M.B., Handstad, T., and Drablos, F. (2012) The Triform algorithm: 535 improved sensitivity and specificity in ChIP-Seq peak finding. BMC Bioinformatics 536 13: 176. 537
Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009) Ultrafast and memory-538 efficient alignment of short DNA sequences to the human genome. Genome Biol 10: 539 R25. 540
Lin, M.T., Occhialini, A., Andralojc, P.J., Parry, M.A.J., and Hanson, M.R. (2014) A 541 faster Rubisco with potential to increase photosynthesis in crops. Nature 513: 547-542 550. 543
López-Igual, R., Picossi, S., López-Garrido, J., Flores, E., and Herrero, A. (2012) N 544 and C control of ABC-type bicarbonate transporter Cmp and its LysR-type 545 transcriptional regulator CmpR in a heterocyst-forming cyanobacterium, Anabaena 546 sp. Environ Microbiol 14: 1035-1048. 547
Lyons, T.W., Reinhard, C.T., and Planavsky, N.J. (2014) The rise of oxygen in Earth's 548 early ocean and atmosphere. Nature 506: 307-315. 549
Madan, A.P., and Nierzwicki-Bauer, S.A. (1993) In situ detection of transcripts for 550 ribulose-1,5-bisphosphate carboxylase in cyanobacterial heterocysts. J Bacteriol 551 175: 7301-7306. 552
Maddocks, S.E., and Oyston, P.C. (2008) Structure and function of the LysR-type 553 transcriptional regulator (LTTR) family proteins. Microbiology 154: 3609-3623. 554
Mohamed, A., and Jansson, C. (1989) Influence of light on accumulation of 555 photosynthesis-specific transcripts in the cyanobacterium Synechocystis 6803. Plant 556 Mol Biol 13: 693-700. 557
Nierzwicki-Bauer, S.A., Curtis, S.E., and Haselkorn, R. (1984) Cotranscription of genes 558 encoding the small and large subunits of ribulose-1,5-bisphosphate carboxylase in 559 the cyanobacterium Anabaena 7120. Proc Natl Acad Sci USA 81: 5961-5965. 560
Nishimura, T., Takahashi, Y., Yamaguchi, O., Suzuki, H., Maeda, S., and Omata, T. 561 (2008) Mechanism of low CO2-induced activation of the cmp bicarbonate transporter 562 operon by a LysR family protein in the cyanobacterium Synechococcus elongatus 563 strain PCC 7942. Mol Microbiol 68: 98-109. 564
Olmedo-Verd, E., Muro-Pastor, A.M., Flores, E., and Herrero, A. (2006) Localized 565 induction of the ntcA regulatory gene in developing heterocysts of Anabaena sp. 566 strain PCC 7120. J Bacteriol 188: 6694-6649. 567
Picossi, S., Flores, E. and Herrero, A. (2014) ChIP analysis unravels an exceptionally 568 wide distribution of DNA binding sites for the NtcA transcription factor in a 569 heterocyst-forming cyanobacterium. BMC Genomics 15: 22. 570
Pollari, M., Ruotsalainen, V., Rantamaki, S., Tyystjarvi, E., and Tyystjarvi, T. (2009). 571 Simultaneous inactivation of sigma factors B and D interferes with light acclimation 572 of the cyanobacterium Synechocystis sp. strain PCC 6803. J Bacteriol 191: 3992-573 4001. 574
Puig, O., Caspary, F., Rigaut, G., Rutz, B., Bouveret, E., Bragado-Nilsson, E., Wilm, 575 M., and Seraphin, B. (2001) The tandem affinity purification (TAP) method: a 576 general procedure of protein complex purification. Methods 24: 218-229. 577
Price, G.D., Badger, M.R., Woodger, F.J., and Long, B.M. (2008). Advances in 578 understanding the cyanobacterial CO2-concentrating-mechanism (CCM): functional 579 components, Ci transporters, diversity, genetic regulation and prospects for 580 engineering into plants. J Exp Bo. 59: 1441-1461. 581
Price, G.D. (2011) Inorganic carbon transporters of the cyanobacterial CO2 582 concentrating mechanism. Photosynth Res 109: 47-57. 583
Page 20 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 22: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/22.jpg)
For Peer Review O
nly
21
Ramasubramanian, T.S., Wei, T.-F. and Golden, J.W. (1994) Two Anabaena sp. strain 584 PCC 7120 DNA-binding factors interact with vegetative cell- and heterocyst-specific 585 genes. J Bacteriol 176: 1214-1223. 586
Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Seraphin, B. (1999) A 587 generic protein purification method for protein complex characterization and 588 proteome exploration. Na. Biotechnol 17: 1030-1032. 589
Rippka, R., Deruelles, J., Waterbury, J.B., Herdman, M., and Stanier, R.Y. (1979) 590 Generic assignments, strain stories and properties of pure cultures of 591 cyanobacteria. J Gen Microbiol 111: 1-61. 592
Schaefer, M.R., and Golden, S.S. (1989) Differential expression of members of a 593 cyanobacterial psbA gene family in response to light. J Bacteriol 171: 3973-3781. 594
Scheneider, K.L., Pollard, K.S., Baertsch, R., Pohl, A., and Lowe, T.M. (2006) The 595 UCSC archaeal genome browser. Nucleic Ac Res 34: D407–D410. 596
Valladares, A., Rodríguez, V., Camargo, S., Martínez-Nöel, G.M., Herrero, A., and 597 Luque, I. (2011) Specific role of the cyanobacterial PipX factor in the heterocysts of 598 Anabaena sp. strain PCC 7120. J Bacteriol 193(5): 1172-1182. 599
Wang, H.L., Postier, B.L., and Burnap, R.L. (2004) Alterations in global patterns of 600 gene expression in Synechocystis sp. PCC 6803 in response to inorganic carbon 601 limitation and the inactivation of ndhR, a LysR family regulator. J Biol Chem 279: 602 5739-5751. 603
604 605
606
Page 21 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 23: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/23.jpg)
For Peer Review O
nly
22
Figure legends: 607
Fig. 1. Growth of the all3953 mutant. A, The growth rate constant (µ = ln2/td, where td is 608
the doubling time) was calculated from the increase of protein content determined in 609
0.2 ml samples of cultures. The table shows the mean and standard deviation from 3 610
independent cultures of each strain and condition. ∆all3953 is strain CSS74; CSS77 is 611
a control strain that carries the Sm/Sp-resistant determinant in a wild-type background. 612
B, Samples of cultures were photographed after 5 days of incubation under the 613
indicated conditions. HL, high light; LL, low light; HC, high carbon; LC, low carbon. 614
615
Fig. 2. Expression of rbcLXS in the ∆all3953 mutant and complemented strain. 616
Northern analysis carried out with RNA from strains CSS77 (control) CSS74 (∆all3953) 617
and CSS74C (CSS74 complemented) was isolated from cells grown with HC (0) and 618
incubated for 1h (1) with LC. The membranes were hybridized with an internal 619
fragment of the rbcL gene (upper panels) and, as a loading and transfer control, of the 620
rnpB gene (lower panels). Arrowheads point to the main transcripts detected with the 621
rbcL gene probe (approximate sizes are indicated). 622
623
Fig. 3. Consensus All3953 binding sequence and rbcL promoter. A, The primary 624
consensus motif based on 142 high confidence CSS57 ChIP-Seq peak sequences is 625
shown with indication of the probability of occurrence of each base along the 22-nt 626
sequence. W is A or T; Y is C or T; B is C, G or T. B, Structure of the rbcLXS promoter 627
region. The transcription initiation point of the operon (+1) and the -10 and -35 boxes 628
(from Nierzwicki-Bauer et al., 1984) are indicated in red. The NtcA-binding site 629
(GTAN8TAC) is indicated in green, and the three putative binding sites for All3953 (Box 630
I, Box II and Box III) are indicated in blue. 631
632
Page 22 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 24: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/24.jpg)
For Peer Review O
nly
23
Fig. 4. qRT-PCR analysis of the expression of selected photosynthesis and respiration-633
related All3953 gene targets. Transcriptional response of the indicated genes to Ci 634
limitation in the control (CSS77) and ∆all3953 mutant (CSS74) strains was 635
investigated. RNA was isolated from cells grown with 10 mM NaHCO3-supplemented 636
medium bubbled with 1%CO2 in air (0) incubated for 1 h (1) or 3 h (3) in NaHCO3-free 637
medium bubbled with air. Bars represent the mean transcript levels (± standard 638
deviation) in three independent experiments. 639
640
Page 23 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 25: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/25.jpg)
For Peer Review O
nly
1
The LysR-type transcription factor PacR is a global regulator of photosynthetic 1
carbon assimilation in Anabaena 2
3
Silvia Picossi, Enrique Flores and Antonia Herrero* 4
5
Instituto de Bioquímica Vegetal y Fotosíntesis, Consejo Superior de Investigaciones 6
Científicas and Universidad de Sevilla, Américo Vespucio 49, E-41092, Seville, Spain. 7
8
9
*Corresponding author. Tel.: +34 954489522. Fax: +34 954460165. E-mail address: 10
12
Keywords: ChIP; Cyanobacteria; Oxygenic phototrophy; Photoprotection; RuBisCo 13
14
Running title: Photosynthetic carbon assimilation regulator 15
16
Accession link to data: 17
http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=afcxwkacxpydfax&acc=GSE58861 18
19
20
21
22
Page 24 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 26: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/26.jpg)
For Peer Review O
nly
2
Summary 23
Cyanobacteria perform water-splitting photosynthesis and are important primary 24
producers impacting the carbon and nitrogen cycles at global scale. They fix CO2 25
through ribulose bisphosphate carboxylase/oxygenase (RuBisCo) and have 26
evolved a distinct CO2 concentrating mechanism (CCM) that builds high CO2 27
concentrations in the vicinity of RuBisCo favoring its carboxylase activity. 28
Filamentous cyanobacteria such as Anabaena fix CO2 in photosynthetic 29
vegetative cells, which donate photosynthate to heterocysts that rely on a 30
heterotrophic metabolism to fix N2. CCM elements are induced in response to 31
inorganic carbon limitation, a cue that exposes the photosynthetic apparatus to 32
photodamage by over-reduction. An Anabaena mutant lacking the LysR-type 33
transcription factor All3953 grows poorly and dies under high light. The rbcL 34
operon encoding RuBisCo is induced upon carbon limitation in the wild type but 35
not in the mutant. ChIP-Seq analysis was used to globally identify All3953 targets 36
under carbon limitation. Targets include, besides rbcL, genes encoding CCM 37
elements, photorespiratory pathway, photosystem- and electron transport-38
related components, and factors, including flavodiiron proteins, with a 39
demonstrated or putative function in photoprotection. qRT-PCR analysis of 40
selected All3953 targets showed regulation in the wild type but not in the mutant. 41
All3953 (PacR) is a global regulator of carbon assimilation in an oxygenic 42
photoautotroph. 43
44
45
Page 25 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 27: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/27.jpg)
For Peer Review O
nly
3
Introduction 46
As the organisms that developed oxygenic photosynthesis, cyanobacteria have played 47
a crucial role in Earth's history and the evolution of life in our planet. Indeed, the 48
production of O2 as a result of cyanobacterial activity was responsible for the oxidation 49
of the Earth's atmosphere about 2.5-2.3 billion years ago (Lyons et al., 2014). 50
Furthermore, all the extant plastids of eukaryotic algae and plants are of cyanobacterial 51
origin. Cyanobacteria were the first organisms to link the activity of the two types of 52
photosystems (PSI and PSII), which allowed the generation of high electrochemical 53
potential, and to combine them with a H2O-splitting complex. Nowadays, most 54
cyanobacteria are phototrophs relying on oxygenic photosynthesis to generate ATP 55
and reducing equivalents for the fixation of CO2 and the assimilation of inorganic 56
nitrogen. Indeed, they are responsible for an important fraction of the primary 57
productivity in the Earth's oceans, where they are important CO2 and N2 fixers, thus 58
impacting the C and N cycles at a global scale (Knoll 2008; Price et al., 2008). 59
The enzyme responsible for the bulk of CO2 fixation in the biosphere is ribulose-60
1,5-bisphosphate carboxylase/oxygenase (RuBisCo), which has a relatively low affinity 61
for CO2 and, moreover, it can also accept O2 as a substrate. Compensating for this 62
relatively low performance, RuBisCo is considered the most abundant enzyme on 63
Earth. As a carboxylase, RuBisCo catalyzes the first step of the Calvin-Benson-64
Bassham (CBB) cycle, i.e., the incorporation of atmospheric CO2 into ribulose-1,5-65
bisphosphate to give two molecules of 3-phosphoglycerate. As an oxygenase, it 66
catalyzes the incorporation of O2 into ribulose-bisphosphate, which produces 2-67
phosphoglycolate that can leads to photorespiration with a subsequent loss of fixed C 68
and energy. To increase the efficiency of CO2 fixation, cyanobacteria have developed a 69
distinct CO2 concentrating mechanism (CCM) constituted by inorganic carbon (Ci) 70
transporters that incorporate bicarbonate and CO2 into the cell, and a proteinaceous 71
compartment, the carboxysome, where RuBisCo, together with carbonic anhydrase, is 72
Page 26 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 28: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/28.jpg)
For Peer Review O
nly
4
confined (Price et al., 2008; Cameron et al., 2014). Three high-affinitiy bicarbonate 73
transporters (the ABC-type Cmp, also called BCT1, and the Na+-dependent BicA and 74
SbtA), and two CO2 transporters (the high-affinity NDH-I3 and the low-affinity NDH-I4) 75
have been identified in different cyanobacteria (see Price, 2011). Through CCM, Ci in 76
the form of CO2 can concentrate in the vicinity of cyanobacterial RuBisCo, to allow high 77
specific activity for production of 3-phosphoglycerate to levels much higher than in 78
plants (Cameron et al., 2014). Indeed, components of cyanobacterial CCM have been 79
transformed in tobacco, with the result of improved specific activity of CO2 fixation, 80
which represents a step towards improved photosynthesis in plants (Lin et al., 2014). 81
In unicellular cyanobacteria, CCM elements are regulated by Ci availability. 82
Especially genes encoding Ci transporters are induced, whereas the structural genes 83
for carboxysome components and the rbcL/S genes encoding RuBisCo are only 84
moderately responsive (see Price et al., 2008; Cameron et al., 2014). In chemotrophic 85
bacteria the process of CO2 fixation and the response to Ci limitation are usually 86
controlled by LysR-type transcriptional regulators (LTTRs). The genes encoding the 87
enzymes of the CBB cycle are usually found in clusters regulated by CbbR factors, 88
which constitute a sub-family of LTTRs (Gibson and Tabita, 1996). In unicellular 89
cyanobacteria, a number of CbbR homologs have been characterized. CmpR is an 90
activator of the cmp genes (Nishimura et al., 2008), whereas CcmR (aka NdhR) acts as 91
a transcriptional repressor of multiple genes encoding other Ci transporters (e.g., Figge 92
et al., 2001; Wang et al., 2004). A third type of CbbR-like protein, the activator of the 93
RuBisCo genes, has not yet been identified in cyanobacteria. 94
The identification of a third type of CbbR-like protein, the activator of the RuBisCo 95
genes, RbcR, has remained elusive in cyanobacteria. 96
Filamentous heterocyst-forming cyanobacteria, of which Anabaena sp. PCC 97
7120 (hereafter Anabaena) is a model organism, additionally have the capacity for cell 98
differentiation to turn some O2-evolving photosynthetic cells of the filament into 99
heterocysts, which are heterotrophic cells especialized in the fixation of atmospheric 100
Page 27 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 29: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/29.jpg)
For Peer Review O
nly
5
N2. Thus, Anabaena is a truly pluricellular bacterium with different cell types specialized 101
in different nutritional tasks that exchange nutrients and regulators and contribute to 102
the performance of the filament as the organism unit (see Flores and Herrero, 2010). 103
Nitrogen assimilation and heterocyst differentiation in Anabaena are regulated by the 104
global transcription factor NtcA, which responds to the cellular C-to-N ratio, and the 105
heterocyst-specific transcription factor HetR (see Herrero et al., 2013). The Anabaena 106
genomic sequence includes three genes annotated as CbbR-like LTTRs (Kaneko et 107
al., 2001). Of these, all0862 has been identified as cmpR, and its product activates the 108
expression of the cmp operon (alr2877-alr2880) and the cmpR gene itself in response 109
to Ci limitation (López-Igual et al., 2012). Notably, this regulation is effected in 110
combination with NtcA, thus revealing a mode of co-regulation by C and N availability 111
(López-Igual et al., 2012). Furthermore, in Anabaena the rbcLXS operon encoding 112
RuBisCo, which is moderately induced under Ci limitation (López-Igual et al., 2012), is 113
repressed in the heterocysts (Madan and Nierzwicki-Bauer, 1993), a regulation likely 114
exerted by NtcA (Ramasubramanian et al., 1994; Picossi et al., 2014). 115
Here we have identified the CbbR-homolog All3953 as the activator of the 116
RuBisCo-encoding operon in Anabaena. We have determined the All3953 regulon by 117
ChIP-Seq, which has revealed that All3953 is a global regulator for Ci assimilation 118
genes and genes involved in protection of the photosynthetic apparatus against 119
oxidative damage that are regulated by Ci availability. 120
121
Results 122
All3953, an RbcR-like factor in Anabaena sp. PCC 7120 123
To gain insight into the LTTR All3953 in Anabaena, the expression of the all3953 gene 124
under different growth conditions was analyzed by northern blot. Three bands of 125
hybridization corresponding to transcripts of ca. 1.9, 1.6 and 1.3 kb, respectively, which 126
appeared similarly represented before and after Ci limitation could be observed (Supp. 127
Page 28 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 30: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/30.jpg)
For Peer Review O
nly
6
Fig. 1A). On the other hand, all3953 expression did not significantly respond to N 128
depletion (Supp. Fig. 1B). The latter result was consistent with previous global 129
transcriptional studies (Ehira and Ohmori, 2006; Flaherthy et al., 2011) and with the 130
lack of binding associated to all3953 of the N-control transcriptional regulator NtcA 131
upon combined nitrogen depletion (Picossi et al., 2014). 132
133
Isolation and characterization of an all3953 mutant 134
To study the role of All3953, a mutant strain bearing an inactivated version of all3953 135
was constructed (see Experimental procedures). In strain CSS74 most of the all3953 136
gene was deleted and the C.S3 gene cassette (encoding Sm/Sp resistance) was 137
introduced to facilitate segregation and maintenance of the mutation in Anabaena 138
(Supp. Fig. 2A). As a control, strain CSS77 bearing the C.S3 gene cassette in the 139
Anabaena plasmid alpha was also constructed. For cis complementation, a wild-type 140
version of all3953 was transferred to strain CSS74 in an integrative plasmid, 141
generating strain CSS74C (Supp. Fig. 2A). 142
Strain CSS74 exhibited poor growth under standard growth conditions with 143
ammonium as a nitrogen source, and it formed short filaments in liquid medium, 144
whereas strain CSS74C behaved similarly to CSS77 (not shown). To quantify the 145
deleterious effect of the all3953 mutation, growth rates were calculated in liquid 146
medium under different illumination and Ci-supply conditions (Fig. 1). Growth rate of 147
the control strain CSS77 was highest (0.892 days-1) under high light (HL) and high 148
carbon (HC), and was about 30% lower under the other tested conditions (Fig. 1A). In 149
contrast, growth of strain CSS74 was severely affected under HL HC conditions 150
(growth rate ca. 70% lower than that of the control) (Fig. 1A), under which it ended up 151
dying after about 5 days (Fig. 1B). Under HL and low carbon (LC) or low light (LL) HC, 152
the defect was close to 30% with regard to the control, although after prolonged 153
incubation the mutant was more severely affected under HL LC. The defect was the 154
Page 29 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 31: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/31.jpg)
For Peer Review O
nly
7
smallest (ca. 15%) under LL LC conditions (Fig. 1A,B). In solid mediumFinally, growth 155
of strain CSS74 was similar, and similar to that of the control, in the presence of 156
ammonium, nitrate or no combined nitrogen the effect of the N source on the growth of 157
strain CSS74 was tested in solid medium under LL LC and HL LC conditions, whereas. 158
under HL LC In LL LC growth of strain CSS74 was similar, and similar to that of the 159
control, in the presence of ammonium, nitrate or no combined nitrogen (Figure 1C). 160
However, under HL LC a severe growth defect was observed with regard to the control 161
with any of the tested nitrogen sources (not shownFig. 1C). It is worth noting that, 162
because the CSS74 strain formed short filaments, colonies were observed at a lower 163
chlorophyll concentration than in the control strain. In summary, the lack of All3953 had 164
a deleterious effect on growth, especially under HL (and HC) conditions. 165
To further characterize the growth defect of the all3953 mutant, the rate of 166
oxygen evolution using CO2 as a final electron acceptor was measured under different 167
illumination conditions in the CSS74 mutant in relation to the control strain CSS77. 168
When exponentially-growing cells were incubated for 24 h under LL HC, the oxygen 169
evolution rate was slightly lower in strain CSS74 in comparison to CSS77 (88 and 170
105 µmol O2�[mg Chl]-1�h-1, respectively). Under HL the difference between the two 171
strains was larger (167, for CSS77, and 110, for CSS74, µmol O2�[mg Chl]-1�h-1). 172
173
Effect of all3953 mutation on rbcLXS expression 174
To test the effect of the all3953 mutation on the expression of the rbcLXS operon, 175
northern blot analysis was performed with RNA isolated from cells of the control and 176
mutant strains grown with HC and transferred to LC conditions. After 1 h incubation 177
with LC, a ca. 2-fold increase in the amount of the rbcLXS transcripts could be 178
observed in the control strain. No induction could be detected in the mutant (Fig. 2). In 179
the complemented strain CSS74C the expression of rbcLXS increased in LC similarly 180
to the control (Fig. 2). These results indicated that the induction of the rbcLXS operon 181
Page 30 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 32: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/32.jpg)
For Peer Review O
nly
8
upon Ci deficiency was dependent on All3953 and that the defect in strain CSS74 was 182
exclusively due to the lack of All3953. 183
184
ChIP-Seq analysis of the All3953 targets 185
To determine the DNA targets of All3953 at a genomic level, we used chromatin 186
immunoprecipitation followed by high-throughput sequencing analysis. To this end, we 187
constructed a strain (CSS57) expressing from the all3953 promoter a version of 188
All3953 C-terminally fussed to TAP-tag (Rigaut et al., 1999), as well as a control strain 189
(CSS68) expressing the TAP-tag alone under the control of the all3953 promoter 190
(Supp. Fig. 2B, see Experimental procedures). Immunoprecipitation was carried out 191
using cells of strains CSS57 and CSS68 grown with ammonium as the nitrogen source 192
under HC conditions and incubated for 3 h with ammonium under LC conditions. 193
The analysis of the sequences resulted in a total of 142 All3953 binding 194
regions, of which 127 were located in the chromosome, 10 in plasmid alpha, three in 195
plasmid beta and two in plasmid gamma. Each binding region was ascribed to one or 196
two genes according to the location (midpoint) of the region, and the relative location 197
with respect to the assigned gene was also indicated (Table 1 and Supp. Table 1). A 198
total of 175 genes were ascribed to the 142 binding regions. The binding regions were 199
mostly located upstream of the ascribed genes (72%), whereas 21% were intragenic 200
and 7% were located downstream of genes. The results of the ChIP-Seq analysis are 201
available at GEO accession number GSE58861 202
(http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc= GSE58861). 203
The 175 ascribed genes were classified according to their functional category 204
(Table 2). Remarkably, there were 19 genes encoding proteins related to 205
photosynthesis and respiration, and 21 genes encoding regulatory proteins, including 206
All7179, a SigB homolog. The rest were mostly genes encoding hypothetical or 207
unknown proteins (42%), but also genes encoding proteins involved in translation, in 208
Page 31 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 33: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/33.jpg)
For Peer Review O
nly
9
biosynthesis of amino acids and cofactors, prosthetic groups and carriers, in transport, 209
and in other cellular processes. Table 3 highlights All3953-binding regions related to 210
photosynthesis and respiration among which, confirming our results of gene 211
inactivation, the gene encoding the large subunit of the RuBisCo (rbcL; binding region 212
#37) is included. The fact that a high number of genes involved in photosynthesis and 213
C fixation, including rbcL, were identified as targets of RbcR suggests that this protein 214
is a global transcription factor for photosynthetic C assimilation. 215
A CisFinder analysis of the primary consensus motif was carried out based on 216
142 high-confidence ChIP-Seq peak sequences (Fig. 3A). The consensus motif found 217
has a dyad-symmetry architecture and matches the consensus of LysR-recognition 218
binding sites (RBS) (T-N11-A) (Maddocks and Oyston, 2008), as well as the consensus 219
binding sites proposed for CbbR factors (TNA-N7/8-TNA). The primary motifs identified 220
in the central 100 nt of the binding regions are indicated in Supp. Table 1 (for some 221
binding regions more than one motif have been identified). 222
223
Expression analysis of some All3953 targets in Anabaena 224
To corroborate our ChIP-Seq analysis and to support the notion that All3953 is indeed 225
a global regulator for C fixation genes, the expression levels of some of the 226
photosynthesis- and C-fixation-related target genes, its response to Ci limitation and its 227
dependence on All3953 was further analyzed by qRT-PCR (Fig. 4). Strains CSS77 and 228
CSS74 were grown in ammonium and HC under standard light conditions (80 229
µE�m-2�s-1) at 30ºC up to the exponential phase. They were then transferred to medium 230
with ammonium under LC conditions. As previously shown by northern analysis, 231
transcription levels of the all3953 gene did not significantly change after Ci deprivation 232
in the control strain CSS77. As expected, all3953 transcript levels were not detectable 233
in CSS74, corroborating that the all3953 mutation was segregated in this strain. The 234
rbcL gene (alr1524) was 4.6-fold induced at 3 h after transfer to LC in strain CSS77, 235
Page 32 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 34: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/34.jpg)
For Peer Review O
nly
10
whereas no induction was observed in CSS74, thus corroborating the dependence on 236
All3953. Interestingly, under HC the expression of rbcL in the mutant was higher than 237
in the control strain, suggesting that besides as an activator under LC, All3953 could 238
be acting as a repressor of rbcL under HC conditions. 239
ORF all4446 (flv4) was highly induced (about 100-fold), and its level was 240
maximum 1 h after the shift to LC (Fig. 4). In the all3953 mutant, the basal transcription 241
of all4446 in HC was about 8-fold lower than in the control strain, and it was only 242
slightly induced (2-fold) upon the shift to LC. all3891 (flv1A) was induced about 6-fold 3 243
h after the shift to LC in the control strain, whereas only a 2-fold induction was 244
observed in the all3953 mutant. all1304 (bicarbonate transporter homolog) and alr4156 245
(NdhF homolog) were both highly induced (up to 30- and 20-fold, respectively) upon 246
transfer of strain CSS77 to LC. In contrast, no induction of alr4156 and only a small 247
induction of all1304 took place in strain CSS74. Expression of alr4592 (psbAIII) 248
increased about 5-fold upon Ci deprivation in CSS77, but did not appreciably change in 249
CSS74. The alr0223 (NdhA homolog) gene was about 2-fold induced under Ci 250
deprivation in CSS77 but not in CSS74. Finally, the expression of alr1004 (alanine-251
glyoxylate aminotransferase) was repressed by 5-fold under LC conditions in CSSL77 252
but not in CSS74. These results confirm that expression of the above studied genes is 253
regulated, either positively or negatively, by All3953. 254
255
Discussion 256
We have identified the LTTR All3953 as the activator of the RuBisCo-encoding genes 257
in the cyanobacterium Anabaena sp. PCC 7120. All3953 appears to activate the rbcL 258
operon under Ci limitation and to repress it when Ci is abundant. An LTTR factor 259
regulating the expression of the rbcL operon has not, to our knowledge, been 260
described in any cyanobacterium. The expression of all3953 does not respond to Ci 261
limitation (Supp. Fig. 1) and, indeed, no binding region of All3953 was found adscribed 262
Page 33 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 35: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/35.jpg)
For Peer Review O
nly
11
to all3953. Thus, the all3953 gene seems to belong to the non-autoregulated LTTRs. 263
All3953 shares 28 and 26% identical residues with NdhR from Synechocystis sp. PCC 264
6803 and Synechococcus sp. PCC 7002 (CcmR), respectively. 265
By ChIP-Seq analysis of a strain bearing a TAP-tagged version of All3953, we 266
have determined 142 All3953-bound regions at 3 h after transfer from high to low Ci 267
conditions, which have been assigned to 177 genes. Apart from genes encoding 268
unknown or hypothetical proteins, the larger category is of genes encoding regulatory 269
proteins, including the transcriptional regulators Alr0353 (a LTTR) and All4500 (CRP-270
like), the two-component response regulator All3348, the two-component sensor 271
histidine-kinase All1145 and the group 2-sigma 70-type sigma factor All7179 (Supp. 272
Table 1). Interestingly, when comparing to Synechocystis sigma factors, All7179 273
(SigB4) is more similar toa homolog of Synechocystis SigB, which, along with SigD has 274
been shown to be important for PSII recovery in this unicellular cyanobacterium (Pollari 275
et al., 2009). All3953 also binds upstream of genes patS and hetN, whose products 276
regulate heterocyst differentiation (Supp. Table 1). The fact that All3953 binds to the 277
promoter region of genes encoding other regulatory proteins suggests a wide role of 278
this protein in the physiology of the organism. 279
In the promoter region of the rbcL operon we have found three putative binding 280
sites for All3953, Box I, Box II, and Box III (Fig. 3B) that resemble the consensus 281
recognition sequence found by Cisfinder analysis (Fig. 3A). It is conceivable that, like in 282
some other LTTRs these boxes combine repression and activation sites. In this regard, 283
binding of All3953 to Box III, overlapping gene promoter elements, could be related to 284
the repression of rbcL observed under high Ci (Fig. 4). On the other hand, as 285
mentioned above, the rbcL operon is repressed in heterocysts by the global 286
transcriptional regulator NtcA, for which a binding site is found overlapping the operon 287
TSP (Ramasubramanian et al., 1994; Picossi et al., 2014) (Figure 3B). It is conceivable 288
that NtcA binding in these differentiated cells interfere with All3952-mediated activation. 289
Page 34 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 36: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/36.jpg)
For Peer Review O
nly
12
Besides being the activator of the RuBisCo genes, All3953 targets include 290
genes involved in other processes related to carbon assimilation, such as Ci transport 291
(all1304, encoding an homolog of the BicA bicarbonate transporter; alr4156 encoding a 292
homolog of the NdhF3 subunit of the NDH-13 CO2 uptake system; and alr0869 293
encoding a homolog of the NdhF4 subunit of the NDH-14 CO2 uptake system); 294
components of the carboxysome shell (all0868, putative ccmK) and 2-295
phosphoglycolate metabolism (alr1004 and alr2873, possibly related to 296
photorespiration [Eisenhut et al., 2008]). Notably, All3953 targets include also a 297
number of genes encoding photosystem components, such as alr5154 (psaA, 298
encoding the PSI core protein PsaA), alr3727 (psbAII, encoding a component of form II 299
of the PSII core protein PsbA [D1]), alr4592 (psbAIII, encoding another component of 300
form II of PsbA) and alr1216 (PSII 12 kD extrinsic protein PsbU), and genes related to 301
PS activity. In the latter group are alr4149 (biliverdin reductase, putatively involved in 302
phycobilisome -PSII antenna- synthesis), and genes that can participate in 303
photosynthetic electron transfer, such as alr0223 and alr0348 (ndhA and ndhD, 304
subunits of other putative NADH dehydrogenases), alr1576 (dehydrogenase subunit), 305
all0737 (thioredoxin reductase), all1365 (CytM cytochrome), all4148 (ferredoxin I), 306
all3891 and all4446 (flavodiiron proteins Flv1A and Flv4, respectively). (Besides in CO2 307
uptake, NdhF3 and NdhF4 can also participate in electron transfer.) 308
Reports on gene expression regulation by Ci are scarce for Anabaena. 309
However, in the unicellular cyanobacterium Synechocystis sp. PCC 6803 310
transcriptomic analysis has already shown down-regulation of some genes encoding 311
polypeptides of PSI and PSII complexes as well as of phycobilisome components, 312
upon transfer to Ci limitation conditions, likely as an adaptation to lower assimilatory 313
power demand, and up-regulation of some PSII core polypeptides, interpreted as 314
adaptation to conditions of shortage of electron acceptors that could lead to 315
photodamage and increased turnover of PS core components (Wang et al., 2004). Our 316
analysis extends the array of photosynthetic genes responding to Ci limitation, 317
Page 35 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 37: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/37.jpg)
For Peer Review O
nly
13
remarkably to include the core PSI reaction center psaA gene. Moreover, except for 318
alr1004 that responds negatively, all the Anabaena photosynthetic genes mentioned 319
above increase expression upon the shift to Ci limitation. 320
Noteworthy, for the majority of photosynthetic gene targets of All3953 in 321
Anabaena, a function in protection against reactive oxygen species, which can be 322
generated by Ci limitation or exposure to HL, has either been described or could be 323
predicted. Thus, the psbAII and psbAIII genes are induced under HL in the unicellular 324
Synechococcus sp. PCC 7942, and cells cultured under HL showed more form II, and 325
less form I (encoded by psbAI), of D1 compared to cells under LL (Schaefer and 326
Golden, 1989). Regarding flavodiiron proteins, genes, flv1A, flv3A, and specially flv2 327
and flv4 of Anabaena have been shown up-regulated in vegetative cells in low Ci, and 328
flv1A and flv3A also in high light, whereas flv1B and flv3B are expressed exclusively in 329
heterocysts (Ermakova et al., 2013). Whereas Flv1A and Flv3A appear involved in 330
photoreduction of oxygen to water by removing excess electrons from PSI through 331
NAD(P)H dehydrogenases, Flv2 and Flv4 could have a role in photoprotection of PSII 332
under low Ci (Ermakova et al., 2013). Regarding photorespiration, it has also been 333
considered to have a role in removal of excess O2 (Eisenhut et al., 2008). To the best 334
of our knowledge, the regulator responsible for the response to Ci availability of any 335
photosynthetic gene has not been identified in cyanobacteria (oxygenic phototrophs). 336
Our ChIP-Seq and expression analysis indicate that All3953 is a regulator of 337
photosynthetic genes in Anabaena. 338
The growth rate of Anabaena is highest under HL HC conditions (Fig. 1), 339
implying that this cyanobacterium has mechanisms to get profit of HC while 340
counteracting HL stress. The all3953 mutant strain CSS74 exhibited a growth defect in 341
all the conditions tested, but especially under HL, where it ends-up dying (Fig. 1). This 342
shares the idea that in Anabaena All3953 is required to cope with HL stress. The effect 343
of the lack of All3953 seems more detrimental in relation to impaired photoprotection 344
than to impaired Ci scavenging (preference of the mutant for LL LC over HL HC 345
Page 36 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 38: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/38.jpg)
For Peer Review O
nly
14
conditions). Indeed, even in LL, the mutant seems to perform slightly better with LC 346
than with HC (Fig. 1). Although LC could suppose a limitation of electron acceptors, an 347
increased rate of photorespiration under LC together with the fact that some of the 348
All3953 targets that could cope with excess oxygen are residually induced upon the 349
transfer from HC to LC in the CSS74 mutant (Fig. 4) could contribute to the preference 350
of this strain for LC over HC, especially under HL. 351
Our results show that in Anabaena the responses to Ci availability include 352
regulation of genes encoding elements of CCM and RuBisCo, but also of 353
photosynthetic genes to adjust generation of assimilatory power while preserving the 354
photosynthetic apparatus from oxidative damage, which is specially relevant in 355
oxygenic phototrophs. Because All3953 is a transcriptional regulator globally 356
coordinating these responses, we have named it PacR (Photosynthetic assimilation of 357
carbon Regulator). 358
359
Experimental procedures 360
Strains 361
Anabaena sp. strain PCC 7120 was grown photoautrophically at 30°C with illumination 362
(80 µE�m-2�s-1) in liquid BG110 medium (Rippka et al., 1979) supplemented with 3 mM 363
NH4Cl, 6 mM TES buffer and 10 mM NaHCO3 and bubbled with a mixture of CO2 and 364
air (1% v/v) (HC). Other conditions used were no NaHCO3 supplement and bubbling 365
with air (LC); 12 µE�m-2�s-1 (LL); 175 µE�m-2�s-1 (HL). For growth on plates illumination 366
was 9 µE�m-2�s-1 (LL) or 34 µE�m-2�s-1 (HL). For the mutants generated in this work, 367
antibiotics were used at the following concentrations: Sm, 2 µg ml−1; Sp, 2 µg ml−1; and 368
Nm, 25 µg ml−1 for bubbled cultures; and Sm, 5 µg ml−1; Sp, 5 µg ml−1; and Nm, 369
40 µg ml−1 for cultures in solid medium. 370
371
Strain construction 372
Page 37 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 39: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/39.jpg)
For Peer Review O
nly
15
To construct a mutant of the all3953 gene, the 5' and 3' end of the gene, along with the 373
flanking regions, were PCR amplified using chromosomal DNA of PCC 7120 as the 374
template and primers all3953-14 (BglII) and all3953-15 (SalI), and primers all3953-16 375
(SalI) and all3953-17 (PstI), respectively (all primers are specified in Supp. Table 2). 376
The PCR products were digested with SalI and ligated. The resulting mixture was used 377
as a template for overlapping PCR with primers all3953-14 and all3953-17. The new 378
PCR product was digested with BglII and PstI and ligated to the BglII-PstI-digested 379
pRL271 (Black et al., 1993), obtaining plasmid pCSS161. Plasmid pCSS161 was 380
digested with SpeI and the 2-kb Smr Spr gene cassette C.S3, excised with XbaI from 381
pCSE120 [S.K3/L.HEH2 (BamHI)/C.S3 (BamHI); nomenclature as in (Elhai and Wolk, 382
1988)], was inserted obtaining plasmid pCSS162. Plasmid pCSS162 was transferred to 383
strain PCC 7120 by conjugation (Elhai et al., 1997). Exconjugants resistant to Sm and 384
Sp, which had the ∆all3953::C.S3 construct integrated by double recombination were 385
selected, obtaining strain CSS74. The segregation of the mutation was tested by PCR 386
(Supp. Fig. 2) with primers all3953-14, all3953-15, all3953-17 and all3953-20. 387
To construct a control strain expressing Smr and Spr plasmid pCSS163, a 388
derivative of plasmid pCSEL24 (Olmedo-Verd et al., 2006) containing the C.S3 gene 389
cassette, was transferred to Anabaena by conjugation. Exconjugants that had the 390
pCSS163 integrated in the alpha plasmid of Anabaena were selected, obtaining the 391
strain CSS77 (Supp. Fig. 2). 392
To complement the all3953 mutation of strain CSS74, a DNA fragment 393
encompassing the whole all3953 gene and sequences upstream from it was amplified 394
by PCR using the primer pair all3953-24/all3953-25, both including EcoRI sites, and 395
strain PCC 7120 DNA as the template. This fragment was cloned in the EcoRI site of 396
the mobilizable Nmr encoding vector pRL424 (Elhai and Wolk, 1988) producing plasmid 397
pCSS164, which was transferred to strain CSS74 by conjugation followed by selection 398
for Nmr. The genomic structure of the exconjugants in the all3953 region (Supp. Fig. 2) 399
was corroborated by PCR. 400
Page 38 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 40: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/40.jpg)
For Peer Review O
nly
16
To construct a strain expressing All3953-C-TAP, the all3953 gene (including the 401
upstream region) was PCR-amplified with primers all3953-11 and all3953-12 and DNA 402
of PCC 7120 as the template. The TAP-tag was PCR-amplified with primers TAPtag-1 403
and TAPtag-2 using DNA of plasmid pBS1479 as the template (Puig et al., 2001). The 404
two PCR products were digested with SalI and ligated, after which the ligation product 405
was used as the template for an overlapping PCR using primers all3953-11 and 406
TAPtag-2. The PCR product was digested with PstI and ligated to the mobilizable 407
vector pCSV3 (Valladares et al., 2011) digested with PstI, rendering plasmid pCSS107. 408
To construct a control strain with the TAP-tag under the control of the all3953 409
promoter, a 0.4-kb region upstream of all3953 was PCR-amplified using primers 410
all3953-11 and all3953-18 and DNA of pCSS107 as the template. The PCR product 411
was digested with SalI and ligated to the PCR-amplified TAP-tag digested with SalI, 412
after which the ligation product was used as the template for an overlapping PCR using 413
primers all3953-11 and TAPtag-2. The PCR product was digested with PstI and ligated 414
to PstI-digested pCSV3 to give plasmid pCSS157. Plasmids pCSS107 and pCSS157 415
were transferred by conjugation to strain PCC 7120 and single Smr Spr recombinants 416
were selected, obtaining strain CSS57 and CSS68, respectively. Western blots using 417
Peroxidase-Anti-Peroxidase Soluble Complex (PAP, Sigma-Aldrich) were performed to 418
ensure that the two strains expressed the TAP-tag (Supp. Fig. 2B). 419
420
Chromatin immunoprecipitation 421
Cells of strains CSS57 growing exponentially (3-5 µg Chl�ml-1) in the light (80 422
µE�m-2�s-1) in medium supplemented with 2 µg�ml-1 Sm and Sp, in HC conditions were 423
incubated with LC for 3 h. Formaldehyde was then added to the cultures to a final 424
concentration of 1%, and the cultures were incubated for 15 min. Glycine was added at 425
125 mM final concentration and the incubation was continued for 5 min to stop the 426
fixing reaction. The cells were then filtered, washed with cold TBS (20 mM Tris-HCl, pH 427
7.4, 140 mM NaCl) and collected in tubes (25 ml of culture per tube). The pellets were 428
Page 39 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 41: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/41.jpg)
For Peer Review O
nly
17
frozen in liquid nitrogen and stored at -20°C until used. Pellets corresponding to about 429
25 ml of culture were resuspended in 500 µl of lysis buffer (50 mM HEPES-KOH, pH 430
7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 431
supplemented with Mini EDTA-free protease inhibitor cocktail [Roche]) and, after 432
addition of 150 µl of glass beads (acid-washed, 425-600 µm [Sigma]), the cells were 433
broken in a multivortexer at 2,000 rpm for 1 h at 4°C. The cell lysates were collected by 434
centrifugation and the extracts were subjected to sonication to shear the DNA to about 435
300-bp fragments (60 cycles of 10 s, 20 s ice, 15% amplitude, in a Branson Digital 436
Sonifier). After centrifugation to eliminate cell debris, the whole-cell extracts were 437
stored at −20°C or immediately used for immunoprecipitation. 438
Immunoprecipitation of DNA was carried out as described (Picossi et al., 2014), 439
with some modifications. Whole-cell extracts were prepared at 4 mg�ml-1 of total protein 440
with lysis buffer (in 500 µl total volume). A 50-µl sample was taken as the input sample, 441
and the extracts were incubated with 15 µl IgG-conjugated Dynabeads (about 6 µg 442
IgG) at 4ºC with rotation for 12-14h. The washes of the Dynabeads, as well as the 443
elution of the immunoprecipitated material, the crosslinking reversion and the isolation 444
of the DNA were performed as in (Picossi et al., 2014). 445
446
Massive sequencing of the immunoprecipitated DNA 447
Input and ChIP DNA samples were sent for sequencing to the Functional Genomics 448
Core Facility of the Institute for Research in Biomedicine, Barcelona (Spain). Next 449
generation sequencing was carried out using Illumina’s sequencing technology. ChIP 450
DNA Sample Prep Kit (Illumina) was used for library preparation. Libraries were loaded 451
at 8 pM concentration into the flow cell using the Cluster Station running recipe V7 with 452
the Single-Read Cluster Generation Kit v4 (all Illumina). The flow cell was loaded into 453
the Genome Analyzer II and samples were sequenced for 120 nucleotides from a 454
single end using the Sequencing Kit v5 and recipe v8 (all Illumina). Manufacturer’s 455
Page 40 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 42: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/42.jpg)
For Peer Review O
nly
18
recommendations were strictly followed. Illumina sequencing data were pre-processed 456
with the standard Illumina pipeline version 1.5 and sequences were aligned to the PCC 457
7120 genome (http://genome.microbedb.jp/cyanobase/Anabaena) with the Bowtie 458
software 0.12.5 (Langmead et al., 2009). The analysis of the results were carried out 459
using the Triform algorithm (Kornacker et al., 2012) as in (Picossi et al., 2014). The 460
sequences in the ChIP samples of strain CSS68 (TAP control) were used as the 461
background of the sequences found for strain CSS57 (All3953-TAP), and thus to 462
determine the specific binding regions of All3953-TAP in the genome of Anabaena. 463
The binding regions were visualized and analyzed using the UCSC Microbial Genome 464
Browser (Scheneider et al., 2006). They were ascribed to one or two genes, in case it 465
was not possible to ascribe them to only one, and classified as upstream of the gene, if 466
the midpoint of the binding region was located upstream of the start of the gene, 467
internal, if the midpoint of the binding region was inside the gene, or downstream, if the 468
midpoint of the binding region was located downstream of the end of the gene to which 469
it had been ascribed. 470
471
Page 41 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 43: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/43.jpg)
For Peer Review O
nly
19
Northern and qRT-PCR analyses 472
Isolation of total RNA from Anabaena was done as described previously (Mohamed 473
and Jansson, 1989). Northern analysis was performed as described previously (López-474
Igual et al., 2012). 475
For qRT-PCR, 750 ng of DNA-free RNA samples were used for all the PCR 476
primer pairs. For the RT reaction, the Quantitech Reverse transcription kit (Qiagen), 477
with the Random Hexamer Primer mix (100 ng per sample) (Bioline) was used. The 478
cDNA produced was diluted 7.5 times to use 2 µl of cDNA per PCR reaction. PCR was 479
done using the Quantimix Easy SYG Kit (Biotools) (SYBR green I) in a iCycler iQ Multi-480
Color Real Time PCR Detection System (Bio-Rad). The abundance of a transcript in 481
the RNA sample was calculated as: abundance= 2^[Ct(sample)-Ct(control)], where the 482
RNA sample of the control strain CSS77 in HC condition (0) was used as the control. 483
484
Oxygen evolution 485
2-ml samples of exponentially grown cultures in HC LL or HC HL conditions were used 486
to measure O2 evolution with an O2 electrode calibrated with culture medium and 487
Na2S2O4 as the reducing agent. O2 production was measured in the light (400 488
µE�m-2�s-1) after a seven-minute incubation in the dark. 489
490
Acknowledgments 491
This work was supported by grants BFU2010-17980 and BFU2013-44686-P from the 492
Spanish government, co-financed by FEDER. The authors are grateful to K. Kornacker 493
for carrying out the Triform and CisFinder analyses, and to H. Auer and I. Pons, from 494
the Functional Genomics Core Facility of the IRB, Barcelona (Spain); to F. Monje-495
Casas and Yagut Allahverdiyeva-Rinne for critical reading of the manuscript and to M. 496
J. Huertas and A. Torrado for help with O2 production measurements. 497
498 REFERENCES 499
Page 42 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 44: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/44.jpg)
For Peer Review O
nly
20
500
Black, T.A., Cai, Y., and Wolk C.P. (1993) Spatial expression and autoregulation of 501 hetR, a gene involved in the control of heterocyst development in Anabaena. Mol 502 Microbiol 9: 77-84. 503
Cameron, C.J., Sutter, M., and Kerfeld, C.A. (2014) The carboxysome: Function, 504 structure and cellular dynamics. The Cell Biology of Cyanobacteria, eds. Flores E, 505 Herrero A (Caister Academic Press, Norfolk), pp. 171-188. 506
Ehira, S., and Ohmori, M, (2006) NrrA, a nitrogen-responsive response regulator 507 facilitates heterocyst development in the cyanobacterium Anabaena sp. strain PCC 508 7120. Mol Microbiol 59: 1692-1703. 509
Elhai., J., Vepritskiy, A., Muro-Pastor, A.M., Flores, E, and Wolk, C.P. (1997) Reduction 510 of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain 511 PCC 7120. J Bacteriol 179: 1998-2005. 512
Eisenhut, M., Ruth, W., Haimovich, M., Bauwe, H., Kaplan, A., and Hagemann, M. 513 (2008) The photorespiratory glycolate metabolism is essential for cyanobacteria and 514 might have been conveyed endosymbiotically to plants. Proc Natl Acad Sci USA 515 105: 17199-17204. 516
Elhai, J., and Wolk, C.P. (1988) A versatile class of positive-selection vectors based on 517 the nonviability of palindrome-containing plasmids that allows cloning into long 518 polylinkers. Gene 68: 119-138. 519
Ermakova, M., Battchikova, N., Allahverdiyeva, Y., and Aro, E.M. (2013) Novel 520 heterocyst-specific flavodiiron proteins in Anabaena sp. PCC 7120. FEBS Lett 587: 521
82-7. 522 Figge, R.M., Cassier-Chauvat, C., Chauvat, F., and Cerff, R. (2001) Characterization 523
and analysis of an NAD(P)H dehydrogenase transcriptional regulator critical for the 524 survival of cyanobacteria facing inorganic carbon starvation and osmotic stress. Mol 525 Microbiol 39: 455-68. 526
Flaherty, B.L., Van Nieuwerburgh, F., Head, S.R., and Golden, J.W. (2011) Directional 527 RNA deep sequencing sheds new light on the transcriptional response of Anabaena 528 sp. strain PCC 7120 to combined-nitrogen deprivation. BMC Genomics 12: 332. 529
Flores, E., and Herrero, A. (2010) Compartmentalized function through cell 530 differentiation in filamentous cyanobacteria. Nat Rev Microbiol 8: 39-50. 531
Gibson, J.L., and Tabita, F.R. (1996) The molecular regulation of the pentose 532 phosphate pathway in proteobacteria and cyanobacteria. Arch Microbiol 166: 141-533
150. 534 Herrero, A., Picossi, S., and Flores, E. (2013) Gene Expression during heterocyst 535
differentiation. Adv Bot Res 65: 281-329. 536
Kaneko, T., Nakamura, Y., Wolk, C.P., Kuritz, T., Sasamoto, S., and Watanabe, A. 537 (2001) Complete genomic sequence of the filamentous nitrogen-fixing 538 cyanobacterium Anabaena sp. strain PCC 7120. DNA Res 8: 205-213. 539
Knoll, A.H. (2008) Cyanobacteria and Earth history. The Cyanobacteria: Molecular 540 Biology, Genomics and Evolution, eds. Herrero A, Flores E (Caister Academic 541 Press, Norfolk), pp. 1-19. 542
Kornacker, K., Rye, M.B., Handstad, T., and Drablos, F. (2012) The Triform algorithm: 543 improved sensitivity and specificity in ChIP-Seq peak finding. BMC Bioinformatics 544 13: 176. 545
Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009) Ultrafast and memory-546 efficient alignment of short DNA sequences to the human genome. Genome Biol 10: 547
R25. 548 Lin, M.T., Occhialini, A., Andralojc, P.J., Parry, M.A.J., and Hanson, M.R. (2014) A 549
faster Rubisco with potential to increase photosynthesis in crops. Nature 513: 547-550
550. 551 López-Igual, R., Picossi, S., López-Garrido, J., Flores, E., and Herrero, A. (2012) N 552
and C control of ABC-type bicarbonate transporter Cmp and its LysR-type 553
Page 43 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 45: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/45.jpg)
For Peer Review O
nly
21
transcriptional regulator CmpR in a heterocyst-forming cyanobacterium, Anabaena 554 sp. Environ Microbiol 14: 1035-1048. 555
Lyons, T.W., Reinhard, C.T., and Planavsky, N.J. (2014) The rise of oxygen in Earth's 556 early ocean and atmosphere. Nature 506: 307-315. 557
Madan, A.P., and Nierzwicki-Bauer, S.A. (1993) In situ detection of transcripts for 558 ribulose-1,5-bisphosphate carboxylase in cyanobacterial heterocysts. J Bacteriol 559 175: 7301-7306. 560
Maddocks, S.E., and Oyston, P.C. (2008) Structure and function of the LysR-type 561 transcriptional regulator (LTTR) family proteins. Microbiology 154: 3609-3623. 562
Mohamed, A., and Jansson, C. (1989) Influence of light on accumulation of 563 photosynthesis-specific transcripts in the cyanobacterium Synechocystis 6803. Plant 564 Mol Biol 13: 693-700. 565
Nierzwicki-Bauer, S.A., Curtis, S.E., and Haselkorn, R. (1984) Cotranscription of genes 566 encoding the small and large subunits of ribulose-1,5-bisphosphate carboxylase in 567 the cyanobacterium Anabaena 7120. Proc Natl Acad Sci USA 81: 5961-5965. 568
Nishimura, T., Takahashi, Y., Yamaguchi, O., Suzuki, H., Maeda, S., and Omata, T. 569 (2008) Mechanism of low CO2-induced activation of the cmp bicarbonate transporter 570 operon by a LysR family protein in the cyanobacterium Synechococcus elongatus 571 strain PCC 7942. Mol Microbiol 68: 98-109. 572
Olmedo-Verd, E., Muro-Pastor, A.M., Flores, E., and Herrero, A. (2006) Localized 573 induction of the ntcA regulatory gene in developing heterocysts of Anabaena sp. 574 strain PCC 7120. J Bacteriol 188: 6694-6649. 575
Picossi, S., Flores, E. and Herrero, A. (2014) ChIP analysis unravels an exceptionally 576 wide distribution of DNA binding sites for the NtcA transcription factor in a 577 heterocyst-forming cyanobacterium. BMC Genomics 15: 22. 578
Pollari, M., Ruotsalainen, V., Rantamaki, S., Tyystjarvi, E., and Tyystjarvi, T. (2009). 579 Simultaneous inactivation of sigma factors B and D interferes with light acclimation 580 of the cyanobacterium Synechocystis sp. strain PCC 6803. J Bacteriol 191: 3992-581
4001. 582 Puig, O., Caspary, F., Rigaut, G., Rutz, B., Bouveret, E., Bragado-Nilsson, E., Wilm, 583
M., and Seraphin, B. (2001) The tandem affinity purification (TAP) method: a 584 general procedure of protein complex purification. Methods 24: 218-229. 585
Price, G.D., Badger, M.R., Woodger, F.J., and Long, B.M. (2008). Advances in 586 understanding the cyanobacterial CO2-concentrating-mechanism (CCM): functional 587 components, Ci transporters, diversity, genetic regulation and prospects for 588 engineering into plants. J Exp Bo. 59: 1441-1461. 589
Price, G.D. (2011) Inorganic carbon transporters of the cyanobacterial CO2 590 concentrating mechanism. Photosynth Res 109: 47-57. 591
Ramasubramanian, T.S., Wei, T.-F. and Golden, J.W. (1994) Two Anabaena sp. strain 592 PCC 7120 DNA-binding factors interact with vegetative cell- and heterocyst-specific 593 genes. J Bacteriol 176: 1214-1223. 594
Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Seraphin, B. (1999) A 595 generic protein purification method for protein complex characterization and 596 proteome exploration. Na. Biotechnol 17: 1030-1032. 597
Rippka, R., Deruelles, J., Waterbury, J.B., Herdman, M., and Stanier, R.Y. (1979) 598 Generic assignments, strain stories and properties of pure cultures of 599 cyanobacteria. J Gen Microbiol 111: 1-61. 600
Schaefer, M.R., and Golden, S.S. (1989) Differential expression of members of a 601 cyanobacterial psbA gene family in response to light. J Bacteriol 171: 3973-3781. 602
Scheneider, K.L., Pollard, K.S., Baertsch, R., Pohl, A., and Lowe, T.M. (2006) The 603 UCSC archaeal genome browser. Nucleic Ac Res 34: D407–D410. 604
Valladares, A., Rodríguez, V., Camargo, S., Martínez-Nöel, G.M., Herrero, A., and 605 Luque, I. (2011) Specific role of the cyanobacterial PipX factor in the heterocysts of 606 Anabaena sp. strain PCC 7120. J Bacteriol 193(5): 1172-1182. 607
Page 44 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 46: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/46.jpg)
For Peer Review O
nly
22
Wang, H.L., Postier, B.L., and Burnap, R.L. (2004) Alterations in global patterns of 608 gene expression in Synechocystis sp. PCC 6803 in response to inorganic carbon 609 limitation and the inactivation of ndhR, a LysR family regulator. J Biol Chem 279: 610 5739-5751. 611
612 613
614
Page 45 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 47: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/47.jpg)
For Peer Review O
nly
23
Figure legends: 615
Fig. 1. Growth of the all3953 mutant. A, The growth rate constant (µ = ln2/td, where td is 616
the doubling time) was calculated from the increase of protein content determined in 617
0.2 ml samples of cultures. The table shows the mean and standard deviation from 3 618
independent cultures of each strain and condition. ∆all3953 is strain CSS74; CSS77 is 619
a control strain that carries the Sm/Sp-resistant determinant in a wild-type background. 620
B, Samples of cultures were photographed after 5 days of incubation under the 621
indicated conditions. C, Growth in solid medium (no NaHCO3) with 3 mM NH4Cl (A), 622
17.6 mM NaNO3 (N), or no combined nitrogen (-N). 5-µl drops, containing 50, 5, 0.5 or 623
0.05 ng Chl, were spotted, incubated for 14 days and photographed. HL, high light; LL, 624
low light; HC, high carbon; LC, low carbon. 625
626
Fig. 2. Expression of rbcLXS in the ∆all3953 mutant and complemented strain. 627
Northern analysis carried out with RNA from strains CSS77 (control) CSS74 (∆all3953) 628
and CSS74C (CSS74 complemented) was isolated from cells grown with HC (0) and 629
incubated for 1h (1) with LC. The membranes were hybridized with an internal 630
fragment of the rbcL gene (upper panels) and, as a loading and transfer control, of the 631
rnpB gene (lower panels). Arrowheads point to the main transcripts detected with the 632
rbcL gene probe (approximate sizes are indicated). 633
634
Fig. 3. Consensus All3953 binding sequence and rbcL promoter. A, The primary 635
consensus motif based on 142 high confidence CSS57 ChIP-Seq peak sequences is 636
shown with indication of the probability of occurrence of each base along the 22-nt 637
sequence. W is A or T; Y is C or T; B is C, G or T. B, Structure of the rbcLXS promoter 638
region. The transcription initiation point of the operon (+1) and the -10 and -35 boxes 639
(from Nierzwicki-Bauer et al., 1984) are indicated in red. The NtcA-binding site 640
Formatted:Formatted:Formatted:Formatted: Font: Helvetica
Formatted:Formatted:Formatted:Formatted: Font: Not Bold
Page 46 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 48: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/48.jpg)
For Peer Review O
nly
24
(GTAN8TAC) is indicated in green, and the three putative binding sites for All3953 (Box 641
I, Box II and Box III) are indicated in blue. 642
643
Fig. 4. qRT-PCR analysis of the expression of selected photosynthesis and respiration-644
related All3953 gene targets. Transcriptional response of the indicated genes to Ci 645
limitation in the control (CSS77) and ∆all3953 mutant (CSS74) strains was 646
investigated. RNA was isolated from cells grown with 10 mM NaHCO3-supplemented 647
medium bubbled with 1%CO2 in air (0) incubated for 1 h (1) or 3 h (3) in NaHCO3-free 648
medium bubbled with air. Bars represent the mean transcript levels (± standard 649
deviation) in three independent experiments. 650
651
Page 47 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 49: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/49.jpg)
For Peer Review O
nly
Table 1. Results of the ChIP-Seq analysis of All3953 binding to DNA at 3 h after Ci limitation
*Some of the binding regions were ascribed to more than one gene (see Supp. Table 1).
Binding regions found Genes ascribed Position of the binding region with respect to the gene
upstream internal downstream
Chromosome 127 157 118 29 10
Alpha 10 13 8 4 2
Beta 3 3 0 3 0
Gamma 2 2 0 1 1
Total 142 175 126 37 13
Page 48 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 50: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/50.jpg)
For Peer Review O
nly
1
Table 2. Functional categories of the genes ascribed to the All3953 binding regions.
Functional category Number
Amino acid biosynthesis 5
Biosynthesis of cofactors, prosthetic groups, and carriers 4
Cell envelope 2
Cellular processes 5
Central intermediary metabolism 3
DNA replication, recombination and repair 3
Energy metabolism 4
Other categories 19
Photosynthesis and respiration 19
Purines, pyrimidines, nucleosides and nucleotides 2
Regulatory proteins 21
Translation 9
Transport and binding proteins 4
Unknown and hypothetical proteins 75
Page 49 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 51: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/51.jpg)
For Peer Review Only
Table 3. All3953-binding regions assigned to photosynthesis and respiration-related genes.
BR NLQ LOC GENE POSITION FUNCTION¶ ST START SEQ
7 172,84 239694 alr0223* upstream NADH dehydrogenase subunit 1; NdhA + 239712 AGGTATTAGTTTAACTAATGTT
12 38,58 398948 alr0348 upstream close NADH dehydrogenase subunit 4; NdhD + 398912 AACAATTCCTTAATATAATGTA
19 62,81 859596 all0737 upstream thioredoxin reductase - 859596 ATTCATAAAAGCGTTTTATATC
25 238,45 997693 all0868 upstream CO2 concentrating mechanism protein CcmK + 997698 ATGTATAAGTTTTATTAATATG
alr0869 upstream NADH dehydrogenase subunit 5
27 66,90 1175262 alr1004* upstream alanine--glyoxylate aminotransferase + 1175259 GTATATAGGCGATCATTATGGC
31 36,15 1433154 alr1216 upstream photosystem II 12 kD extrinsic protein PsbU + 1433147 AAATATTGTGAGCATTAATAAG
34 385,11 1547013 all1304* upstream bicarbonate transporter - 1546894 GTGCATTTGCAATAGTTATTAT
35 31,96 1620674 all1365 downstream cytochrome CytM + 1620645 CGTAATAAATTTTAATCATCAT
37 63,26 1785455 alr1524* upstream RbcL + 1785446 ACTTATGCCATTTCTTGATATA
38 204,06 1843221 alr1576 upstream far dehydrogenase subunit - 1843218 AGTAATAACTGCTACTTATTAC
61 29,78 3499605 alr2873 internal 3' end possible glycerate kinase - 1843218 CAAAATTAAACTGTCTAATTTC
86 170,25 4499861 alr3727 upstream photosystem II protein D1 (psbAII) + 4499883 GTATATATATTTTAGTAATATT
91 155,06 4693128 all3891* upstream flavoprotein (flv1A) + 4693099 ATTTATAAGTTTTACTTAAGCT
98 166,48 4993006 all4148 upstream ferredoxin I - 4993375 AACCATAAATTTTTCTAATAAC
99 61,47 4999503 alr4156* upstream NADH dehydrogenase subunit 5; NdhF + 4999503 AAAGATAAATTTGCCTTATTTA
108 163,25 5332512 all4446* upstream flavoprotein (flv4) - 5332500 AATAATAAATTTTACTAATAAA
112 233,71 5489698 alr4592* upstream photosystem II protein D1 (psbAIII) + 5489979 CTATATAGTTTTTACTCATATT
121 51,04 6151146 alr5154 upstream photosystem I core protein A1 + 6151133 GGACATAAGTTTTACGAATTGT
*Genes whose expression has been studied by qRT-PCR ¶Functions are as specified in cyanobase (http://genome.microbedb.jp/cyanobase/Anabaena). BR: binding region, NLQ: -logQvalue , LOC: chromosome location of the midpoint of the binding region, ST: DNA strand, START: chromosome location of the 5’ end of the putative binding sequence of All3953 (SEQ).
Page 50 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 52: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/52.jpg)
For Peer Review O
nly
Figure 1
262x350mm (300 x 300 DPI)
Page 51 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 53: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/53.jpg)
For Peer Review O
nly
Figure 2
262x350mm (300 x 300 DPI)
Page 52 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 54: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/54.jpg)
For Peer Review O
nly
Figure 3
297x420mm (300 x 300 DPI)
Page 53 of 54
Wiley-Blackwell and Society for Applied Microbiology
![Page 55: For Peer Review Only - Digital.CSICdigital.csic.es/bitstream/10261/123086/1/Submitted-R1.pdf · For Peer Review Only 1 1 The LysR-type transcription factor PacR is a global regulator](https://reader034.fdocuments.us/reader034/viewer/2022042209/5eadbfb66bcba761e9533fe9/html5/thumbnails/55.jpg)
For Peer Review O
nly
Figure 4
297x420mm (300 x 300 DPI)
Page 54 of 54
Wiley-Blackwell and Society for Applied Microbiology