Fine-Tuning of Translation Termination Efﬁciency in … · 2007. 11. 29. · In eukaryotes,...

Copyright � 2007 by the Genetics Society of AmericaDOI: 10.1534/genetics.107.070771

Fine-Tuning of Translation Termination Efficiency in Saccharomycescerevisiae Involves Two Factors in Close Proximity to the

Exit Tunnel of the Ribosome

Isabelle Hatin,*,†,1 Celine Fabret,*,† Olivier Namy,*,†

Wayne A. Decatur‡ and Jean-Pierre Rousset*,†

*IGM, Universite Paris-Sud, UMR 8621, F91405 Orsay, France, †CNRS, F91405 Orsay, Franceand ‡Department of Biochemistry and Molecular Biology, University of Massachusetts,

Amherst, Massachusetts 01003

Manuscript received January 11, 2007Accepted for publication April 27, 2007

ABSTRACT

In eukaryotes, release factors 1 and 3 (eRF1 and eRF3) are recruited to promote translation terminationwhen a stop codon on the mRNA enters at the ribosomal A-site. However, their overexpression increasestermination efficiency only moderately, suggesting that other factors might be involved in the terminationprocess. To determine such unknown components, we performed a genetic screen in Saccharomyces cerevisiaethat identified genes increasing termination efficiency when overexpressed. For this purpose, we con-structed a dedicated reporter strain in which a leaky stop codon is inserted into the chromosomal copy ofthe ade2 gene. Twenty-five antisuppressor candidates were identified and characterized for their impacton readthrough. Among them, SSB1 and snR18, two factors close to the exit tunnel of the ribosome,directed the strongest antisuppression effects when overexpressed, showing that they may be involved infine-tuning of the translation termination level.

TRANSLATION termination is the step that liber-ates the newly synthesized polypeptide from the

ribosome before recycling the translational machinery.Three triplets—UAA, UAG (Weigert and Garen 1965),and UGA (Brenner et al. 1967)—were identified asnonsense stop codons and shown to serve in vitro as sig-nals for the release of polypeptide from the ribosome(Takanami and Yan 1965). The misincorporation of anamino acid at the stop codon occurs at a frequency of�10�4 and is called readthrough. The efficiency of thistermination is modulated by cis and trans factors. Ingeneral, release factors efficiently recognize the termi-nation codons, but in certain instances, near-cognatetransfer RNAs (tRNAs) overcompete and lead to read-through. tRNA decoding of a stop codon occurs morefrequently when the stop codon is surrounded by a contextthat modifies the competition for stop codon recognitionbetween a release factor and near-cognate tRNA (Salser

1969; Fluck and Epstein 1980; Engelberg-Kulka 1981).In Saccharomyces cerevisiae, both 59 and 39 sequences play arole in translation termination (Bonetti et al. 1995;Namy et al. 2001; Tork et al. 2004). Several studies pointto different elements that could be involved in the 59

effect in S. cerevisiae: (i) the tRNA located on the ribo-

somal P-site (Mottagui-Tabar and Isaksson 1998),(ii) the mRNA structure shape due to the nucleotide se-quence at the P site that could alter decoding throughdistortion of the ribosome structure (Tork et al. 2004),and (iii) the chemical property of the amino acid atthe penultimate position. Previous analyses have shownthat the nucleotides 39 of the stop have a predominantrole on readthrough efficiency and that the 59 contexteffect is dependent on the 39 context (Skuzeski et al.1991; Bonetti et al. 1995; Howard et al. 1996; Mottagui-Tabar and Isaksson 1998; Cassan and Rousset 2001;Namy et al. 2001). In particular, the nucleotide imme-diately following the stop is highly biased in prokaryotesand eukaryotes and it has been proposed that the stopsignal could involve four nucleotides (nt) (Brown et al.1990). Several studies have pointed to at least three ntupstream and six nt downstream of the stop to be in-volved in determining readthrough efficiency (Bonetti

et al. 1995; Namy et al. 2001). Aminoglycosides can in-crease readthrough and have been shown to suppresspremature stop mutations in several animal and cul-tured cell models (Bedwell et al. 1997; Barton-Davis

et al. 1999; Manuvakhova et al. 2000; Bidou et al. 2004).These observations have opened the possibility of treat-ing patients who bear nonsense mutations with amino-glycoside antibiotics to express full-length protein. Giventhe numerous human diseases caused by nonsense mu-tation (Krawczak et al. 2000), it is thus imperative to

1Corresponding author: Institut de Genetique et Microbiologie, Batiment400, Universite Paris-Sud, F91405 Orsay, France.E-mail: [email protected]

Genetics 177: 1527–1537 (November 2007)

determine the precise mechanism of translation termi-nation in eukaryotes.

In eukaryotic cells, termination necessitates the re-cruitment of the release factors eRF1 and eRF3 by theribosomal machinery at the A-site. eRF1 is involved instop codon recognition but fully efficient terminationneeds interaction with the GTPase eRF3. In 1994, Frolova

and coworkers showed that SUP45 protein of S. cerevisiaebelongs to a highly conserved eukaryotic protein familyand corresponds most likely to the yeast eRF1 (Frolova

et al. 1994). That assignment was subsequently experimen-tally demonstrated by Stansfield et al. (1995b). eRF1comprises three domains: the N-terminal domain involvedin stop codon recognition (Bertram et al. 2000; Song et al.2000; Chavatte et al. 2001) and the M domain that con-tains a GGQ motif highly conserved throughout evolution(Frolova et al. 1999), which is responsible for peptidyltransferase hydrolytic activity. These two domains formthe functionally active ‘‘core’’ (Frolova et al. 2000). Thethird domain in eRF1, the C-terminal domain, is involvedin the interaction with the protein phosphatase PP2A(Andjelkovic et al. 1996) and with eRF3 (Stansfield et al.1995b; Zhouravleva et al. 1995). eRF3, encoded by SUP35in S. cerevisiae, is made up of three domains. The N-terminal and M domains are not essential for viability andtermination (Ter-Avanesyan et al. 1993). In S. cerevisiae,the N terminus is asparagine and glutamine rich and un-derlies the conformational changes of eRF3 to proteinase-resistant aggregates, leading to the ½PSI1� phenotype (seereview in Patino et al. 1996; Paushkin et al. 1996;Chernoff 2001; Cosson et al. 2002). ½PSI1� cells presenta defect in translation termination characterized by anomnipotent nonsense suppression phenotype (Liebman

and Sherman 1979). The C-terminal domain carriesGTPase activity (Frolova et al. 1996), which is essentialfor viability and termination and interacts with eRF1and Upf1 (Stansfield et al. 1995b; Weng et al. 1996;Czaplinski et al. 1998). Recently, Salas-Marco andBedwell (2004) showed that eRF3 mutants with areduced GTPase activity lead to a decreased translationtermination efficiency. Recent results suggest that astable interaction between eRF1 and the stop codon inthe A-site stimulates eRF3 GTP hydrolysis, which leads toefficient release of the polypeptide from the ribosomeby eRF1 (Salas-Marco and Bedwell 2004; Alkalaeva

et al. 2006). In spite of genetic, biochemical, andcrystallographic analyses of eRF1 and eRF3, questionsabout the translational termination mechanism remain.In particular, several factors have been demonstrated tointeract with the termination process, either directlythrough contacts with release factors or indirectly, as dem-onstrated by genetic experiments. This is the case for theUpf1p factor that physically interacts with release factorseRF3 and eRF1. The two other Upf factors (Upf2p andUpf3p) are also connected with translational termina-tion through a mechanism not well identified (Weng

et al. 1996; Czaplinski et al. 1998; Wang et al. 2001). An

interaction of eRF1 with PABp has also been shown inXenopus and human cells (Cosson et al. 2002) and couldhelp recycling of translational components. In addition,Itt1p (Urakov et al. 2001) and PP2A (Andjelkovic et al.1996) have been described to interact with eRF1, butwithout clue on the mechanism of translational termi-nation mediated by these interactions. Several observa-tions also suggest a link between termination and thecytoskeleton. Sla1p is involved in the cytoskeleton andhas been found to interact with the N-terminal domainof eRF3 (Bailleul et al. 1999). Actin mutants have beenassociated with increased readthrough on the UAA stopcodon (Kandl et al. 2002), and a microtubule bindingprotein of the spindle pole body Stu2p has been iden-tified in a genetic screen for factors modulating trans-lational termination efficiency (Namy et al. 2002).

Apart from the above-mentioned proteins, one canenvision that other factors able to modulate the termina-tion process remain to be discovered. Indeed, overexpres-sion of yeast eRF factors, Sup45p and Sup35p, increasestranslational termination efficiency no more than 2.6-fold (Stansfield et al. 1995b; Williams et al. 2004). Toidentify antisuppressors limiting near-cognate, tRNA-mediated suppression, we developed a screen for factorsthat would increase translational termination when over-expressed (multicopy antisuppressors). For this purpose,we used a strain that carries an allele of the ADE2 gene,interrupted by an in-frame UAG stop codon surroundedby sequences known to promote a readthrough levelhigh enough to obtain white colonies. We screened forcandidate DNA fragments able to confer a red color tothe colonies. Among those, SSB1 and snR18 sequenceswere found repeatedly and have been shown to actuallydecrease the readthrough level. The mechanism ofSSB1-induced readthrough decrease has been furthercharacterized.

MATERIALS AND METHODS

Yeast strains and media: The S. cerevisiae strains used for thiswork are OL556 (MATa/MATa, cdc25-5/cdc25-5 his3/his3 leu2/leu2 trp1/TRP1 rca1/rca1 ura3/ura3) (Boy-Marcotte et al. 1996),74D694 (MATa ade1-14 trp1-289 leu2-3,112 his3-200 ura3-52)½psi��; ½psi1� (Derkatch et al. 1998), MT557/3b (MATa ade2-1sup45-2 leu2-3,112 ura3-1 his5-2) (Stansfield et al. 1995a), andFS1 (MATa, ade2-592 lys2-201 leu2-3,112 his3-200 ura3-52)(Namy et al. 2001).

The modified FS1strain used in the screen was constructedas follows: From the ADE2 gene and its promoter cloned in acentromeric URA3 vector (pFL38), a readthrough sequencederived from tobacco mosaic virus (TMV) (GGAACACAATAGCAGTTACAG) was cloned in the unique HpaI restrictionsite located within the coding sequence of the ADE2 gene(Namy et al. 2001). A homologous recombination in the FS1strain at the ADE2 locus was performed with this vectorlinearized by enzymatic restriction. The recombined whiteclones were selected on complete medium depleted in adeninedue to the recovery of the activity of the synthesized Ade2p

1528 I. Hatin et al.

protein. The correct integration was verified by sequencing ofthe genomic allele.

The strains were grown in minimal media supplementedwith the appropriate amino acids to allow maintenance of thedifferent plasmids after transformation. Yeast transformationswere performed by the lithium acetate method (Ito et al.1983). Color screening was performed on plates containing adrop-out medium, complete supplemented medium (CSM)(Bio 101), with all amino acids and 10 mg/liter adenine. Thecolor intensity was checked after incubation for 5 days at 30�. 5-FOA was added at a final concentration of 1.5 mg/ml to selectthe loss of URA3 plasmids.

Plasmids and molecular biology methods: A yeast genomicDNA library was kindly provided by Francxois Lacroute. It wasconstructed by partial restriction of genomic DNA by SauIIIAfrom the S288c strain, and then fragments were ligated intothe BamHI site of the pFL44L multicopy vector (Bonneaud

et al. 1991). pAC derivatives were constructed by cloning thefragment of interest in the unique MscI site between LacZ andLuc open reading frames (ORFs) of pAC99 (Stahl et al. 1995;Bidou et al. 2000).

The identification of the candidate genes was obtainedby release of plasmid DNA from yeast, as already describedby Hoffman and Winston (1987), and used to transformEscherichia coli strain DH5a. Plasmid DNA was extracted fromtransformants, and boundaries of the insert were sequencedusing �21M13 and M13 reverse primers. This allowed us todetermine the coordinates of the genomic region and to iden-tify the ORFs and genes present on the insert by comparisonwith data from the Saccharomyces Genome Databank.

The construction of the mutated SSB1 coding sequence wasrealized as follows: A mutagenesis on pUC-SSB1cds using ahigh-fidelity Taq DNA polymerase Pfu from Stratagene (LaJolla, CA) was done for SSB435, a couple of oligonucleotides,435w (CAAGAGAAGAACCTTTACTA CAGTCGCTG ACAACCAAACCACCGTTC) and 435c (GAACGGTGGTTTGGTTGTCAG CGACTGTAGTAAAGGTTCTTCTCTTG); for SSB436,436w (GAGAAGAACCTTTACT ACATGTAGTGACAACCAAACCACCGTTCAATTCCC) and 436c (GGGAATTGAACG GTGGTTTGGTTGTCACTACAT GTAGTAAAGGTTCTTCTC); andfor SSBCA, CAw (CCATCAAGAGAAGAACCTTTACTACAGTCAGTGACAACCAAACCACCGTTCAAT TCCC) and CAc (GGGAATTGAACGGTGGTTTGGTTGTCACTGACTGTAGTAAAGGT TCTTCTCTTGATGG). The mutated pUC-SSB1cds vec-tors, after control of the sequence of the mutated region usingas primer of sequence the oligonucleotide SSBseq2, have beendigested by BglII and AgeI restriction enzymes to be cloned atthe same sites in the pUC-SSB. The sequence of the mutatedpUC-SSB was verified. Then the SSB-mutated sequences underits own promoter were cloned in pFL44L vector following thesame procedure as for wild-type SSB1 under its own promoter.

The construction of SUP45 on multicopy vector was re-alized from the pSP35-45 with SUP35 and SUP45 under con-trol of their own promoter (Bidou et al. 2000). The SUP35 andSUP45 with their promoter were inserted into the multicopypHS8 vector at the PvuII restriction site and were calledpHS35-45. The SUP45 with its own promoter was purifiedfrom agarose gel after digestion of pHS35-45 by XbaI andcloned at the same restriction site into the pHS8 vector, andthis vector was called pHS-SUP45.

The construction of the eEF1Ba coding sequence underthe cyc1 promoter was realized as follows: Total RNA from theFy S. cerevisiae strain was extracted from 5 ml of exponentialyeast culture (Schmitt et al. 1990) treated by 10 units of RNasefree DNase I (Boehringer Mannheim, Indianapolis) at 37� for1 hr. DNase I was inactivated by heating at 90� for 5 min, as rec-ommended by the manufacturer. RNA was reverse transcribedwith random primer with a Superscript II kit (Invitrogen, San

Diego) for amplification of eEF1Ba coding sequence withhigh-fidelity Taq DNA polymerase Pfu from Stratagene usingeEF1Ba AUG (ATGGCATCCACCGATTTCTC) and eEF1BaUAA (TTATAATTTTTGCATAGCAG) as primers. The amplimerwas cloned in pUC19 vector at the HincII restriction site and arecombinant vector called pUC-eEF1Bacds was sequencedusing �21M13, M13 reverse primers. The eEF1Ba codingsequence cloned in pUC-SSB1cds vector was cut by PstI andEcl136II restriction enzymes to be cloned at the same restric-tion site in pCM189 vector. The eEF1Ba coding sequence un-der the cyc1 promoter was then cloned in the pFL44L vector atthe SmaI site by enzymatic restriction of the pCM-eEF1Bacdsvector with Eco47III and HindIII filled by Klenow enzyme.Recombinant clones in the right orientation without an intronwere verified by amplification, enzymatic restriction, and se-quencing of the junction site.

The small nucleolar RNA (snoRNA) snR18 was also clonedunder the cyc1 promoter as the eEF1Ba coding sequence butin the first step using snRw (TAAGCATCCACCGATTTCTCCAAGATTG) and snRc (TTAGGTTGAACCATCTGGAGAATTTCTGGG) to amplify genomic DNA from the Fy S. cerevisiaestrain with high-fidelity Taq DNA polymerase Pfu from Strat-agene. All constructs were verified by sequencing the region ofinterest using the Big Dye terminator kit and were migrated onan ABI310 automatic sequencer (Applied Biosystems, FosterCity, CA).

Quantification of readthrough efficiency: Luciferase and b-galactosidase activities were assayed in the same crude extractas previously described (Stahl et al. 1995). All the quantifica-tion was the median of at least five independent measurements.The efficiency is defined as the ratio of luciferase activity tob-galactosidase activity. To establish the relative activities ofb-galactosidase and luciferase, the ratio of luciferase activityto b-galactosidase activity from an in-frame control plasmid wastaken as a reference. Efficiency of readthrough, expressedas percentage, was calculated by dividing the luciferase/b-galactosidase ratio obtained from each test construct by thesame ratio obtained with an in-frame control construct (Bidou

et al. 2000).

RESULTS

The genetic screen used was based on the ability tomonitor termination efficiency through the expressionof the ADE2 gene, which encodes the P-ribosyl-amino-imidazole-carboxylase (EC 4.1.1.21), responsible for thedegradation of the red pigment amino imidazole ribo-tide. The screen was performed in a FS1 strain where theade2 gene is interrupted by an in-frame UAG stop codonderived from the TMV leaky context (for the strain con-struction, see materials and methods). This contextpromotes 15% of readthrough that leads to an expres-sion of Ade2p sufficient to degrade its red substrate andobtain white colonies (Namy et al. 2001). This strain wastransformed with a S. cerevisiae genomic library cloned onthe multicopy pFL44L vector and plated on minimalmedium supplemented with CSM containing a mini-mum quantity of adenine (10 mg/liter), allowing healthygrowth with the optimization of red color. This allowedus to isolate ‘‘antisuppressor’’ factors in a single step. Of52,000 transformants, 26 displayed a red color after 5days at 30�. To check whether the antisuppressor phe-notype of the clones was due to the presence of an

Fine-Tuning of Translation Termination 1529

overexpressed gene, they were plated in the presence of5-FOA, which selects for cells that have lost the plasmid.All of the isolated candidates, except no. 17, reversedthe phenotype after 1 week; this isolate was kept to serveas a negative control in further experiments. This resultdemonstrates that, for the vast majority of the candi-dates, the effect was dependent on the continuouspresence of the vector. This point is important since itruled out the involvement of a cytoplasmic factor, whichmight have been induced by an overexpressed gene. Foreach of the 25 confirmed candidates, sequencing of thefragment boundaries was performed, allowing identifi-cation of the inserted genomic fragment. The completelist of the genes present on these 25 fragments is pre-sented in Table 1. Seven are known to be involved indifferent aspects of translation: ribosomal protein, trans-lation termination factor, translation initiation factor,elongation factor, tRNA, and Hsp70 chaperone.

Many irrelevant factors might modify the pigmentaccumulation in cells. Among these are the enzymesearly in the adenine biosynthesis pathway, proteinsinvolved in vacuole permeability where the pigmentaccumulates, factors involved in controlling the effi-ciency of translation initiation, etc. To identify factorsactually involved in translation termination, we usedan independent reporter system and quantified read-

through efficiency in the presence or absence of thecandidate plasmids.

These vectors (pAC) carry a dual lacZ-luc reporterinterrupted by a unique cloning site at the junction ofthe two coding sequences where in-frame stop codons indifferent contexts are inserted. The SV40 promoter,known to be active in both S. cerevisiae and mammaliancells (Camonis et al. 1990), drives the expression. b-Galactosidase that originates from translation upstreamof the stop codon is used as an internal control, reca-pitulating the different levels where expression couldbe modulated. The firefly luciferase activity dependson translation downstream of the stop codon and allowsprecise quantification of readthrough (Stahl et al.1995; Bidou et al. 2000). Under these conditions, theratio of firefly luciferase to b-galactosidase activitiesreflects the readthrough efficiency without interferencefrom other levels of control. To obtain absolute read-through levels, the values obtained with the test con-structs are normalized against results from a similar duallacZ-luc reporter gene where the stop is replaced with asense codon. Each of the 26 vectors was cotransformed,with a pAC vector bearing a UAG stop codon, into theFS1 strain. For each cotransformation, five independentassays with two independent clones were performed.The readthrough level was quantified and compared to

TABLE 1

Selected clones

Name Insert size (bp) ORF or gene name Readthrough decrease (%)

1 4732 MRPL32-YCP4-CIT2-YCR006 �152 3490 VPS8-SNR18-eEF1Ba �263 5462 MSN1-RRI2-YOL118c-MCH4 �94 5764 SSB1-YDL228c-HO �465 5434 PRC1-YMR298w-YMR299c-ADE4-ATML �376 4572 STB4 �117 3945 SUP35-ARG82-HMO1- �258 3882 YBR225w-YBR226c-MCX1-SLX1 �129 4292 RPL20B-SPS4-YOR314w-YOR314W A-59YOR315w �2010 4092 BNA4 -BRN1-YBL096c-YBL095w �1711 6574 PTP1-SSB1-YDL228c-HO �4312 6033 STU1-RIB1-HEK2-SHE1 �1313 4000 VTS1-PDE2-PRT1 �1014 4636 SSB1-YDL228c-HO �3515 3928 ILV2-YMR107w-YMRWD15-YMRcD14 �2016 5429 YAP1-GIS4-ARNtS(AGA) �3518 5140 ATM1-PRP12 �1219 4088 TUS1-YLRCD26 �2120 4531 HFA1-ERG12-YMR209c �521 9430 VPS67-YKR021W-YKR022C-YKR023W-DBP7-RPC37 �1022 5170 eEF1Ba-SNR18-VPS8 �5623 5724 PTP1-SSB1-YDL228c-HO �4024 6257 PIN4-SAS3-YBL053w-YBL054w �2025 3680 SSB1-YDL228c-HO �5126 5735 MPH2-YDL246C �8

Twenty-five clones selected with the name of the genes present on the DNA fragments are listed. FS1 strainwas cotransformed with pFL44L clones and pAC vector bearing a UAG stop codon. The readthrough decreasewas expressed as the percentage of readthrough decrease referred to empty pFL44L vector.


that obtained in the presence of an empty pFL44L vec-tor. As shown in Table 1, the readthrough level decreasesin the presence of each of the 25 confirmed candidates.To assess if the difference of readthrough level betweencandidates and strain FS1 transformed by the emptypFL44L vector is significant, we performed a nonpara-metric statistical test (Mann–Whitney). Candidate no.17, like the empty pFL44L cloning vector, did not affectreadthrough, which validated the screen. According tothe Mann–Whitney test, a difference of at least 20% ontermination translation between the candidate and theempty vector is needed to consider an effect as signifi-cant. Two candidates do not exhibit a significant differ-ence in readthrough efficiency compared to the negativecontrols: isolate no. 3 carrying the transcriptional activa-tor gene MSN1 and isolate no. 12 bearing the HEK2 geneinvolved in translation initiation. On the other hand,isolate no. 7 harboring SUP35 (eRF3), isolate no. 9 car-rying RPL20B, isolate no. 18 carrying tRNAser (IGA), thefive isolates carrying the SSB1 gene, and the two isolatescarrying the eEF1Ba gene display a statistically signifi-cant difference. Altogether, 12 of the 25 candidates di-rected a significant decrease of readthrough efficiency,which indicates that the screen based on ADE2 activitywas highly stringent.

eEF1Ba: eEF1Ba is the b-subunit of the eukaryotictranslation elongation factor 1 (eEF1), which is highlyconserved both functionally and structurally amongspecies (Le Sourd et al. 2006). In yeast cells, eEF1 is aheterotrimer containing three units, responsible forbinding the amino-acylated tRNA to the ribosomal A-site and also participating in the proofreading of thecodon–anticodon match; eEF1A is a classic G proteininvolved in the GTP-dependent binding of amino-acylated tRNA, and the eEF1Ba subunit, associated withthe g-subunit, functions as a guanine exchange factorin vitro and catalyzes the exchange of GDP for GTP oneEF1A to recycle it. The function of eEF1B has beendescribed as critical in regulation of eEF1A activity, trans-lational fidelity, translation rate, and cell growth (Le

Sourd et al. 2006). The eEF1Ba gene, in addition to en-coding the eEF1Ba translation factor, contains an in-tervening sequence encoding the small nucleolar RNAsnR18. To determine whether the increased expression

of eEF1Ba protein or snR18 is involved in the decreaseof readthrough, we have cloned two different versions ofthe coding region in a multicopy vector pFL44L underthe strong Cyc1 promoter: (i) the open reading frame ofeEF1Ba without the intron and (ii) the intron contain-ing snR18 surrounded by only 80 nt of the eEF1Ba cod-ing sequence and lacking the ATG. These constructswere transformed into the FS1 parental strain. As shownin Figure 1, only the construct carrying snR18 was ableto restore the antisuppression phenotype. The read-through efficiencies directed by these two constructswas quantified using the three stop codons in the samesurrounding context cloned in the pAC vector astargets. Strains cotransformed with the two pFL44L con-structs were compared to strains cotransformed with theempty vector. Results presented in Table 2 show that,with the construct expressing only the snR18 maturedfrom the eEF1Ba intron, there is a significant decreaseof readthrough (31–20%, P ¼ 0.03) on the UAG stopcodon and a slight decrease of readthrough on the UAAand UGA stop codons (11–10%, P¼ 0.045 and 15–10%,P ¼ 0.025, respectively). Interestingly, a strong increaseof readthrough on UAA and UGA stop codons is ob-served upon overexpression of the eEF1Ba open read-ing frame without an intron (11–27%, P ¼ 0.012 and15–38%, P ¼ 0.006, respectively). This is reminiscentof previous observations by Carr-Schmid et al. (1999).Altogether, we have observed that the increase of ter-mination, especially for the UAG stop codon, involvesthe small nucleolar RNA snR18, and not eEF1Ba.

Figure 1.—FS1 modified strain with ADE2 locus reporterwas transformed by pFL44L vector empty, pFL44L-eEF1Ba,or pFL44L-snR18 and spread on CSM minimal medium.The color intensity was checked after incubation for 5 daysat 30�.

TABLE 2

Readthrough efficiency in the presence ofoverexpressed proteins

Expression vectorTAA(%)

TAG(%)

TGA(%)

TMG(%)

IXR1(%)

MoMuLV(%)

Empty vector 11 31 15 4 3 4SSB1 2 19 9 2 1 2SSB2 5 23 19 2 2 4eEF1Ba

coding sequence27 36 38

snR18 10 20 10SUP35 and SUP45 3SUP45 4

The readthrough efficiency was expressed as the ratio of lu-ciferase activity to b-galactosidase activity referred to a similarratio from an in-frame control in the presence or absence ofthe overexpressed proteins Ssb1p and Ssb2p, the eEf1bapcoding sequence, and the snoRNAs SnR18 and Sup45p aloneor with Sup35p. Columns correspond to the different stop co-don targets tested: TAA, TAG, and TGA correspond tothe three stop codons in the same TMV-surrounded context(CAA stop CAA); TMG corresponds to the TAG stop codonsurrounded by CAG on each side of the stop; IXR1 corre-sponds to the TAA stop codon from the IXR1 S. cerevisiae cod-ing sequence; and MoMuLV corresponds to the TAG stopcodon from the Gag–Pol junction of the Moloney murine leu-kemia virus. All the tests were performed in the FS1 strain.


SSB1: As mentioned above, the five candidatescarrying the SSB1 gene and YDL228c were all able toefficiently decrease the readthrough level (from 35 to51%) when cotransformed with pAC-TMG (comparedto the empty vector pFL44L). To establish if this effectcould be attributed to SSB1 or YDL228c overexpression,we cloned the SSB1 coding sequence in a centromericvector under the strong Cyc1 promoter (pCMSSB1) andtested the readthrough efficiency in the presence of thisconstruct in different S. cerevisiae strains. Results pre-sented in Figure 2 show that overexpression of SSB1reproduces the effect observed with the entire DNAfragment, although translational termination increasesto a greater extent when expressed from the multicopyvector than from a centromeric vector (2- and 1.6-fold,respectively, in the FS1 strain). Overexpression of SSB1from a multicopy vector has a significant effect ontermination in 74D694 ½psi�� and FS1 strains (1.3- to 2-fold, respectively), but surprisingly not in the ½psi1�state in the 74D694 strain (Figure 2). This may berelated to different levels of accumulation of the Sup35protein in these two strains.

To better characterize the effect of SSB1 protein, wetested a panel of recoding targets corresponding to dif-ferent stop codons and surrounding sequences in theFS1 strain: the UAG stop codon targets correspondingto the TMV termination context, a derived sequence(TMG) where CAA on each side of the stop were re-placed by CAG, and the MoMuLV context including theUAG stop and the downstream pseudoknot. In all cases,a 2-fold increase of translation termination is observedupon SSB1 overexpression (Table 2). The effect of SSB1overexpression on termination was also examined in thethree stop codons in the TMV context. Although aneffect is observed in all cases, its extent varies, from a 1.5-fold increase with UGA to a 4-fold increase with UAA.

We also tested the effect of overexpressing the para-logous SSB2 gene under its own promoter cloned in the

multicopy vector pYESSB2 and compared the same vec-tor expressing SSB1 (kindly provided by S. Rospert) onthe same set of readthrough targets. As shown in Table 2,the effect on the level of translation termination wassignificantly less pronounced for Ssb2p than for Ssb1p.

As mentioned above, overexpression of release fac-tors in yeast has been shown to have only a moderateeffect on translation termination. To compare the ex-tent of the effect directed by Ssb1p and release factoroverexpression, we cloned both SUP45 and SUP35 geneson the same multicopy vector and quantified the read-through efficiency. As for Ssb1p, a threefold increase wasobtained upon Sup35p and Sup45p overexpression onthe UAA stop codon in the TMV readthrough context.This confirms the relatively weak effect of the over-expression of both factors on termination.

To evaluate whether Ssb proteins are actually involvedin the termination process, we used the MT556/3b strainthat carries a sup45 thermo-sensitive allele and deter-mined whether Ssb1p overexpression could revert thephenotype. The readthrough level was quantified at 30�in the presence or absence of the overexpressed releasefactor eRF1 or/and the Ssbp chaperones. The Sup45thermo-sensitive S. cerevisiae strain was first transformedwith multicopy URA3 vectors carrying either SUP45alone or SUP45 and SUP35. The MT556/3b strain wasthen transformed with pYESSB1 or pYESSB2 or theempty pFL44L vector. Figure 3 shows that a very highreadthrough level is obtained with all three stop codonsin the TMV context in the MT557/3b strain (27%on UGA, 33% on UAA, and 69% on UAG stop codon).The readthrough efficiency decreases �10-fold for allstop codons in the presence of overexpressed wild-typeSup45p protein, but is not affected by Ssb1p or Ssb2poverexpression (Figure 3). We then examined thethermo-sensitive phenotype. At 30�, all transformantsgrow on liquid culture with a generation time of 2 hr. At37�, only cells transformed with SUP45, with SUP45 andSUP35, or with SSB1 are able to grow, but no growth isdetected in cells transformed with pFL44L or SSB2. Thegeneration time is 8 hr with SSB1 and 2 hr with SUP45 atnonpermissive temperature (Table 3). Thus, overexpres-sion of Ssb1p, but not of Ssb2p, allows a partial recoveryof the thermo-resistance in the Sup45 thermo-sensitivestrain (Figure 4). To determine if suppression of thethermo-sensitive phenotype is a general chaperone ef-fect of Ssb1p, we tested in the same manner the ability ofSsb1p to revert thermo-sensitivity of a cdc25 thermo-sensitive mutant in the strain OL556. We observe no re-version of thermo-sensitive phenotype in this strain inpresence of Ssb1p overexpression (data not shown).

The difference in the ability of Ssb1p and Ssb2p torevert the sup45p thermo-sensitivity allows determiningif one or more of the amino acids that differ between thetwo proteins could play a role in the ability to revert thethermo-sensitivity. An aspartate is found in Ssb1p and aglutamine is found in Ssb2p at position 49 in the ATPase

Figure 2.—FS1 and 74D694 ½psi�� or ½psi1� strains were co-transformed with pAC-TMG vector bearing a UAG stop codonand SSB1 expressed either from centromeric (pCMSSB1) ormulticopy (pYESSB1) vector. The readthrough level was ex-pressed as the percentage of readthrough decrease referredto the empty vector.


domain. Three others are found in the polypeptide-binding domain and correspond to methionine at posi-tion 413, cysteine at position 435, and alanine at position436 in Ssb1p compared to isoleucine, valine, and serineat the corresponding positions in Ssb2p (Figure 5).Methionine and isoleucine are neutral amino acids, butcysteine in SSB1 could form a disulfide bridge, which isnot possible in Ssb2p. The cysteine in position 435 wasmutated to valine or the alanine in position 436 was mu-tated to serine in Ssb1p protein. A third mutant was con-structed with both mutations. Overexpression of any ofthese mutated forms is not able to revert the thermo-sensitive phenotype (Figure 4).

DISCUSSION

In this work, we identify eEF1Ba and SSB1 genes asable to increase translation termination efficiency whenoverexpressed. Since the eEF1Ba gene that encodesthe b-subunit of the eukaryotic translation elongation

factor 1 also carries an intron encoding the snR18snoRNA, we uncoupled expression of these two factorsand showed that the effect on termination is directed bythe snR18. In the following sections, we shall discuss theresults obtained with the two genes independently,although they may have similar mode(s) of action sinceboth potentially affect the peptide exit tunnel region ofthe ribosome.

snR18: The maturation of preribosomal RNA in thetranslational machinery involves a large number of cleav-age events, which frequently follow alternative pathways.In addition, ribosomal RNAs (rRNAs) are extensivelymodified, with the methylation of the 29-hydroxyl groupof sugar residues and conversion of uridines to pseu-douridines being the most frequent modifications,although the extent of the modification event (i.e., theproportion of modified ribosomes) is unknown and pos-sibly variable (Grosjean 2005). In particular, the degreeof modification has been shown to vary with growth tem-perature in certain Archaea, plants, and trypanosomes(Brown et al. 2003; Omer et al. 2003; Uliel et al. 2004).In humans, it has been shown that the 5.8S rRNA is hypo-29-O-methylated in neoplastic tissues (Munholland and

Figure 3.—The readthrough level in MT557/3b strain was quantified by the dual reporter sys-tem pAC with the three stop codon targets TAA,TAG, or TGA in the presence or absence of over-expressed Sup45p, Ssb1p, or Ssb2p.

TABLE 3

Growth of the MT557/3b strain in the presence ofoverexpressed proteins at permissive and

nonpermissive temperatures

Generation time

MT557/3b transformed by 30� 37�

Empty vector 2 hr .20 hrSUP45 2 hr 2 hrSSB1 2 hr 8 hrSSB2 2 hr .13 hrSsb1.435 2 hr .13 hrSsb1.436 2 hr .13 hrSsb1.CA 2 hr .13 hr

The generation time at 30� and 37� was established fromliquid culture of the MT557/3b strain in the presence or ab-sence of overexpressed proteins Sup45p, Ssb2p, and Ssb1pand Ssb1p mutants.

Figure 4.—The MT557/3b strain transformed or not trans-formed by mutated overexpressed proteins Sup45p, Ssb2p,Ssb1p, or ssb1p was incubated at 30� and 37� for 3 days.


Nazar 1987). Both cleavage and modification reactionsof pre-rRNAs are assisted by a variety of an abundantclass of trans-acting RNAs, snoRNAs, which function inthe form of ribonucleoprotein particles (snoRNPs).The majority of snoRNAs act as guides directing site-specific 29-O-ribose methylation or pseudouridine for-mation by base pairing near target sites. EukaryoticrRNAs display a complex pattern of ribose methylations.Ribose methylations of eukaryotic rRNAs are eachguided by a cognate small RNA, belonging to the familyof box C/D antisense snoRNAs, through transient for-mation of a specific base pairing at the rRNA modifica-tion site. Over 100 RNAs of this type have been identifiedto date in vertebrates and the yeast S. cerevisiae. ManysnoRNAs are produced by unorthodox modes of bio-genesis, including salvage from introns of pre-mRNAs,as for snR18 in yeast, or from non-protein-coding tran-scripts. In yeast, however, numerous snoRNAs are gen-erated from independent transcription units.

The snoRNA snR18 is 102 nucleotides long andguides the methylation at the sites corresponding tothe A647/C648 positions of the 25S rRNA (Lowe andEddy 1999). We have shown here that overexpression ofsnR18 induces increased termination efficiency. Differ-ent mechanisms may account for this observation. If theeffect is direct, it could act through a hyper-modificationof the A647/C648 position. This would imply that, inthe normal situation, not all ribosomes are methylatedat this position and that modified ribosomes are moreefficient terminators than unmodified ones. Althoughthe proportion of ribosomes methylated at A647/C648is not known, it has been shown for other positions thatonly a fraction of ribosomes are modified (Grosjean

2005). Alternatively, the effect of snR18 overexpressionmight be indirect. A possibility would be that it actsthrough titration of a general factor(s)—perhaps eventhe methylase Nop1p—involved in the biogenesis or ac-tion of methylation snoRNPs, which could result in pro-ducing fewer snoRNP complexes, less active snoRNPcomplexes, and/or less stable snoRNP complexes. Suchan effect might lead to hypomethylation of other po-sition(s). The precise role of the different methylatednucleotides in the rRNA has not yet been deciphered,precluding further speculations.

While trying to identify the portion of the eEF1Ba

gene region involved in the effect on readthrough, wemade the interesting observation that overexpression ofthe eEF1Ba gene, devoid of its snR18-encoding intron,actually decreases termination efficiency. This is in full

agreement with the work of Carr-Schmid et al. (1999)who have previously shown that eEF1Ba mutants exhibitan antisuppressor phenotype. They interpreted thiseffect as a more efficient competition for recognitionof the stop codon by release factors due to an increasedratio of release factor to active eEF1A. This interpreta-tion is strongly supported by the results presented here.Finally, it might be significant that two factors acting inan opposite way on termination are coexpressed as asingle RNA, preventing an imbalance in terminationefficiency.

SSB1: We show that the SSB1 gene is able to increasetranslation termination efficiency when overexpressed.This increase is effective on the three stop codons, al-though to different extents, and on several stop codoncontexts. Ssb1p is one of the Hsp70 homologs presentin the S. cerevisiae genome. It is closely related to itsSsb2p paralogous gene. Ssb1p and Ssb2p share identicalfunction and a similar level of expression; they differ byfour amino acids (Boorstein et al. 1994). Rakwalska

and Rospert (2004) showed previously that the lack offunctional Ssb1/2 in yeast caused severe problems intranslational fidelity, which were strongly enhanced byparomomycin and correlated with growth inhibition.Since SSB1 and SSB2 transcript levels are regulated inde-pendently of those of genes encoding ribosomal pro-teins (see Discussion in Muldoon-Jacobs and Dinman

2006), not all ribosomes would be associated withfunctional chaperone complement, and overexpressionof Ssb proteins would improve the functioning of theribosome.

The quantification of readthrough in the strain witha conditional-lethal mutant allele of SUP45 (sup45-2)demonstrates an extremely high level of readthroughon the UAG stop codon and 30% readthrough on UAAand UGA stop codons in the same surrounding envi-ronment. Ssb1p overexpression does not decrease thereadthrough level in the SUP45 thermo-sensitive strainbut specifically allows a partial recovery of the thermo-resistance phenotype, which suggests that this effectcould be associated with the chaperone role of theSsb1p protein in the folding of the Sup45p protein. Itwould, however, be insufficient to allow a significant ef-fect on the termination capacity of the protein, since themutation specifically affects this activity. Interestingly,overexpression of Ssb2p protein was unable to reversethe Sup45p thermo-sensitivity phenotype. The proteinsdiffer by only four amino acids. Of these four aminoacids, three are located in the polypeptide-binding

Figure 5.—Four amino acids differ between S.cerevisiae SSB1 and SSB2. These proteins show anATPase domain from amino acid 1 to 400 and apolypeptide-binding domain from amino acid401 to 507.


domain. We analyzed the role of cysteine 435 andalanine 436 found in the Ssb1p protein by mutatingthem to the amino acids found in the correspondingresidues of the Ssb2p protein. The mutant Ssb1p pro-teins are not able to reverse the thermo-sensitivity ofthe mutant SUP45 strain. This demonstrates that thepolypeptide-binding domain is responsible for the spe-cific effect of Ssb1p on the thermo-sensitive phenotypeof the strain with allele sup45-2. Since the effect wasrecapitulated by mutation of only the cysteine residue, itcould be dependent on the formation of a specific di-sulfide bridge with misfolded Sup45p. Although we can-not exclude an additional effect of the polymorphismlocated in the ATPase domain, this effect should belimited, since the mutants of the polypeptide-bindingdomain recapitulate the observed difference betweenthe two isoforms.

Possible involvement of the polypeptide exit tunnelof the ribosome in translation termination: Ssbp isassociated with the ribosome when it is actively synthe-sizing proteins (Nelson et al. 1992), and it interacts withboth the ribosome and directly with the nascent chainas it emerges from the ribosome. Ssb1p and Ssb2p areactually in close proximity to a variety of nascent poly-peptides (Pfund et al. 1998; Gautschi et al. 2002;Rospert et al. 2002). This suggests that Ssbp functionsas a chaperone for polypeptide chains during trans-lation. Such a role in emerging polypeptides could beto facilitate the successful folding of newly synthesizedproteins (Beckmann et al. 1990; Frydman et al. 1994;Hardesty et al. 1995; Eggers et al. 1997). An alternativeexplanation of the role of the Ssb chaperone would bethrough a direct role in the decoding process. As pro-posed by Muldoon-Jacobs and Dinman (2006), Ssbchaperone activity might help nascent peptides to backup into the exit tunnel and thus would participate in theefficient accommodation of the aminoacyl tRNA in theribosomal A-site. Whatever the mechanism involved, it

is significant that the absence of the RAC complexcomponents, Ssz1 and zuotin, decreases translationalaccuracy, reinforcing the role of the ribosome-exit-tunnel-associated chaperone in decoding (Rakwalska andRospert 2004). Whether overexpression of Ssz1 andzuotin also increases termination efficiency would beinteresting to determine.

Remarkably, positions A647/C648 that are methyl-ated by the snoRNA snR18 were included in the se-quences identified as approaching the surface aroundthe lumen of the polypeptide exit tunnel in the largeribosomal subunit (Nissen et al. 2000) (see Figure 6).Although the precise mechanism of this effect could notbe inferred from the study reported here, the fact thatboth Ssb1p and snR18 are somehow linked to the exittunnel might be significant regarding the terminationmechanism.

We thank members of our laboratory for numerous stimulatingdiscussions. This research was supported by grants from the Associa-tion pour la Recherche sur le Cancer (grant 3849 to J.-P.R.) and theAssociation Francxaise contre les Myopathies (grants 9584 and 10683to J.-P.R.).

LITERATURE CITED

Alkalaeva, E. Z., A. V. Pisarev, L. Y. Frolova, L. L. Kisselev andT. V. Pestova, 2006 In vitro reconstitution of eukaryotic trans-lation reveals cooperativity between release factors eRF1 andeRF3. Cell 125: 1125–1136.

Andjelkovic, N., S. Zolnierowicz, C. Van Hoof, J. Goris and B. A.Hemmings, 1996 The catalytic subunit of protein phosphatase2A associates with the translation termination factor eRF1.EMBO J. 15: 7156–7167.

Bailleul, P. A., G. P. Newnam, J. N. Steenbergen and Y. O. Chernoff,1999 Genetic study of interactions between the cytoskeletal as-sembly protein sla1 and prion-forming domain of the release fac-tor Sup35 (eRF3) in Saccharomyces cerevisiae. Genetics 153: 81–94.

Barton-Davis, E. R., L. Cordier, D. I. Shoturma, S. E. Leland

and H. L. Sweeney, 1999 Aminoglycoside antibiotics restoredystrophin function to skeletal muscles of mdx mice. J. Clin.Invest. 104: 375–381.

Figure 6.—snR18 guides modification to sitesin the wall of the polypeptide exit tunnel. (A)The large ribosomal subunit viewed down thepolypeptide exit tunnel, with the start of the tun-nel in the front of the image and the end, wherethe nascent polypeptide emerges, in the back. Pro-teins (red) and RNA as ribbon representation.The nucleotides targeted for 29-O-methylationdue to complementarity between the rRNA andsnR18 are highlighted by showing their van derWaals radii (green). Starting in the canonical‘‘crown view,’’ the subunit (of Thermus thermophi-lus; pdb code 2j01) has been rotated forwardslightly around the horizontal axis and slightlycounterclockwise around the vertical axis. Thefragment of A-site tRNA visible in the complexis pink; a complete P-site tRNA (purple) and

E-site tRNA (cyan) is observed. Importantly, the targeted sites occur in the conserved core of the large subunit (Gerbi 1996),validating examining structures from other species. (B) Cross section of the large ribosomal subunit (a 13.2 A thick slab) as viewedfrom the side to feature the polypeptide exit tunnel. Details are as in A, except the tRNAs are not shown. This view is obtained byrotation of 90� about the vertical axis from the crown view and rotating the subunit backward slightly around the horizontal axis.


Beckmann, R. P., L. E. Mizzen and W. J. Welch, 1990 Interaction ofHsp 70 with newly synthesized proteins: implications for proteinfolding and assembly. Science 248: 850–854.

Bedwell, D. M., A. Kaenjak, D. J. Benos, Z. Bebok, J. K. Bubien et al.,1997 Suppression of a CFTR premature stop mutation in abronchial epithelial cell line. Nat. Med. 3: 1280–1284.

Bertram, G., H. A. Bell, D. W. Ritchie, G. Fullerton and I.Stansfield, 2000 Terminating eukaryote translation: domain1 of release factor eRF1 functions in stop codon recognition.RNA 6: 1236–1247.

Bidou, L., G. Stahl, I. Hatin, O. Namy, J. P. Rousset et al.,2000 Nonsense-mediated decay mutants do not affect pro-grammed -1 frameshifting. RNA 6: 952–961.

Bidou, L., I. Hatin, N. Perez, V. Allamant, J. J. Panthier et al.,2004 Premature stop codons involved in muscular dystrophiesshow a broad spectrum of readthrough efficiencies in responseto gentamicin treatment. Gene Ther. 11: 619–627.

Bonetti, B., L. W. Fu, J. Moon and D. M. Bedwell, 1995 The effi-ciency of translation termination is determined by a synergisticinterplay between upstream and downstream sequences in Sac-charomyces cerevisiae. J. Mol. Biol. 251: 334–345.

Bonneaud, N., O. Ozier-Kalogeropoulos, G. Y. Li, M. Labouesse,L. Minvielle-Sebastia et al., 1991 A family of low and highcopy replicative, integrative and single-stranded S. cerevisiae/E. coli shuttle vectors. Yeast 7: 609–615.

Boorstein, W. R., T. Ziegelhoffer and E. A. Craig, 1994 Molecularevolution of the HSP70 multigene family. J. Mol. Evol. 38: 1–17.

Boy-Marcotte, E., D. Tadi, M. Perrot, H. Boucherie and M. Jacquet,1996 High cAMP levels antagonize the reprogramming of geneexpression that occurs at the diauxic shift in Saccharomyces cer-evisiae. Microbiology 142(Pt. 3): 459–467.

Brenner, S., L. Barnett, E. R. Katz and F. H. Crick, 1967 UGA:a third nonsense triplet in the genetic code. Nature 213: 449–450.

Brown, C. M., P. A. Stockwell, C. N. Trotman and W. P. Tate,1990 Sequence analysis suggests that tetra-nucleotides signalthe termination of protein synthesis in eukaryotes. Nucleic AcidsRes. 18: 6339–6345.

Brown, J. W., M. Echeverria and L. H. Qu, 2003 Plant snoRNAs:functional evolution and new modes of gene expression. TrendsPlant Sci. 8: 42–49.

Camonis, J. H., M. Cassan and J. P. Rousset, 1990 Of mice andyeast: versatile vectors which permit expression in both buddingyeast and higher eukaryotic cells. Gene 86: 263–268.

Carr-Schmid, A., L. Valente, V. I. Loik, T. Williams, L. M. Starita

et al., 1999 Mutations in elongation factor 1beta, a guanine nu-cleotide exchange factor, enhance translational fidelity. Mol.Cell. Biol. 19: 5257–5266.

Cassan, M., and J. P. Rousset, 2001 UAG readthrough in mamma-lian cells: effect of upstream and downstream stop codon con-texts reveal different signals. BMC Mol. Biol. 2: 3.

Chavatte, L., L. Frolova, L. Kisselev and A. Favre, 2001 Thepolypeptide chain release factor eRF1 specifically contacts thes(4)UGA stop codon located in the A site of eukaryotic ribo-somes. Eur. J. Biochem. 268: 2896–2904.

Chernoff, Y. O., 2001 Mutation processes at the protein level: IsLamarck back? Mutat. Res. 488: 39–64.

Cosson, B., A. Couturier, S. Chabelskaya, D. Kiktev, S. Inge-Vechtomov et al., 2002 Poly(A)-binding protein acts in transla-tion termination via eukaryotic release factor 3 interaction anddoes not influence ½PSI(1)� propagation. Mol. Cell. Biol. 22:3301–3315.

Czaplinski, K., M. J. Ruiz-Echevarria, S. V. Paushkin, X. Han, Y.Weng et al., 1998 The surveillance complex interacts with thetranslation release factors to enhance termination and degradeaberrant mRNAs. Genes Dev. 12: 1665–1677.

Derkatch, I. L., M. E. Bradley and S. W. Liebman, 1998 Over-expression of the SUP45 gene encoding a Sup35p-binding pro-tein inhibits the induction of the de novo appearance of the½psi1� prion. Proc. Natl. Acad. Sci. USA 95: 2400–2405.

Eggers, D. K., W. J. Welch and W. J. Hansen, 1997 Complexes be-tween nascent polypeptides and their molecular chaperones inthe cytosol of mammalian cells. Mol. Biol. Cell 8: 1559–1573.

Engelberg-Kulka, H., 1981 UGA suppression by normal tRNA Trpin Escherichia coli: codon context effects. Nucleic Acids Res. 9:983–991.

Fluck, M. M., and R. H. Epstein, 1980 Isolation and characteriza-tion of context mutations affecting the suppressibility of non-sense mutations. Mol. Gen. Genet. 177: 615–627.

Frolova, L., X. Le Goff, H. H. Rasmussen, S. Cheperegin, G. Drugeon

et al., 1994 A highly conserved eukaryotic protein family pos-sessing properties of polypeptide chain release factor. Nature372: 701–703.

Frolova, L., X. Le Goff, G. Zhouravleva, E. Davydova, M. Philippe

et al., 1996 Eukaryotic polypeptide chain release factor eRF3 isan eRF1- and ribosome-dependent guanosine triphosphatase.RNA 2: 334–341.

Frolova, L. Y., R. Y. Tsivkovskii, G. F. Sivolobova, N. Y. Oparina, O.I. Serpinsky et al., 1999 Mutations in the highly conservedGGQ motif of class 1 polypeptide release factors abolish abilityof human eRF1 to trigger peptidyl-tRNA hydrolysis. RNA 5:1014–1020.

Frolova, L. Y., T. I. Merkulova and L. L. Kisselev, 2000 Trans-lation termination in eukaryotes: polypeptide release factoreRF1 is composed of functionally and structurally distinct do-mains. RNA 6: 381–390.

Frydman, J., E. Nimmesgern, K. Ohtsuka and F. U. Hartl,1994 Folding of nascent polypeptide chains in a high molecularmass assembly with molecular chaperones. Nature 370: 111–117.

Gautschi, M., A. Mun, S. Ross and S. Rospert, 2002 A functionalchaperone triad on the yeast ribosome. Proc. Natl. Acad. Sci.USA 99: 4209–4214.

Gerbi, S. A., 1996 Expansion segments: regions of variable size thatinterrupt the universal core secondary structure of ribosomalRNA, pp. 71–87 in Ribosomal RNA: Structure, Evolution, Processingand Function in Protein Biosynthesis, edited by R. A. Dahlberg

and A. E. Zimmermann. CRC Press, New York.Grosjean, H., 2005 Modification and editing of RNA: historical

overview and important facts to remember, pp. 1–22 in Fine-Tuningof RNA Functions by Modification and Editing, edited by H. Grosjean.Springer-Verlag, New York.

Hardesty, B., W. Kudlicki, O. W. Odom, T. Zhang, D. McCarthy

et al., 1995 Cotranslational folding of nascent proteins on Es-cherichia coli ribosomes. Biochem. Cell Biol. 73: 1199–1207.

Hoffman, C. S., and F. Winston, 1987 A ten-minute DNA prepara-tion from yeast efficiently releases autonomous plasmids fortransformation of Escherichia coli. Gene 57: 267–272.

Howard, M., R. A. Frizzell and D. M. Bedwell, 1996 Amino-glycoside antibiotics restore CFTR function by overcoming pre-mature stop mutations. Nat. Med. 2: 467–469.

Ito, H., Y. Fukuda, K. Murata and A. Kimura, 1983 Transformationof intact yeast cells treated with alkali cations. J. Bacteriol. 153:163–168.

Kandl, K. A., R. Munshi, P. A. Ortiz, G. R. Andersen, T. G. Kinzy

et al., 2002 Identification of a role for actin in translational fi-delity in yeast. Mol. Genet. Genomics 268: 10–18.

Krawczak, M., E. V. Ball, I. Fenton, P. D. Stenson, S. Abeysinghe

et al., 2000 Human gene mutation database: a biomedical infor-mation and research resource. Hum. Mutat. 15: 45–51.

Le Sourd, F., S. Boulben, R. Le Bouffant, P. Cormier, J. Morales

et al., 2006 eEF1B: at the dawn of the 21st century. Biochim.Biophys. Acta 1759: 13–31.

Liebman, S. W., and F. Sherman, 1979 Extrachromosomal psi1 de-terminant suppresses nonsense mutations in yeast. J. Bacteriol.139: 1068–1071.

Lowe, T. M., and S. R. Eddy, 1999 A computational screen for meth-ylation guide snoRNAs in yeast. Science 283: 1168–1171.

Manuvakhova, M., K. Keeling and D. M. Bedwell, 2000 Amino-glycoside antibiotics mediate context-dependent suppression oftermination codons in a mammalian translation system. RNA6: 1044–1055.

Mottagui-Tabar, S., and L. A. Isaksson, 1998 The influence of the59 codon context on translation termination in Bacillus subtilisand Escherichia coli is similar but different from Salmonellatyphimurium. Gene 212: 189–196.

Muldoon-Jacobs, K. L., and J. D. Dinman, 2006 Specific effects ofribosome-tethered molecular chaperones on programmed -1ribosomal frameshifting. Eukaryot. Cell 5: 762–770.

Munholland, J. M., and R. N. Nazar, 1987 Methylation of ribo-somal RNA as a possible factor in cell differentiation. CancerRes. 47: 169–172.


Namy, O., I. Hatin and J. P. Rousset, 2001 Impact of the six nu-cleotides downstream of the stop codon on translation termina-tion. EMBO Rep. 2: 787–793.

Namy, O., I. Hatin, G. Stahl, H. Liu, S. Barnay et al., 2002 Geneoverexpression as a tool for identifying new trans-acting factorsinvolved in translation termination in Saccharomyces cerevisiae.Genetics 161: 585–594.

Nelson, R. J., T. Ziegelhoffer, C. Nicolet, M. Werner-Washburne

and E. A. Craig, 1992 The translation machinery and 70 kd heatshock protein cooperate in protein synthesis. Cell 71: 97–105.

Nissen, P., J. Hansen, N. Ban, P. B. Moore and T. A. Steitz,2000 The structural basis of ribosome activity in peptide bondsynthesis. Science 289: 920–930.

Omer, A. D., S. Ziesche, W. A. Decatur, M. J. Fournier and P. P.Dennis, 2003 RNA-modifying machines in Archaea. Mol.Microbiol. 48: 617–629.

Patino, M. M., J. J. Liu, J. R. Glover and S. Lindquist,1996 Support for the prion hypothesis for inheritance of a phe-notypic trait in yeast. Science 273: 622–626.

Paushkin,S.V.,V.V.Kushnirov,V.N.SmirnovandM.D.Ter-Avanesyan,1996 Propagation of the yeast prion-like ½psi1� determinantis mediated by oligomerization of the SUP35-encoded poly-peptide chain release factor. EMBO J. 15: 3127–3134.

Pfund, C., N. Lopez-Hoyo, T. Ziegelhoffer, B. A. Schilke, P. Lopez-Buesa et al., 1998 The molecular chaperone Ssb from Saccha-romyces cerevisiae is a component of the ribosome-nascent chaincomplex. EMBO J. 17: 3981–3989.

Rakwalska, M., and S. Rospert, 2004 The ribosome-bound chap-erones RAC and Ssb1/2p are required for accurate translation inSaccharomyces cerevisiae. Mol. Cell. Biol. 24: 9186–9197.

Rospert, S., Y. Dubaquie and M. Gautschi, 2002 Nascent-polypeptide-associated complex. Cell. Mol. Life Sci. 59: 1632–1639.

Rospert, S., M. Rakwalska and Y. Dubaquie, 2005 Polypeptidechain termination and stop codon readthrough on eukaryoticribosomes. Rev. Physiol. Biochem. Pharmacol. 155: 1–30.

Salas-Marco, J., and D. M. Bedwell, 2004 GTP hydrolysis by eRF3facilitates stop codon decoding during eukaryotic translation ter-mination. Mol. Cell. Biol. 24: 7769–7778.

Salser, W., 1969 The influence of the reading context upon thesuppression of nonsense codons. Mol. Gen. Genet. 105: 125–130.

Schmitt, M. E., T. A. Brown and B. L. Trumpower, 1990 A rapidand simple method for preparation of RNA from Saccharomycescerevisiae. Nucleic Acids Res. 18: 3091–3092.

Skuzeski, J. M., L. M. Nichols, R. F. Gesteland and J. F. Atkins,1991 The signal for a leaky UAG stop codon in several plant virusesincludes the two downstream codons. J. Mol. Biol. 218: 365–373.

Song, H., P. Mugnier, A. K. Das, H. M. Webb, D. R. Evans et al.,2000 The crystal structure of human eukaryotic release factoreRF1: mechanism of stop codon recognition and peptidyl-tRNAhydrolysis. Cell 100: 311–321.

Stahl, G., L. Bidou, J. P. Rousset and M. Cassan, 1995 Versatilevectors to study recoding: conservation of rules between yeastand mammalian cells. Nucleic Acids Res. 23: 1557–1560.

Stansfield, I., Akhmaloka and M. F. Tuite, 1995a A mutant alleleof the SUP45 (SAL4) gene of Saccharomyces cerevisiae showstemperature-dependent allosuppressor and omnipotent suppres-sor phenotypes. Curr. Genet. 27: 417–426.

Stansfield, I., K. M. Jones, V. V. Kushnirov, A. R. Dagkesamanskaya,A. I. Poznyakovski et al., 1995b The products of the SUP45(eRF1) and SUP35 genes interact to mediate translation termina-tion in Saccharomyces cerevisiae. EMBO J. 14: 4365–4373.

Takanami, M., and Y. Yan, 1965 The release of polypeptide chainsfrom ribosomes in cell-free amino acid-incorporating systemsby specific combinations of bases in synthetic polyribonucleoti-des. Proc. Natl. Acad. Sci. USA 54: 1450–1458.

Ter-Avanesyan, M. D., V. V. Kushnirov, A. R. Dagkesamanskaya, S.A. Didichenko, Y. O. Chernoff et al., 1993 Deletion analysis ofthe SUP35 gene of the yeast Saccharomyces cerevisiae reveals twonon-overlapping functional regions in the encoded protein. Mol.Microbiol. 7: 683–692.

Tork, S., I. Hatin, J. P. Rousset and C. Fabret, 2004 The major 59determinant in stop codon read-through involves two adjacentadenines. Nucleic Acids Res. 32: 415–421.

Uliel, S., X. H. Liang, R. Unger and S. Michaeli, 2004 Small nu-cleolar RNAs that guide modification in trypanosomatids: reper-toire, targets, genome organisation, and unique functions. Int.J. Parasitol. 34: 445–454.

Urakov, V. N., I. A. Valouev, E. I. Lewitin, S. V. Paushkin, V. S.Kosorukov et al., 2001 Itt1p, a novel protein inhibiting trans-lation termination in Saccharomyces cerevisiae. BMC Mol. Biol.2: 9.

Wang, W., K. Czaplinski, Y. Rao and S. W. Peltz, 2001 The role ofUpf proteins in modulating the translation read-through ofnonsense-containing transcripts. EMBO J. 20: 880–890.

Weigert, M. G., and A. Garen, 1965 Base composition of nonsensecodons in E. coli: evidence from amino-acid substitutions at atryptophan site in alkaline phosphatase. Nature 206: 992–994.

Weng, Y., K. Czaplinski and S. W. Peltz, 1996 Genetic and bio-chemical characterization of mutations in the ATPase and heli-case regions of the Upf1 protein. Mol. Cell. Biol. 16: 5477–5490.

Williams, I., J. Richardson, A. Starkey and I. Stansfield,2004 Genome-wide prediction of stop codon readthrough dur-ing translation in the yeast Saccharomyces cerevisiae. NucleicAcids Res. 32: 6605–6616.

Zhouravleva, G., L. Frolova, X. Le Goff, R. Le Guellec, S. Inge-Vechtomov et al., 1995 Termination of translation in eukar-yotes is governed by two interacting polypeptide chain releasefactors, eRF1 and eRF3. EMBO J. 14: 4065–4072.

Communicating editor: A. Nicolas


Fine-Tuning of Translation Termination Efﬁciency in … · 2007. 11. 29. · In eukaryotes,...

Documents

Transcript of Fine-Tuning of Translation Termination Efﬁciency in … · 2007. 11. 29. · In eukaryotes,...