ANNE CATHRYN COX

December 11, 2016

HEPATOCYTE NUCLEAR FACTOR

4 ALPHA (HNF4A) EXPRESSION

INCREASES IN BURMESE PYTHON

LIVER 1 DAY AFTER FEEDING THE PYTHON PROJECT, FALL 2016

1

1. ABSTRACT Over 1 in 5 adults in the US has metabolic

syndrome (MetS), which is a collection of

symptoms including some or all of the

following: obesity, high fasting plasma

glucose, high blood pressure, high

triglyceride levels, and low HDL cholesterol

levels (Beltrán-Sánchez, Harhay, Harhay, &

McElligott, 2013). Although this syndrome is

well studied, there is still much to learn about

how humans process fat in the liver. The

Burmese python has several key

physiological processes that make it such a

pertinent animal for research on human

disease involving the metabolism of

cholesterol and other fats, including MetS,

pathological cardiac hypertrophy, and

hepatic steatosis (fatty liver disease). One of

these processes is the rapid metabolism of

serum fatty acids post-meal. To explore this

process, hepatocyte nuclear factor 4 alpha

(HNF4A) expression in python liver tissue

was tested using real-time PCR. HNF4A has

two separate functions important to bile acid

homeostasis in hepatocytes in humans: (1) to

upregulate the transcription of transport

proteins (largely NCTP) moving recycled

bile acid into hepatic cells while downregulating transport proteins which

move bile acids from hepatic cells into the

canaliculus, and (2) to increase binding of

HNF1A to its promoter thereby increasing

the transcription of CYP7A1 and the

downstream synthesis of bile acids. This

research found that expression of HNF4A

mRNA doubles from the fasted tissue at 1

day-post-fed (DPF), and then returns to

normal by 3 DPF, suggesting that the python

uses similar pathways of bile-acid

sequestration in hepatocytes as humans.

2. INTRODUCTION Over 1 in 5 adults in the US has metabolic

syndrome (MetS), which is a collection of

symptoms including some or all of the

following: obesity, high fasting plasma

glucose, high blood pressure, high

triglyceride levels, and low HDL cholesterol

levels (Beltrán-Sánchez, Harhay, Harhay, &

McElligott, 2013). Although this syndrome is

well studied, there is still much to learn about

how humans process fat in the liver. Model

organisms are important in research to help

improve our understanding of biological

systems similar to humans in order to better

address complex problems in medicine.

Some of the more common model organisms

in scientific research (especially pertaining to

human disease) are mice or rats. Although

mice and lab rats have beneficial aspects for

being a model organism in a laboratory (e.g.

mammalian, rapid lifecycle, etc), there are

sometimes advantages to using other model

organisms, like the Burmese python (Python

bivittatus). The Burmese python has several

key physiological processes that make it such

a pertinent animal for research on human

disease involving the metabolism of

cholesterol and other fats, including MetS,

pathological cardiac hypertrophy, and

hepatic steatosis (fatty liver disease). The

python’s digestive organs, including the

heart, all grow in mass rapidly after

consuming a meal (Secor, 2008). This organ

growth is physiological and not pathological,

and is attributed to a few select fatty acids

present in the python’s serum that are not

originally from the meal (Riquelme et al.,

2011; Secor, 2008). Key insights from

research on the Burmese python are already

yielding new human implications for treating

cardiac regression in cancer patients and

cardiac hypertrophy (Riquelme et al., 2011).

However, it is not well understood where

these key fatty acids come from in the python

serum, and how the python processes the

large amount of fat in its postprandial system

and serum. In order to address this,

researchers from the Python Project under the

lab of Dr. Leslie Leinwand are looking into

specific genes that are known in humans to

2

play a role in either the synthesis or transport

of bile acids, which emulsify fats in the

digestive system and allow them to be

processed. By unlocking the key to how

pythons process such large amounts of fat

and remain healthy, human conditions such

as metabolic syndrome can be looked at from

another, perhaps more enlightening angle

than previous research.

Hepatocyte nuclear factor 4 alpha (HNF4A)

is one of several transcription factors that

heavily regulate genes involving the transport

of bile acids around the digestive system,

largely from the liver where they are

synthesized through the bile duct to the

intestines to digest fats, and then back to the

liver from the intestines. By focusing on a

transcription factor for many transport

proteins instead of one specific transport

protein, expression levels can potentially be

implied for many genes and not just one. In

knockout studies with mice, adult male mice

had decreased levels of mRNA for NCTP

(Sodium Taurocholrate Cotransporting

Polypeptide) among others when HNF4A

was rendered nonfunctional in the liver (Lu,

Gonzalez, & Klaassen, 2010). NCTP,

expressed less in the absence of HNF4A, is a

transport pump and is the primary way in

which bile acids recycle from the ileum and

colon back into the hepatocyte for reuse.

HNF4A has been shown to increase NCTP in

other studies as well (Dietrich et al., 2007;

Hayhurst, Lee, Lambert, Ward, & Gonzalez,

2001). In another knockout study, the serum

chemistry of wild-type vs HNF4A-null mice

was analyzed (Hayhurst et al., 2001). This

study found that in addition to having

decreased NCTP levels by western blot,

HNF4A null mice had increased levels of

ALT, triglycerides, total cholesterol, HDL

cholesterol, and bile acids in their serum

(Hayhurst et al., 2001). This leads to the

conclusion that HNF4A must be important to

getting bile acids out of an organism’s serum

and into its hepatocytes for use in the liver.

Another important function of HNF4A is to

help hepatocyte nuclear factor 1 alpha

(HNF1A), another important hepatic

transcription factor, to bind its promoters on

several other hepatic genes in liver cell nuclei

(Eeckhoute, Formstecher, & Laine, 2004).

When it does this, the genes which are

activated by HNF1A, such as Cholesterol 7-

Alpha-Hydroxylase (CYP7A1) are also

upregulated. CYP7A1 plays a vital role and

is the rate determining step in the conversion

of cholesterol into bile acids. Because of

HNF4A’s varying functions in bile acid

synthesis and export, it may hold key insights

into fat digestion in the Burmese python.

The main function of HNF4A is to participate

as a transcription factor for select hepatic

genes. HNF4a directly upregulates some

hepatic genes, and (likely indirectly)

downregulates other genes. In a knockout

study with mice, the following genes were

found to be upregulated by HNF4A: NTCP,

OATP1A1, OATP2B1, OAT2, OATP1B2,

OCT1, NPT1, SLC26A1, SVCT1, UGT2A3,

UGT2B1, UGT3A1, UGT3A2, UGT1A5,

UGT1A9, SULT1A1, SULT1B1, SULT5A1,

MRP6, MATE1, GSTM4, GSTM6, and

BCRP (Lu et al., 2010). In the same study, the

knockout mice were found to have higher

levels of mRNA for the following genes,

indicating that they are downregulated by

HNF4A: OATP1A4, OCTN2, UGT1A1,

SULT1E1, SULT2A2, GSTA4, GSTM1-

M3, MDR1A, MRP3, and MRP4 (Lu et al.,

2010). Several trends emerge from these

groups of upregulated and downregulated

proteins that are worth exploring. First,

NTCP, SLCs and OATP1s are all

upregulated by HNF4A, and all of these

proteins serve as bile acid uptake (influx)

proteins for hepatocytes (i.e. they take

recycled bile acids back into the liver cells)

(Halilbasic, Claudel, & Trauner, 2013).

Additionally, MDRs such as MRP2, MDR1,

and BCRP are all downregulated by HNF4A,

and these proteins serve as canalicular

3

exporters (i.e. they move bile acids from the

liver cell to the canaliculis for export)

(Halilbasic et al., 2013). MRP3 and MRP4

were also downregulated by HNF4A, and

these proteins are basolateral transporters

(i.e. take bile acids out of ileocytes and

colonocytes , where they are then brought

back to the hepatocytes through the

enterohepatic cycle (Thomas, Pellicciari,

Pruzanski, Auwerx, & Schoonjans, 2008).

These data in conjunction show that an

increase in expression of HNF4A would

cause a sequestration of available bile acids

in the enterohepatic cycle into the

hepatocytes, and additionally, a shutting off

of secondary pathways of bile acid export

from the digestive system. This sequestration

could be useful in the case of a python having

a large meal, because it would initially

require a large amount of conjugated bile

acids in the hepatocytes to be able to flow all

at once in a concentrated fasion into the

canaliculus and help to digest the meal.

An additional function of HNF4A is to assist

in the binding of HNF1A to its promoters,

causing an upregulation in genes controlled

by HNF1A as a transcription factor

(Eeckhoute et al., 2004). HNF1A is known to

bind near CYP7A1 and trans activate the

CYP7A1 gene in humans, but not in rats

(Chen, Cooper, & Levy-Wilson, 1999).

Additionally, HNF1A’s stimulatory effect on

the expression of CYP7A1 has been observed

to be curbed by the expression of PPARα and

LXRα, both of which are known to inhibit

CYP7A1 (Gbaguidi & Agellon, 2004;

Halilbasic et al., 2013). It is possible that

HNF1A also stimulates the production of

CYP7A1 in pythons. If this is the case, an

upregulation in HNF4A leading to an

increase in HNF1A could potentially increase

bile acid synthesis from cholesterol inside

hepatocytes. This function makes sense with

the upregulation of NCTP by HNF4A that

brings back bile acids from the enterohepatic

cycle into the liver cells, because helping in

bile acid synthesis through HNF1A would

also increase the amount of bile acids in the

liver cells waiting to be transported across the

membrane to the canaliculus. Both of

HNF4A’s functions serve to sequester bile

acids in hepatocytes, perhaps in preparation

for the digestion of a large meal or in

preparation of removing a large amount of fat

from the serum of the python. Additionally,

the sequestration of bile acids in hepatocytes

may be the reason that a python’s organs

grow in mass after feeding, but before lipids

are present in the serum (Riquelme et al.,

2011; Secor, 2008).

By illuminating the function and expression

of HNF4A in the liver, answers about how

the Burmese python digests meals and

increases the mass of its digestive organs in a

physiological and not a pathological way

may also be illuminated. By continuing to

piece together how the lipid homeostatic

system functions in python, it is expected that

continued developments in human lipid

homeostasis will also be made. The

possibility of using python mechanisms for

curbing pathological heart growth, cardiac

regression, fatty liver disease, and even

metabolic syndrome is real and has been

demonstrated to work in the heart (Riquelme

et al., 2011). Moving forward, genes like

HNF4A will be analyzed in order to try and

replicate this success in the liver. HNF4A has

two separate functions important to bile acid

homeostasis in hepatocytes in humans: (1) to

upregulate the transcription of transport

proteins moving recycled bile acid into

hepatic cells while downregulating transport

proteins which move bile acids from hepatic

cells into the canaliculus, and (2) to increase

binding of HNF1A to its promoter thereby

increasing the transcription of CYP7A1 and

the downstream synthesis of bile acids. Both

of these functions act to sequester bile acids

in hepatocytes. Since HNF4A is highly

conserved among organisms, it is expected

that expression in the post-prandial python of

4

HNF4A will increase dramatically

immediately after the python is fed and

continue to be upregulated at 1 day post fed

(DPF), in order to sequester bile acids in

hepatocytes and prepare for the digestion of

the meal. This hypothesis will be tested with

real-time PCR using primers validated both

in-silico and in-vitro with BLAST and

conventional PCR.

3. METHODS The gene of interest, HNF4A, was chosen

based on research from prior semesters in the

python project, indicating that it would be an

interesting gene to study, providing new

insights into previous research. Additionally,

it was chosen due to the known functions of

HNF4A in humans and mice in bile acid

transport and synthesis in the liver.

First, primers for HNF4A to be used in qPCR

were designed by finding the corresponding

gene sequence in the gallus gallus genome.

This sequence was BLASTed against the

python molorus bivitattus whole genome

shotgun (WGS) database from NCBI. This

was done because the python genome is not

annotated, and existing transcriptomes are

unreliable when translated in silico. After

alignments in contigs from the python WGS were identified, the contigs were mapped

back to the gallus gallus transcript to find the

correct order. The newly assembled putative

python transcript was then validated by

translation to ensure there was an open

reading frame with no stop codons, and then

BLASTed by protein to ensure the correct

protein was returned by the database.

Once the python sequence was validated in

silico, primers were chosen using Primer3

and specifying a length of 18-25 base pairs,

melt temperature of 60 °C, GC clamp

avoidance, and GC content of 40-60%.

Additionally, the primers with the lowest

self-complementarity were chosen to

increase PCR efficiency.

The primers obtained from Primer3 were

then validated in silico by primer BLAST

against all mRNA in the NCBI database to

ensure that only the intended product would

be amplified. Only HNF4A was returned by

this BLAST, in different species, indicating

that the gene is highly conserved.

The primers used produce a product with a

length of 122 base pairs, and are shown in the

following table. They were ordered from

Invitrogen.

Forward

primer 5’ GAGATGCTGCTTGGAGGTTC 3’

Reverse

primer 5’ TCTGAGGAGGCATTGTGTTG 3’

After primers were designed, RNA from

several timepoints after eating was isolated.

Pythons were cared for under 12 hour light

cycle conditions, and an animal euthanization

protocol was approved by the University of

Colorado, Boulder IACUC. The pythons

were fed rats equaling 25% of the python

body weight every 14 days. Two pythons

from each timepoint after feeding were used

(Fasted, 1 day post fed (DPF), 3 DPF, and 10

DPF). 30 mg of liver tissue from each of the

two snakes for each time point were

homogenized (60 mg total per time point

sample). The sex of the 1 DPF and 10 DPF

pythons were male, and the fasted and 3 DPF

pythons were unknown.

The RNA was isolated from the tissue

samples using TRI Reagent (Sigma Aldrich,

St. Louis, MO), according to manufacturer

instructions. Briefly, pooled tissue samples

were homogenized for 20-30 seconds in 1mL

TRI Reagent. Following incubation at room

temperature, RNA, DNA, and protein were

separated using 200μL of chloroform.

Samples were centrifuged and clear

supernatant containing RNA was removed.

5

RNA was precipitated and purified using

decreasing concentrations of ethanol. Pellets

were suspended in 50μL of RNase-free

water.

The resulting RNA concentration was

measured using a spectrophotometer, so that

mass of RNA used in subsequent steps could

be normalized to the concentration of a

particular sample.

After RNA was isolated, cDNA was

synthesized according to manufacturer

instructions of the SuperScript III

(Invitrogen). The only exceptions made to

this protocol were that 2000 ng of RNA were

used in a 20 μL total reaction volume,

yielding a 100 ng/μL cDNA solution.

Additionally, the HNF4A specific primers

enumerated earlier in this section were used

to synthesize gene-specific cDNA, so that the

ribosomal RNA would not be made into

cDNA, and all cDNA obtained would be

gene specific. It was assumed that 100% of

the HNF4A mRNA from the RNA samples

was converted to cDNA for the purposes of

this experiment. The lyophilized primers

were resuspended to a concentration of 100

μM, then diluted to a working concentration

of 12.5 μM.

After cDNA was synthesized, qPCR was

performed using the cDNA. In order to

produce a standard curve for interpolating

starting concentrations of the unknown

timepoints, serial dilutions of cDNA were

made. First, 5 μL of each of the Fasted, 1

DPF, 3 DPF, and 10 DPF timepoints were

combined into a pooled sample to minimize

sample-to sample errors (all time points had

the same concentration of cDNA). Then, this

pooled sample (100 ng/μL) was diluted 1:10

four times, producing the following dilution

concentrations for the standard curve: 10

ng/μL, 1 ng/μL, 0.1 ng/μL, 0.01 ng/μL, and

then pure deionized reverse-osmosis water

was used as the no template control (NTC).

For the unknown cDNA, the stock cDNA

synthesized to be 100 ng/μL for each time

point was diluted to a working concentration

of 1 ng/μL. To set up the qPCR 96-well plate,

4 μL of each of the dilutions were loaded into

wells in triplicate. Similarly, 4 μL of each

unknown (Fasted, 1 DPF, 3 DPF, and 10

DPF) were loaded in triplicate. Then, 16 μL

of SYBR Select master mix (used according

to manufacturer (ThermoFisher Scientific)

instructions) including the HNF4A specific

primers was added to all of the wells, both

standards (including the NTC) and

unknowns.

The plates were then run through qPCR in the

BioRad CFX 96 Real-Time Thermocyler,

and the gene expression data was obtained

and analyzed through the native software to

the instrument (CFX Manager). For data

analysis, the starting concentration of the

triplicates for each time point were averaged

and then normalized to the fasted sample to

obtain the fold change in mRNA expression

at the four time points.

In order to validate that the product obtained

in the qPCR reactions was the intended

amplification product of 122 base pairs from

the in-silico validation of the HNF4A

specific primers, the products of the qPCR

reaction from the most amplified wells (1

DPF) and the NTC wells were then loaded

and run on a 1% agarose gel with ethidium

bromide. 6 μL of 6X DNA loading dye was

loaded into the qPCR well to be loaded on the

gel, and then 15 μL from the mixed well was

loaded into the well of the gel. The products

were loaded with a 1kb DNA ladder in which

the lowest 2 bands show 100 and 200 base

pair product size.

4. RESULTS

By performing the protocol enumerated in

the previous section, the following data were

obtained. The real time PCR plate was set up

6

3 different times using the same samples. The

first time the plate was run, a doubling of

expression at 1 day post fed was observed

with very little technical error. The second

and third time that the plates were run, the

fasted and 3 day samples were much lower

with respect to the 1 DPF and 10 DPF

samples, possibly indicating degradation of

the samples or another error in keeping the

samples. Despite this incongruence, the

technical error in both the second and the

third plates was small, and the general trend

of HNF4A being upregulated at 1 DPF and

slightly at 10 DPF was conserved throughout

all trials.

FIGURE 1 AVERAGE FOLD CHANGE IN HNF4A MRNA

FROM 3 QPCR PLATES

FIGURE 2 FOLD CHANGE IN HNF4A MRNA PLATE 1

FIGURE 3 FOLD CHANGE IN HNF4A MRNA PLATE 2

FIGURE 4 FOLD CHANGE IN HNF4A MRNA PLATE 3

Additionally, the products from the second

plate qPCR reaction were run on a gel in

order to validate that only the intended

products were amplified, and this was the

case. Below, the gel shows two product bands

from the 3 DPF well of approximately the

correct product size, as well as no band for

the NTC well.

7

Only one product was observed above the

threshold on the melt peaks for all three

plates, and the standard curves were used to

interpolate starting quantities of unknown

samples.

FIGURE 5 QPCR MELT PEAK PLATE 1

FIGURE 6 QPCR STANDARD CURVE PLATE 1

The standard curve for the first plate that was

run had the highest R2 value of the 3 plates

run. Additionally, it exhibited the least

“messy” melt peak.

FIGURE 7 QPCR MELT PEAK PLATE 2

FIGURE 8 QPCR STANDARD CURVE PLATE 2

FIGURE 9 QPCR MELT PEAK PLATE 3

FIGURE 10 QPCR STANDARD CURVE PLATE 3

5. DISCUSSION Based on the data obtained by qPCR, the

Burmese python liver upregulates HNF4A 1

day after feeding. This supports the initial

hypothesis stated in the introduction that

8

HNFA acts as an on/off switch for several

transport genes, which act in conjunction to

produce a build-up of bile acids in liver cells.

Because NCTP transports bile acid from

hepatic portal blood into liver cells, it follows

that NCTP would need to be upregulates

prior to digesting a meal. The python’s meal

stays in its digestive track relatively intact

until at least 3 DPF (Secor, 2008), so the

upregulation of NCTP by an increase in

expression of HNF4A would be in time for

aiding in emulsifying fats from the meal, but

it would also be in time to aid in the removal

of serum fatty acids from the post prandial

Burmese python (Riquelme et al., 2011).

DISCUSSION OF ERROR Additionally, although cDNA is very stable,

it appears from the data that the samples

could have potentially degraded slightly over

time from when the first plate was loaded to

when the third qPCR plate was loaded. The

evidence of this is the standard curve

triplicates becoming more and more

separated despite similar technical error, the

melt peaks becoming messier, the expression

levels being inconsistent among trials despite

the same trends, and the cycle in which the

qPCR products amplified. For the first plate,

the highest concentration of product

amplified and crossed the threshold midway

through the amplification phase around 25

cycles and for the last plate, this was pushed

back to around 31 cycles. All of these

observations indicate that over time, the

integrity of the samples loaded into the qPCR

plates may have decreased due to cDNA

degradation or some other unknown factor.

This migration of amplification to later

cycles of amplification in the qPCR reaction

despite using the same samples and the same

prepared cDNA serial dilutions to produce

the standard curve is shown in the

amplification curves below.

FIGURE 11 PLATE 1 AMPLIFICATION CURVES OF

HNF4A IN QPCR REACTION

FIGURE 12 PLATE 2 AMPLIFICATION CURVE OF HNF4A

IN QPCR REACTION

FIGURE 13 PLATE 3 AMPLIFICATION CURVE OF HNF4A

IN QPCR REACTION

One of the only reasonable explanations for

this migration of amplification cycle over

time is there being less and less target present

for the primers to anneal to over time. Also,

the samples which already contained less

target (Fasted and 1 DPF) degraded faster

9

than the high concentration samples (3 DPF

and 10 DPF).

Further experiments are necessary to confirm

the actual fold change of mRNA of HNF4A,

however, since all trials revealed the same

trend, conclusions based on the trend in

expression are still valid.

POSSIBLE FUTURE EXPERIMENTS In subsequent experiments, the expression of

NCTP should be measured using the same

methodology used in this study. This would

provide insights into how important NCTP is

to bile acid homeostasis, especially the

recycling of used bile acids from hepatic

portal blood into hepatocytes for re-use in

digestion of fats. This study could also be

repeated with higher concentrations of cDNA

in the qPCR reactions in order to eliminate

some error based on possible degradation of

samples as discussed previously in the

Discussion section of this paper.

Additionally, other bile acid transporters

such as ASBT, OSTa/OSTb, and BSEP could

be explored. It is known that these genes play

a role in transporting bile acids into and out

of liver cells, ileocytes, and cholangiocytes.

Knowing the changes in expression for these

genes would then allow a more complete

picture of bile acid transport in the

postprandial Burmese python, allowing for

more insights into potential treatment targets

for humans with MetS.

Finally, HNF1A (hepatocyte nuclear factor 1

alpha) could be measured, to solidify the

relationship between HNF4A and HNF1A,

and to tie the bile acid synthesis story to the

bile acid transport story in the Burmese

Python, due to HNF4A helping to bind

HNF1A to its promoter sites in the nucleus,

and HNF1A regulating CYP7A1, which is

the rate determining protein in the conversion

of cholesterol to bile acid in human and

mouse models.

6. CONCLUSION In summary, the following conclusions were

drawn from the work presented in this paper

stemming from qPCR analysis of HNF4A

mRNA expression levels in post prandial

Burmese Python liver tissue:

HNF4A plays an important role in the

digestive physiology of the Burmese

python, and that role is similar to the

role that has been demonstrated in

humans.

HNF4A is upregulated at 1 dpf, when the highest concentration of lipids is

present in the burmese python serum,

and before the majority of its meal has

been digested. It is likely that NCTP

is also upregulated at this time.

It is possible that in the python,

HNF4A sequesters bile acids in the

hepatocytes in preparation of

releasing them to digest the meal.

This sequestration could explain the

liver hypertrophy seen early after the

snake has fed but before it has

digested its meal.

APPLICATIONS The implications of the findings of this

research present many avenues for the

research of the treatment of symptoms

involved in MetS. Particularly in the case of

heart disease induced by high blood pressure

due to high concentrations of serum fats, this

research could prove useful. Since NCTP is

further correlated with the uptake of bile

acids, it could potentially be the target of a

new pharmaceutical which aims to turn on

the human body’s existing mechanisms for

removing fatty acids from serum.

BIBLIOGRAPHY

Battle, Michele A., Genevieve Konopka,

Fereshteh Parviz, Alexandra Lerch

Gaggl, Chuhu Yang, Frances M. Sladek,

and Stephen A. Duncan. “Hepatocyte

Nuclear Factor 4α Orchestrates

Expression of Cell Adhesion Proteins

during the Epithelial Transformation of

the Developing Liver.” Proceedings of

the National Academy of Sciences 103,

no. 22 (May 30, 2006): 8419–24.

doi:10.1073/pnas.0600246103.

Beltrán-Sánchez, Hiram, Michael O. Harhay,

Meera M. Harhay, and Sean McElligott.

“Prevalence and Trends of Metabolic

Syndrome in the Adult U.S. Population,

1999–2010.” Journal of the American

College of Cardiology 62, no. 8 (August

20, 2013): 697–703.

doi:10.1016/j.jacc.2013.05.064.

Bonzo, Jessica A., Christina H. Ferry,

Tsutomu Matsubara, Jung-Hwan Kim,

and Frank J. Gonzalez. “Suppression of

Hepatocyte Proliferation by Hepatocyte

Nuclear Factor 4α in Adult Mice.” The

Journal of Biological Chemistry 287,

no. 10 (March 2, 2012): 7345–56.

doi:10.1074/jbc.M111.334599.

Chen, Jean, Allen D. Cooper, and Beatriz

Levy-Wilson. “Hepatocyte Nuclear

Factor 1 Binds to and Transactivates the

Human but Not the Rat CYP7A1

Promoter.” Biochemical and

Biophysical Research Communications

260, no. 3 (July 1999): 829–34.

doi:10.1006/bbrc.1999.0980.

Dawson, Paul A., Tian Lan, and Anuradha

Rao. “Bile Acid Transporters.” Journal

of Lipid Research 50, no. 12 (December

2009): 2340–57.

doi:10.1194/jlr.R900012-JLR200.

Dietrich, Christoph G., Ina V. Martin, Anne

C. Porn, Sebastian Voigt, Carsten

Gartung, Christian Trautwein, and

Andreas Geier. “Fasting Induces

Basolateral Uptake Transporters of the

SLC Family in the Liver via HNF4alpha

and PGC1alpha.” American Journal of

Physiology. Gastrointestinal and Liver

Physiology 293, no. 3 (September

2007): G585-590.

doi:10.1152/ajpgi.00175.2007.

Eeckhoute, J., P. Formstecher, and B. Laine.

“Hepatocyte Nuclear Factor 4α

Enhances the Hepatocyte Nuclear

Factor 1α-Mediated Activation of

Transcription.” Nucleic Acids Research

32, no. 8 (2004): 2586–93.

doi:10.1093/nar/gkh581.

Ekholm, E., R. Nilsson, L. Groop, and C.

Pramfalk. “Alterations in Bile Acid

Synthesis in Carriers of Hepatocyte

Nuclear Factor 1α Mutations.” Journal

of Internal Medicine 274, no. 3

(September 1, 2013): 263–72.

doi:10.1111/joim.12082.

Gbaguidi, G. Franck, and Luis B. Agellon.

“The Inhibition of the Human

Cholesterol 7alpha-Hydroxylase Gene

(CYP7A1) Promoter by Fibrates in

Cultured Cells Is Mediated via the Liver

X Receptor Alpha and Peroxisome

Proliferator-Activated Receptor Alpha

Heterodimer.” Nucleic Acids Research

32, no. 3 (2004): 1113–21.

doi:10.1093/nar/gkh260.

Halilbasic, Emina, Thierry Claudel, and

Michael Trauner. “Bile Acid

Transporters and Regulatory Nuclear

Receptors in the Liver and beyond.”

Journal of Hepatology 58, no. 1

(January 2013): 155–68.

doi:10.1016/j.jhep.2012.08.002.

Hayhurst, Graham P., Ying-Hue Lee, Gilles

Lambert, Jerrold M. Ward, and Frank J.

Gonzalez. “Hepatocyte Nuclear Factor

4α (Nuclear Receptor 2A1) Is Essential

for Maintenance of Hepatic Gene

Expression and Lipid Homeostasis.”

1

Molecular and Cellular Biology 21, no.

4 (February 2001): 1393–1403.

doi:10.1128/MCB.21.4.1393-

1403.2001.

“Hepatocyte Nuclear Factor 4 Alpha.”

Wikipedia, the Free Encyclopedia, May

20, 2016.

https://en.wikipedia.org/w/index.php?tit

le=Hepatocyte_nuclear_factor_4_alpha

&oldid=721177930.

Kazgan, Nevzat, Mallikarjuna R. Metukuri,

Aparna Purushotham, Jing Lu,

Anuradha Rao, Sangkyu Lee, Matthew

Pratt-Hyatt, et al. “Intestine-Specific

Deletion of Sirt1 in Mice Impairs

DCoH2–HNF1α–FXR Signaling and

Alters Systemic Bile Acid

Homeostasis.” Gastroenterology 146,

no. 4 (April 2014): 1006–16.

doi:10.1053/j.gastro.2013.12.029.

Lu, Hong, Frank J. Gonzalez, and Curtis

Klaassen. “Alterations in Hepatic

mRNA Expression of Phase II Enzymes

and Xenobiotic Transporters after

Targeted Disruption of Hepatocyte

Nuclear Factor 4 Alpha.” Toxicological

Sciences: An Official Journal of the

Society of Toxicology 118, no. 2

(December 2010): 380–90.

doi:10.1093/toxsci/kfq280.

Pauli-Magnus, Christiane, Bruno Stieger,

Yvonne Meier, Gerd A. Kullak-Ublick,

and Peter J. Meier. “Enterohepatic

Transport of Bile Salts and Genetics of

Cholestasis.” Journal of Hepatology 43,

no. 2 (August 2005): 342–57.

doi:10.1016/j.jhep.2005.03.017.

Purushotham, Aparna, Qing Xu, Jing Lu,

Julie F. Foley, Xingjian Yan, Dong-

Hyun Kim, Jongsook Kim Kemper, and

Xiaoling Li. “Hepatic Deletion of

SIRT1 Decreases HNF1α/FXR

Signaling and Induces Formation of

Cholesterol Gallstones in Mice.”

Molecular and Cellular Biology,

January 30, 2012, MCB.05988-11.

doi:10.1128/MCB.05988-11.

Riquelme, Cecilia A., Jason A. Magida,

Brooke C. Harrison, Christopher E.

Wall, Thomas G. Marr, Stephen M.

Secor, and Leslie A. Leinwand. “Fatty

Acids Identified in the Burmese Python

Promote Beneficial Cardiac Growth.”

Science (New York, N.Y.) 334, no. 6055

(October 28, 2011): 528–31.

doi:10.1126/science.1210558.

Secor, Stephen M. “Digestive Physiology of

the Burmese Python: Broad Regulation

of Integrated Performance.” Journal of

Experimental Biology 211, no. 24

(December 15, 2008): 3767–74.

doi:10.1242/jeb.023754.

Servitja, Joan-Marc, Miguel Pignatelli,

Miguel Angel Maestro, Carina

Cardalda, Sylvia F. Boj, Juanjo Lozano,

Enrique Blanco, et al. “Hnf1alpha

(MODY3) Controls Tissue-Specific

Transcriptional Programs and Exerts

Opposed Effects on Cell Growth in

Pancreatic Islets and Liver.” Molecular

and Cellular Biology 29, no. 11 (June

2009): 2945–59.

doi:10.1128/MCB.01389-08.

Thomas, Charles, Roberto Pellicciari, Mark

Pruzanski, Johan Auwerx, and Kristina

Schoonjans. “Targeting Bile-Acid

Signalling for Metabolic Diseases.”

Nature Reviews Drug Discovery 7, no. 8

(August 2008): 678–93.

doi:10.1038/nrd2619.

Yahoo, Neda, Behshad Pournasr, Jalal

Rostamzadeh, and Fardin Fathi. “Forced

Expression of Hnf4a Induces Hepatic

Gene Activation through Directed

Differentiation.” Biochemical and

Biophysical Research Communications

476, no. 4 (August 5, 2016): 313–18.

doi:10.1016/j.bbrc.2016.05.119.