ExpressionofTerminallyGlycosylatedCalcitoninReceptor^Like ... · individual tumor types/stages by...

Expression ofTerminally Glycosylated Calcitonin Receptor^LikeReceptor in Uterine Leiomyoma: Endothelial Phenotype andAssociationwith Microvascular DensityLeonid L. Nikitenko,1,2,5 Tanya Cross,1Leticia Campo,3 HelenTurley,3 Russell Leek,3 SanjivManek,4

Roy Bicknell,2 andMargaret C.P. Rees1

Abstract Purpose: The role for the hypoxia-inducible angiogenic factor adrenomedullin (AM) in tumorgrowth and progression has been suggested. Calcitonin receptor ^ like receptor (CL) is a Gprotein ^ coupled receptor (GPCR) that mediates effects of AM, but little information is availableon its expression and functional state inhuman tumors.The present study attempted to determineCL potential for antiangiogenic therapy of uterine leiomyoma.Experimental Design and Results:GPCRCL is transported to the cell surface and recognizedbyAMonly when terminally/mature glycosylated.The presence and localizationof this formof thereceptor in tumor and surrounding myometrial tissues obtained from leiomyoma-bearing uteriwere examined using deglycosylation, immunoblotting, and immunofluorescence analysis. Themature CL glycoprotein was expressed in both tissues and localized exclusively in normal andtumor endothelium within leiomyoma-bearing uteri. The functionality of the receptor expressedin myometrial microvascular endothelial cells (MMVEC) was examined in vitro using receptorinternalization and angiogenic assays. The mature CL glycoprotein expressed by primaryMMVECs was functional because AM interacted with this GPCR and induced its internalizationas well as angiogenic effects (proliferation and migration) in MMVECs in vitro. Finally, the levelsof tissue-expressed mature CL glycoprotein as a functional form of this GPCR were analyzed byimmunoblotting. The expression of this functional form of the receptor in vivo was significantlydecreased (P = 0.01) in leiomyoma tissue, and this was concurrent with the decrease in micro-vascular density (measured by Chalkley counting) in tumor compared with surrounding myome-trium (P = 0.031).Conclusions:Our findings suggest that GPCRCLmediates angiogenic effects of AMinmyome-trium and that further evaluation of the properties of the CL expressed in both normal and tumorendothelium in vivo may be essential before targeting this endothelial GPCR for antiangiogenictherapies.

Angiogenesis, or new blood vessel growth, is an essentialprocess during tumor growth and development (1, 2). Despitesome initial setback and negative clinical trial results, majorprogress has been made over the past few years in targetingtumor angiogenesis. Several clinical studies using inhibitors ofkey angiogenic factors, such as vascular endothelial growthfactor (VEGF)-A, not only validated the notion that angiogen-esis is an important target for cancer but also revealed thephenomenon of the resistance of some tumors to antiangio-genic therapy (3, 4). There is now evidence that the effects ofkey angiogenic factors may be replaced by other pathways asthe disease progresses or that other known as well as novelangiogenic molecules might be responsible for breakthroughangiogenesis in hypoxic tumor microenvironments duringantiangiogenic strategies (5). In addition, potent tissue-specificangiogenic factors may be responsible for such resistance toantiangiogenic therapy (6). Therefore, the current challenge intranslating angiogenesis research into the clinic is to identifydifferences in molecular mechanisms of angiogenesis between

Human Cancer Biology

Authors’ Affiliations: 1Nuffield Department of Obstetrics and Gynaecology,2Molecular Angiogenesis Laboratory, Cancer Research UK,Weatherall Institute ofMolecular Medicine, 3Nuffield Department of Clinical Laboratory Sciences, and4Department of Cellular Pathology, The University of Oxford, John RadcliffeHospital, Oxford, United Kingdom; and 5Cancer Research UK Viral OncologyGroup,Wolfson Institute for Biomedical Research, University College London,London, United KingdomReceived 4/6/06; revised 6/5/06; accepted 6/23/06.Grant support: TheWellcomeTrust (L.L. Nikitenko and M.C.P. Rees), MedicalResearch Fund, University of Oxford, United Kingdom (L.L. Nikitenko), CancerResearch UK (L. Campo, H.Turley, R. Leek, and R. Bicknell), and Royal Society UKTravel Award (L.L. Nikitenko).The costs of publication of this article were defrayed in part by the payment of pagecharges.This article must therefore be hereby marked advertisement in accordancewith18 U.S.C. Section1734 solely to indicate this fact.Note: Supplementary data for this article are available at Clinical Cancer ResearchOnline (http://clincancerres.aacrjournals.org/).T. Cross is a Final Honour School student from St. Anne’s College, Oxford.Requests for reprints: Leonid L. Nikitenko,Wolfson Institute for BiomedicalResearch, University College London, London WC1E 6BT, United Kingdom.Phone: 44-02076796749; Fax: 44-02076796851; E-mail: [email protected].

F2006 American Association for Cancer Research.doi:10.1158/1078-0432.CCR-06-0852

www.aacrjournals.orgClin Cancer Res 2006;12(19) October1, 2006 5648

Research. on April 6, 2021. © 2006 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

http://clincancerres.aacrjournals.org/

individual tumor types/stages by defining the role for theknown and novel key as well as tissue-specific angiogenicfactors. This would enable the selection of a specific antiangio-genic therapy from a range of those that are currently used inclinical trials or under development as well as to determine thelikelihood of its effectiveness for an individual patient (5).Uterine leiomyomas, also known as fibroids, are common

benign solid tumors arising from the myometrium. They affectone third of adult women and are a significant cause ofmenorrhagia, pelvic pain, infertility, and pregnancy loss (7).Currently, the most effective treatments for fibroids are surgicaland they are the commonest indication for hysterectomy. It iscurrently believed that the local aberrant angiogenesis isessential for development and growth of leiomyomas (7). Theexpression of various angiogenic factors, including VEGF, basicfibroblast growth factor, platelet-derived growth factor, andadrenomedullin (AM), has been recently documented inleiomyomas, and their role in tumor growth has been suggested(8, 9). However, AM is the only angiogenic factor to directlycorrelate with the increase in both vascular density andendothelial cell proliferation index in fibroids and thereforemight play a key angiogenic role in the pathogenesis of thistumor (9).AM was originally identified as a hypotensive peptide and

then shown to be an endothelial antiapoptotic, growth, andangiogenic factor (10, 11). It belongs to the calcitonin family ofpeptide hormones, which comprises six known members[calcitonin, amylin, two calcitonin gene–related peptides(CGRP-a and CGRP-h), AM, and intermedin; ref. 12]. AMexpression and secretion is regulated by inflammatory cyto-kines (e.g., interleukin-1 and tumor necrosis factor a and hmodulated by estrogen and progesterone in the uterus) andhypoxia (11). Hypoxia is a frequent feature of the microenvi-ronment in solid tumors and constitutes one of the drivingforces of cancer growth and progression (13), and a role for AMas a promoter of these processes via induction of angiogenesishas been suggested for various tumors, including leiomyomas(9, 14–16). However, previous studies focused on analyzingAM expression in normal versus leiomyoma-bearing uteri, andno comparisons have been made between fibroid andmyometrial tissues within leiomyoma-bearing uteri themselves.In addition, no studies have been done to evaluate theexpression of AM receptors in vivo within leiomyoma or anyother tumors, where AM expression is up-regulated (reviewedin ref. 17).Effects of AM are mediated via heterodimeric receptors

composed of calcitonin receptor–like receptor (CRLR, nowknown as CL) and one of the three receptor activity modifyingproteins (RAMP; ref. 18). CL belongs to the family B of seven-transmembrane G protein–coupled receptors (GPCR). TheRAMP family comprises three members (RAMP1, RAMP2, andRAMP3) that share

for immunoblotting analysis solely for the purpose of validation ofspecificity of our own polyclonal antibody in the present study (seebelow).

AntibodyRabbit polyclonal antibody LN-1436 was raised against synthetic

peptide corresponding to residues 427 to 461 (HDIENVLLKPENLYN) atthe extreme COOH terminus of hCL protein (accession nos. AAC41994and AAA62158; ref. 23).

PeptidesSynthetic human AM was from Bachem (St. Helens, Merseyside,

United Kingdom).

Deglycosylation experimentsDeglycosylation experiments were done according to the supplier’s

protocols (Roche, Lewes, United Kingdom) before SDS-PAGE andimmunoblotting.

SDS-PAGE and immunoblottingProtein lysates from cell lines and tissues were obtained and

subjected to SDS-PAGE and immunoblotting as described previously(23, 24). The density of bands was analyzed on an AlphaImager 1220documentation and analysis system version 5.5 using linked back-ground subtraction.

RNA isolation, reverse transcription-PCR, and NorthernblottingRNA isolation, reverse transcription-PCR (RT-PCR), and Northern

blotting were done as described previously (24, 28).Reverse transcription-PCR. Amplifications were routinely done

using 25 to 30 cycles in the Perkin-Elmer (Beaconsfield, United

Kingdom) GeneAmp PCR System 2400 for h-actin control, AM, CL, andRAMPs using primers designed for their specificity and spanning

neighboring exons to enable the detection of a possible genomic DNA

contaminations (Table 1).Northern blotting. To generate the probes, full-length hCL, RAMP1,

and RAMP2 cDNAs were RT-PCR amplified and cloned into pcDNA3.1

vector and full-length RAMP3 and 410 bp PCR-amplified fragment of

AM cDNAs into TOPO vector. All resulting vectors were sequenced using

an Applied Biosystems (Warrington, United Kingdom) 377 Genetic

analyzer, and sequences were checked against the Genbank database.

Ubiquitin probe was from BD Biosciences (Oxford, United Kingdom).

Inserts were excised with restriction enzymes and labeled with

[32P]dCTP using MegaPrime labeling kit (Amersham, Little Chalfont,

United Kingdom). After hybridization and stringent washes as described

previously (24), the blots were exposed to Hyperfilm (Amersham) and

then to Phosphoscreen. Exposure was monitored to avoid saturation of

the signal. The hybridization signals were further analyzed using

ImageQuant software and linked background subtraction.

Endothelial cell isolation and cultureThe method used in the present study was based on that developed

for endometrial endothelium (Supplementary Fig. S1; ref. 29). In brief,positive selection of myometrial microvascular endothelial cells(MMVEC) was done using lectin Ulex europaeus agglutinin-1 (UEA-1) covalently bound to tosylactivated ‘Dynabeads’ M-450 (Dynabeads,Dynal, Norway). Purified endothelial cells were grown in EGM-2MVBullet kit medium (BioWhittaker, Wokingham, United Kingdom).Second round of positive selection using UEA-1-coated beads was doneafter first passage to remove remaining contaminating myometrialmyocytes and vascular smooth muscle cells.

In vitro angiogenesis assaysIn vitro angiogenesis assays included endothelial cell proliferation,

network formation, and migration.Endothelial cell growth and migration assays. [Methyl-3H]thymidine

uptake assay was done as described previously (29). Cell migrationassays were done as described recently (23).Endothelial cell Matrigel network formation assay. For the Matrigel

network formation assay, each well of a 24-well Falcon (FisherScientific, Loughborough, United Kingdom) tissue culture plate wasevenly coated with 150 AL Matrigel (BD Biosciences). MMVECs (1 �104 to 5 � 104) were seeded in triplicate per well in full EGM-2MVmedium. Network formation was accessed after 24 hours by photo-graphing the matrices using Zeiss (Welwyn Garden City, UnitedKingdom) light microscope and Nikon (Kingston Upon Thames,United Kingdom) CoolPix 990 digital camera.

Double immunofluorescenceCultured cells and cryostat sections. CulturedMMVECs and 7 to 8 Am

cryostat sections of myometrial and fibroid tissues were prepared andprocessed for immunofluorescence as described previously (23, 29).Antibodies. Cell type phenotyping was done with monoclonal anti-

CD34 (endothelial cell marker; Qbend 10, Novocastra, Newcastle uponTyne, United Kingdom), anti-CD31 (endothelial cell marker), anti–smooth muscle actin (smooth muscle cell marker), anti-CD45(peripheral blood mononuclear cell marker), and anti-CD68 (macro-phage marker) antibodies and polyclonal antibody against vonWillebrand factor (endothelial cell marker; all from DAKO, Ely, UnitedKingdom). Intracellular structures were identified using monoclonalanti-GM130 (Golgi matrix protein of 130 kDa), anti–early endosome–associated antigen 1, anti-calnexin (endoplasmic reticulum marker),and anti-CD107a (lysosome-associated membrane protein 1; all fromBD Biosciences PharMingen, Oxford, United Kingdom) antibodies.Secondary antibodies were Texas red–conjugated and FITC-conjugatedhorse anti-mouse and horse anti-rabbit IgG (all from Vector Labora-tories, Peterborough, United Kingdom).Double immunofluorescence. Double immunofluorescence was done

as described previously using anti-CL antibody LN-1436 and markers ofindividual cell types (as detailed in the ‘‘Antibodies’’; refs. 23, 29).

Table 1. Primers for RT-PCR

Gene Accession no. Primers (5¶-3¶) forward Primers (5¶-3¶) reverse Sequence PCR fragment size

AM NM 001124.1 AAGAAGTGGAATAAGTGGGCT TGGCTTAGAAGACACCAGAGT 250-660 410exon 3 exon 4

CL U 17473 CTCCTCTACATTATCCATGG CCTCCTCTGCAATCTTTCC 1,338-1,560 222exon 12 exon 13

RAMP1 NM 005855.1 AGTTCCAGGTAGACATGG GCCTACACAATGCCCTCA 160-481 321exon 2 exon 3

RAMP2 NM 005854.1 AAAGGATTGGTGCGACTG GGAAGTGGAGTAACATGG 308-635 327exon 3 exon 4

RAMP3 NM 005856.1 AGACAGGCATGTTGGAGA TTCCAGCTTGCCAGGTGT 118-519 401exon 2 exon 3

b-Actin NM 001101 ATCACCATTGGCAATGAGCG TTGAAGGTAGTTTCGTGGAT 808-905 97exon 4 exon 5





Visualization was carried out with the use of a Leitz Diaplan or LeitzDMRBE microscopes (Leica, Milton Keynes, United Kingdom), aHamamatsu Orca C4742-95 digital camera, and OpenLab software(both from Improvision, Coventry, United Kingdom).CD34/Mib1 double immunohistochemistry. Immunohistochemical

staining for detection of proliferating endothelial cells was done usingmonoclonal anti-CD34 (endothelial cell– specific marker) and anti-Ki-67 (marker of proliferating nuclei) antibodies [Qbend 10 and Mib1(DAKO)] essentially as described previously (9).

Determination of vascular density and endothelial cellproliferation indexVascular density was determined by Chalkley counting and

endothelial cell proliferative index as described previously (9).

Internalization assayHuman MMVECs were supplemented with 0.5% FCS-EGM-2

medium for 16 hours. Cells were then treated with or without 100nmol/L AM in 0.5% FCS-EGM-2 medium for 30 minutes. Internaliza-tion was accessed by immunofluorescence as described above using anti-hCL antibody and cell surface, early endosome, and lysosome markers.

Statistical methodsData on microvascular density, immunoblotting ratio signals, and

mRNA expression levels in patient-matched samples of myometrialand leiomyoma tissues were analyzed by Wilcoxon signed rank test.Ps < 0.05 were considered significant.

Results

Functional CL receptor is expressed inendothelium in leiomyomaMature glycosylated receptor is the predominant CL form in

fibroids. We have currently raised and characterized an anti-hCL polyclonal antibody LN-1436 (23). The antibody specif-ically recognizes unglycosylated, core-glycosylated, and matureglycosylated forms of CL receptor as shown using hCL-transfected or empty vector–transfected cell lines and deglyco-sylation assays (23). In the present study, we used this antibodyto examine which forms, and if the mature CL glycoprotein(functional form of the receptor) in particular, are present inlysates from fibroid and adjacent myometrial tissues fromleiomyoma-bearing uteri. We also did deglycosylation experi-ments to confirm the glycosylation status of the receptor.Several distinct bands were observed in untreated myometrial

and fibroid samples (Fig. 1B, lanes 1 and 4). EndoglycosidasesF and H were used to differentiate between mature and coreN-linked CL glycoproteins. The f55 kDa (strong band) formwas reduced to a 37 kDa formby treatment with endoglycosidaseF, showing that the additionalmass units represent carbohydrateresidues (Fig. 1B, lanes 2 and 5). However, this form is resistantto endoglycosidase H (Fig. 1B, lanes 5 and 6), indicating that CLhas been terminally glycosylated, an event normally associatedwith transit through the Golgi complex and the production ofmature glycoproteins. The majority of CL glycoprotein is amature glycosylated and not core-glycosylated form (Fig. 1B; seeFig. 3B for comparison, representing the immunoblot of degly-cosylation experiments done on lysates fromMMVECs, where allthree forms of CL could be detected). Thus, unglycosylated andmature CL glycoproteins are the predominant forms of thereceptor in myometrial and fibroid tissues. It follows that thepresence of the mature CL glycoprotein in these tissues suggeststhe functional state of the receptor expressed in vivo (20, 23).

CL is predominantly expressed by microvascular endotheliumin vivo in myometrium and fibroid. We then examined CLlocalization in fibroid and adjacent myometrial samples bydouble immunofluorescence. In myometrium, CL was local-ized in microvascular endothelium but was absent in muralcells (vascular smooth muscle cells/pericytes) and leukocytes(Fig. 1C). A similar pattern was observed in fibroids (Fig. 1C).Thus, CL is expressed exclusively by endothelium in bothfibroids and surrounding myometrium. It follows that func-tional CL exhibits endothelial-specific pattern of expressionin vivo .

Myometrial endothelial cells express functional CLreceptor that interacts with AM in vitroWe then did in vitro studies to analyze the functionality of the

CL expressed in MMVECs. We isolated primary MMVECs andexamined the glycosylation status of the CL and alsoinvestigated whether AM interacts with this endogenouslyexpressed receptor and has angiogenic effects on these cellsin vitro .Isolation and characterization of primary human MMVECs. Ini-

tially, we have isolated and characterized primary MMVECs. Weused UEA-1-coated magnetic beads because, similarly to CL,this lectin is expressed specifically in myometrial endotheliumin vivo (Fig. 2A). We obtained pure populations of MMVECs(beads positive) and myometrial smooth muscle cells (beadsnegative) as shown by double immunofluorescence usingantibodies against MMVEC-specific and myometrial smoothmuscle cell– specific markers von Willebrand factor anda-smooth muscle actin, respectively (Supplementary Fig. S1).Primary myometrial endothelial cells formed typical ‘‘cobble-stone’’ morphology and ‘‘capillary-like’’ structures when seededon Matrigel (Fig. 2B) and retained their characteristics inculture as shown by analysis of the expression of endothelialcell–specific markers von Willebrand factor (by immunofluo-rescence; Supplementary Fig. S1), CD31 (by immunoblotting;Fig. 2C), VEGF receptor 2, and Delta4 (by RT-PCR; Fig. 2D;refs. 30, 31).Mature and core-glycosylated CL forms are expressed in

MMVECs in vitro. We then investigated whether primaryMMVECs maintained the expression of the mature CLglycoprotein (the functional form of the receptor) in culture.We found that both core and mature CL glycoproteins arepresent in isolated MMVECs (Fig. 3A; compare with theexpression of only mature CL glycoprotein in tissues, Fig. 1B).The amount of both forms was comparable as determined byquantification of CL/h-actin ratio.Primary MMVECs continue to express CL and other components

of the AM receptor system in vitro. We then investigatedwhether primary MMVECs maintained the expression ofcomponents of AM receptor system (i.e., CL and RAMPs) aswell as AM itself compared with the in vivo expression of thesemolecules (Fig. 3B). Both primary MMVECs and myocytesexpress AM mRNA in vitro (Fig. 3B). CL and RAMP2, but notRAMP1 or RAMP3 mRNA, are expressed in MMVECs (Fig. 3B).CL mRNA was virtually absent in myocytes in vitro (Fig. 3B),which is consistent with the immunofluorescence findings onendothelium-specific distribution of CL protein in myome-trium (Fig. 1C). Myocytes express RAMP1 and RAMP2 but notRAMP3 mRNA. All receptor components (CL and three RAMPs)were expressed in tissues (Fig. 3B).

Functional GPCRCL in Uterine Leiomyoma

www.aacrjournals.org Clin Cancer Res 2006;12(19) October1, 20065651



Presence of the terminally glycosylated CL form in MMVECssuggests its cell surface expression and the presence offunctional endogenous AM receptors. We have examined thisby doing subcellular localization, proliferation, and migrationstudies.Correlation with cell surface expression. Presence of both

terminally and core-glycosylated forms of CL suggests the cellsurface and intracellular localization of this GPCR in MMVECs.This is because, when RAMP expression is insufficient, core-glycosylated CL does not undergo terminal glycosylation and isretained in the endoplasmic reticulum and not transported tothe cell surface (18). We analyzed the subcellular localization ofCL in MMVECs by immunofluorescence.The majority of MMVECs displayed visible staining concen-

trated in a perinuclear region, where CL protein is localized inthe endoplasmic reticulum but not in Golgi apparatus(Supplementary Fig. S2). Although absence or little surfacestaining was shown by lack of colocalization with the plasmamembrane marker CD31 (Supplementary Fig. S2), further

internalization studies confirmed that significant part of thereceptor is presented at the cell surface (as described below).Thus, our findings show both cell surface and intracellularlocalization of the CL in MMVECs.Correlation with the presence of functional endogenous AM-

sensitive receptors. We then investigated whether the expres-sion of mature CL glycoprotein correlates with the presence offunctional endogenous AM receptors in MMVECs. We thereforedid ligand-induced proliferation and migration studies in vitro.Fully active endogenous AM receptors were found in humanMMVECs in vitro as shown by comparable magnitude ofan agonist-mediated proliferation (Fig. 4A) and migration(Fig. 4B).AM interacts with endogenous MMVECs surface-expressed CL

and induces its internalization. The presence of fully activeendogenous receptors for AM as well as RAMP2 mRNAexpression in MMVECs suggests that endogenous CL might beinvolved in generating AM-sensitive receptors via formation ofCL/RAMP2 heterodimers, which are known to interact with AM

Fig. 1. Expression and distribution of GPCRCL inleiomyoma.Thef37 kDa,f55 kDa, andf100 kDaCL species (transiently expressed or endogenous)are present and specifically recognized by thepolyclonal anti-hCL antibody LN-1436 in lysatesfrom transfected HEK293Tcells (A) or inmyometrium and fibroids (B). A, the antibodyrecognizes transiently expressed hCL in HEK293Tcells transfected with hCLpcDNA alone (CL)or together with RAMP2 (CL+RAMP2). HEK293Tcells transfected with empty pcDNAvector(pcDNA) or RAMP2 alone (RAMP2) do notexpress hCL.Thef40 to 45 kDa hCL species(d ; core-glycosylated receptor) are present inHEK293Tcells transfected with hCLpcDNA only.Approximately 55 kDa hCL species (x; mature fullyglycosylated receptor) are only produced when thereceptor is coexpressed with RAMPs. B, tissuelysates were treated with endoglycosidase F (lanes2 and 5), endoglycosidase H (lanes 3 and 6),or vehicle (lanes1 and 4). Products were analyzedby SDS-PAGE under reducing conditions, andimmunoblots were probed using anti-hCL antibody.Arrowheads, deglycosylated (Mr,f37 kDa); d ,core glycosylated (f45 kDa, absent in tissueson the present figure but present in MMVECsin vitro, see Fig. 3A); x, mature fully glycosylated(f55 kDa); *, high molecular weight (f100 kDa)forms of the endogenous receptor.Thef55 kDaendogenous CL species (presumably producedafter coexpression with RAMPs) are reduced toanf37 kDa CL band after endoglycosidase Ftreatment but were resistant to endoglycosidase H.An additionalf100 kDa band was found inmyometrium and fibroids, and it was not reducedafter endoglycosidase treatment. For loadingcontrols, the membrane was reprobed withanti-h-actin (BA) antibody. C, doubleimmunofluorescence was done on frozen sectionsof myometrium and fibroids using combinationof polyclonal anti-hCL antibody and monoclonalantibodies against specific markers of endothelialcells (CD31), smooth muscle cells [smooth muscleactin (SMA)], and leukocytes (CD45). Controlis preimmune rabbit serum and mouse IgGusedat appropriate concentrations.The appropriateFITC-conjugated (for detection of CL; left, firstimage) orTexas red ^ conjugated (for detectionof cell types within tissue; second image) secondaryantibodies were used. 4¶,6-Diamidino-2-phenylindole (separate image not shown) wasused to counterstain cell nuclei.Yellow, colocalizedstructures (right, third image) as determined byoverlay of images.





(20, 32). We tested whether MMVEC-expressed CL interactswith AM by analyzing the dynamics of receptor internalizationin response to AM (10 nmol/L to Amol). Agonist-mediatedinternalization of surface-expressed endogenous CL wasobserved in response to AM (Fig. 4C and SupplementaryFig. S3). A significant proportion of internalized CL was targetedto early sorting endosomes and not lysosomes on exposure tothe ligand. Localization of endoplasmic reticulum–associatedportion of the receptor in perinuclear region remained unaltered(Fig. 4C and Supplementary Fig. S3). These findings show thatmature CL glycoprotein expressed in myometrial endotheliuminteracts with its ligand angiogenic factor AM.

Functional CL receptor is down-regulated and itsexpression is concurrent with alterations inRAMP2 mRNA levels and microvascular density infibroidsExpression of mature CL glycoprotein is down-regulated in

fibroids. Endothelial-specific expression of the receptors forangiogenic factors is often a prerequisite for successful anti-angiogenic therapies (26, 33, 34). Ideally, these receptors shouldbe expressed at higher levels in tumor vasculature and lower, or

even undetectable, levels in normal vasculature. The presenceof differentially expressed receptors would enable selectivetargeting of fibroid vasculature. We therefore analyzed theexpression levels of the functional form of the CL in leiomyomaand surrounding myometrium by immunoblotting. We foundthat the mature glycoprotein (functional receptor) levels weresignificantly down-regulated in fibroids (P < 0.01; Fig. 5A).Concurrence with alterations in RAMP expression. Because

expression of mature CL glycoprotein was down-regulated infibroids and because RAMPs are essential for terminalglycosylation, cell surface targeting, and ligand-binding selec-tivity of this GPCR (18), we studied the expression of RAMPs.Unfortunately no anti-human RAMP antibodies that reliablydistinguish their isoforms (1, 2, and 3) or show expression ofendogenous monomers (which should be observed in case of aheterodimeric CL/RAMP receptor) of expected molecularweight are available. Therefore, we studied RAMP mRNAexpression by Northern blotting. Only RAMP2 mRNA expres-sion was significantly altered (P < 0.05) in fibroids comparedwith myometrium (Fig. 5B). AM and RAMP1 were unchangedin fibroids (Fig. 5B). RAMP3 mRNA levels were below theNorthern blotting detection limit but could be found in normalmyometrium and fibroids by RT-PCR (see Fig. 3B for details).Thus, down-regulation of the functional CL is concurrent withthe reduction in RAMP2 mRNA expression in fibroids.Concurrence with alterations in microvascular density. Because

GPCR CL was localized in microvascular endothelium in bothfibroids and surrounding myometrium (Fig. 1C), we examinedmicrovessel density in both tissues (Fig. 5C). The vasculardensity of leiomyoma tissue in leiomyoma-bearing uteriwas significantly lower than in neighboring myometrial tissue(P < 0.05; Fig. 5C). The endothelial proliferation index wasunaltered in leiomyoma (data not shown). Thus, down-regulation of the functional form of CL receptor is concurrentwith the reduction of the microvascular density in leiomyoma.

Discussion

AM is a potent angiogenic factor. Several studies used animalmodels to show that AM overexpression in xenografted tumorsenhances tumor growth via angiogenesis, whereas blocking AMantibodies have the reverse effect (35). Although theseobservations point to a potential role for AM and its receptorsin tumor angiogenesis, their role in human cancer is as yetpoorly defined (reviewed in ref. 17). The lack of informationabout the distribution, regulation, and function of endogenousAM receptors in tumors makes it difficult to assess the potentialfor anti-AM strategies for noninvasive antiangiogenic therapyand its possible effects on surrounding tissue (reviewed inref. 17). Here, we present the first report on expression of thefunctional form of GPCR CL in human tumors.

We investigated the expression and localization of GPCR CLin uterine leiomyomas, a common solid tumor arising from themyometrium, where a role for AM in angiogenesis has beensuggested based on correlation of its expression with tumorvascularization alone (9). Here, we used both in vitro andin vivo approaches to clarify the role for both AM and its receptorCL in fibroid angiogenesis. First, we studied the distributionand functional state of the CL in leiomyomas. Second, weexamined if AM has an angiogenic effect on microvascularendothelial cells isolated from a specific microvascular bed,

Fig. 2. Isolation and characterization of primary MMVECs. A, doubleimmunofluorescence using rabbit polyclonal anti-hCL antibody and biotinylatedUEA-1was done on cryostat sections of myometrium. Goat anti-rabbitFITC-conjugated antibody (for the detection of CL; left, first image) andstreptavidin-Texas red (for the detection of UEA-1-labeled cells; second image)were used. 4¶,6-Diamidino-2-phenylindole (data not shown) was used tocounterstain cell nuclei. Endothelial CL-positive cells also express UEA-1asdetermined by colocalization (right, third image) on overlaid images. UEA-1-coatedbeads were then used for positive selection of microvascular endothelial cells(see Materials and Methods). B, primary MMVECs form the monolayer onattachment factor ^ coated dishes and the capillary network when seeded onMatrigel. vWF, vonWillebrand factor. C, immunoblot analysis of protein lysates fromprimary MMVECs and myocytes (MC) using anti-CD31antibody. For loadingcontrol, the membrane was reprobed with anti-h-actin (BA) antibody. D, RT-PCRanalysis of expression of endothelial-specific markersVEGF receptor 2(VEGFR-2) and Delta4 (DLL4; refs. 30, 31) in two primary isolates of MMVECs andmyocytes. Both endothelial cell markers are expressed only in purified MMVECs(beads positive) but not in myocytes (beads negative). h-Actin was used as aloading control.





where we found endothelial-specific expression of the CL andwhere a role for AM in aberrant angiogenesis has been recentlyproposed (i.e., from myometrium). This is because theendothelium from different vascular beds shows a differentialresponse to angiogenic factors due to the variations inexpression of their receptors (36). Third, we examined whetherCL expressed by MMVECs is functional (i.e., interacts with AM)by doing ligand-mediated receptor internalization studies andanalyzed which RAMPs might form heterodimers with CL.Finally, we analyzed expression levels of mature CL glycoprotein(functional form of the receptor) in vivo in leiomyomas andcompared this with the expression levels of RAMPs andmicrovascular density in this tumor.To our knowledge, there are no reports on expression of the

functional form of the CL receptor in human tumors.McLatchie et al. (18) showed that terminal (mature) glycosyl-ation of CL receptor requires expression of RAMPs by usingoverexpression cell models. This form of CL is considered to bebiologically active (i.e., interacting with ligands; ref. 20). Wefound that mature CL glycoprotein is expressed in leiomyomas.Thus, we were able to access the functional status of CL directlyin human tumor even without evaluating the expression oftranslated RAMPs. In contrast, the presence of the mature CLglycoprotein in tissues could be used to show indirectly theexpression of these accessory proteins. To our knowledge, ourstudy is the first to introduce the methodologic approach thatenables to access directly both the presence of endogenousRAMP proteins and to detect the levels of the functional CLreceptor in human tumors.In vivo, the mature CL glycoprotein was localized exclusively

in vascular endothelium in both myometrium and fibroids.Although our report is the first to show the expression anddistribution of this functional form of the CL receptor inhuman tumor tissue, more studies are required to investigatethe distribution and the role for this GPCR in other tumor typesand cancers. It could not be excluded that, in other tumors, the

expression pattern of functional form of the CL is different tothe endothelial-specific expression observed in leiomyoma, andit should be expected that CL might be also expressed on tumorcells.6 This notion concurs with previously reported AM effectson growth and migration of human breast, prostate, ovarian,and some other cancer cell lines (35).Our findings suggest the essential role for GPCR CL in

myometrial endothelial cell biology. The endothelial cell–specific expression of the functional form of the CL receptorin vivo in leiomyoma tissue, its internalization in response toagonist stimulation, and effects of AM on growth and migrationof MMVECs in vitro concur with previous observations thatelevated AM levels are associated with increased vasculardensity and endothelial proliferation index in leiomyoma, thussupporting the view that AM might play a role in aberrantangiogenesis in fibroids (9) by inducing an angiogenic responsein the normal myometrial endothelium. However, our dataalso show that mature glycosylated CL levels are lower infibroid tissue within leiomyoma-bearing uteri. We hypothe-sized that the observed decrease could be due to (a) reducedgene transcription (i.e., reduced CL mRNA expression), (b)decrease in expression of other components of the AM receptorsystem (e.g., RAMPs), (c) alterations in vascular density and/ornumber of endothelial cells, (d) chronic activation anddegradation of the AM receptors in fibroids, and (e) possiblealterations in the myometrial vasculature in the presence ofleiomyomas (9). We therefore analyzed these possibilities inmore detail.Our findings suggest that reduced hCL gene transcription in

leiomyomas is unlikely to account for the reduction in matureglycoprotein production. In contrast, observed down-regula-tion of RAMP2 mRNA expression in fibroids could possibly

Fig. 3. CL and RAMP expression in primary MMVECs. A, mature and core-glycosylated receptor expression in MMVECs analyzed by deglycosylation assay. MMVECtotal cell lysates were treated with endoglycosidase F (lane 2), endoglycosidase H (lane 3), or vehicle (lane1). Products were analyzed by SDS-PAGE, and immunoblots wereprobed with anti-hCL antibody LN-1436. Arrowheads, deglycosylated (Mr,f37 kDa); d , core glycosylated (f45 kDa); x, mature fully glycosylated (f55 kDa) formsof the receptor.Thef55 kDa CL species are reduced after endoglycosidase F treatment but were resistant to endoglycosidase H. For loading controls, the membrane wasreprobed with anti-h-actin (BA) antibody.The ratios ‘‘mature CL glycoprotein/h-actin’’ (Mature) and ‘‘core CL glycoprotein/h-actin’’ (Core) in cell lysates were calculatedbased on a densitometry values for the immunoblot bands.B, expression of CL, RAMP, and AMmRNAs in primary cells and tissues analyzed by RT-PCR. RNA samples werefrom MMVECs (1), myometrial myocytes (2), myometrial tissue (3), and fibroid tissue (4).The set of primers for detection of h-actin was used for loading controls. Negativecontrols with no reverse transcriptase enzyme (5) show an absence of signals.

6 L.L. Nikitenko et al., unpublished observations.





account for decreased levels of mature CL glycoprotein becauseRAMPs are known to regulate CL glycosylation (18). Further-more, both reduced terminally glycosylated CL and RAMP2mRNA levels could be due to the observed decrease in vasculardensity. This is because CL is expressed exclusively inendothelium in both myometrium and fibroids and alsobecause MMVECs express only RAMP2 mRNA in vitro . Thereduction of microvascular density in fibroids might be due tothe immature state of blood vessels commonly observed individing tumors or due to the higher content of fibrous

connective tissue, which is avascular (37). Hague et al. (9)reported that the vascular density of leiomyomas is comparablewith that of normal myometrium and that vascular density ofmyometrium was higher in leiomyoma-bearing uteri comparedwith normal controls. Thus, although no direct comparison wasmade between myometrium and fibroid within the sameuterus, the data presented by Hague et al. (9) concur with ourfindings and several other reports showing decrease in micro-vascular density in fibroid tissue within leiomyoma-bearinguteri (38, 39). Finally, it could not be excluded that mature CL

Fig. 4. Angiogenic response of MMVECs andinternalization of endogenous CL in response toAM.A, effect of AMon MMVEC proliferation determinedby [methyl-3H]thymidine uptake. Data are given aspercentage thymidine uptake in AM-treated cellscompared with controls (no added factors).B, effectof AMonMMVECmigration. Points, mean; bars, SE.C, subcellular redistribution/relocalization of CL inMMVECs after exposure to100 nmol/L ligand (AM)for 30 minutes. Cells were processed for doubleimmunofluorescence immediately after exposure.Colocalization of CL with early sorting endosome[early endosome ^ associated antigen1 (EEA1)]and lysosome [lysosome-associated membraneprotein1 (LAMP1)] markers. Localization ofendoplasmic reticulum ^ associated portion of thereceptor (arrows) remains unaltered. Figures arerepresentative of two independent experiments.Thecell surface ^ expressed CL can be visualized onlyafter internalization (arrowheads , left image) andis colocalized with early endosome ^ associatedantigen1but not lysosome-associated membraneprotein1 (both marked with arrows on respectiveright images).





glycoprotein levels might be reduced as a result of increasedligand-induced activation and subsequent internalization anddegradation of the receptor. This is because agonist-promotedinternalization is common to a large number of GPCRs and isoften related to the loss of receptor activity and its targeting tothe degradation pathway (40). If this was the case, then anincrease in either ligand expression or receptor degradationshould be observed. Our Northern blotting data show nochange in the levels of AM mRNA in fibroids compared withsurrounding myometrium, and internalization studies showedthat activated CL is not immediately targeted to lysosomes for

degradation. Similarly, other research groups showed that theexpression of VEGF, another angiogenic factor, is alsounchanged in myometrial and fibroid tissues within the sameuterus (8). Thus, our data suggest that the decreased levels ofthe mature CL glycoprotein in leiomyoma are due to thealterations in vascular density and/or number of endothelialcells and not due to the alterations in the receptor expression intumor endothelium.Because reduced levels of endothelial mature CL glycoprotein

in fibroids correlate only with RAMP2 mRNA expression, it islikely that CL/RAMP2 heterodimer (AM receptor), but notCL/RAMP1 (CGRP receptor), is present in vivo in endotheliumin leiomyoma. This is supported by the presence of RAMP2, butnot RAMP1 or RAMP3 mRNA, in isolated MMVECs. However,also our study shows that, in cultured MMVECs, there was anapproximately equal proportion of the mature and core-glycosylated receptor forms and that CL was localized not onlyon the cell surface but also in the endoplasmic reticulum inMMVECs. When RAMP expression is insufficient, core-glycosy-lated CL is retained in endoplasmic reticulum and nottransported to the cell surface (20). Therefore, it is possiblethat RAMP expression is altered in MMVECs in vitro. It followsthat in vivo RAMP3 may also play a role in the production of afunctional heterodimeric AM receptor (AM2; ref. 12) inendothelium by facilitating the glycosylation of the remainingproportion of the CL. This view is supported by our finding onexpression of the mRNA for this accessory protein inmyometrial tissue. The role for RAMP1 in this process isunlikely because RAMP1 mRNA is predominantly expressed bymyometrial myocytes in vivo as shown by our previous in situhybridization studies (24). Thus, we conclude that it could notbe excluded that both CL/RAMP2 (AM1 receptor) and CL/RAMP3 (AM2 receptor), but not CL/RAMP1 (CGRP receptor),heterodimers form a mixed in vivo –expressed pool of CL-associated receptors in microvascular endothelium in bothmyometrium and fibroids.The presence of differentially expressed receptors would

enable selective targeting of fibroids, and several studies

Fig. 5. CL and RAMP expression and microvascular density in myometrial andfibroid tissues from leiomyoma-bearing uteri. A, protein lysates frommatched pairsof myometrial (M) and fibroid (F) tissues (N = 12) from individual patients wereanalyzed by SDS-PAGE and immunoblotting with antibody LN-1436. Arrowheads,deglycosylated (f37 kDa); d , core glycosylated (f45 kDa; absent in tissues onthe present figure but present in MMVECs in vitro, see Fig. 3A); x, mature fullyglycosylated (f55 kDa) forms of the receptor. For loading controls, the membranewas reprobed with anti-h-actin antibody.The ratio CL/h-actin in tissue lysates wascalculated based on a densitometry values for the immunoblot bands.Wilcoxonsigned rank test was used to evaluate alterations in levels of mature glycosylatedreceptor. Columns, mean; bars, SE. **, P < 0.01. B, RNAwas isolated frommatchedpairs of myometrial and fibroid tissues (N = 12) from individual patients, and itsintegrity was assessed by ethidium bromide ^ stained formaldehyde gelelectrophoresis. RNAwas transferred onto membrane, and blots were hybridizedconsecutively with [32P]dCTP-labeled probes for CL, RAMP1, RAMP2, AM, andubiquitin (loading control). Signals of expected size were observed for each probeas shown on images of the analyzed pairs.The ratios ‘‘gene of interest/ubiquitin’’were calculated and analyzed byWilcoxon signed rank test to compareexpression levels in both tissues. Columns, mean; bars, SE. *, P < 0.05.C, immunohistochemical staining for detection of endothelial cells (gray) inleiomyoma-bearing uteri was done using monoclonal anti-CD34 (endothelialcell ^ specific marker) antibody (as described in Materials and Methods).Vasculardensity data were measured in myometrial and fibroid tissues (right , highmagnification of squared areas) within leiomyoma-bearing uteri and analyzed withGraphPad Prism software.Wilcoxon signed rank test analysis was done to compareobtained values. Columns, mean; bars, SE. *, P < 0.05.





attempted to identify these molecules (41, 42). However, nochanges have been observed in gene expression profiles inendothelium from fibroid and myometrium within leio-myoma-bearing uteri as yet. The functional CL receptor (AM1or AM2 receptor) expressed in fibroid endothelium in vivoretains its potential to be useful for targeting tumor vasculatureeven despite the relatively unaltered expression in leiomyomavessels (when taking into account reduction in microvesseldensity in leiomyoma and endothelial-specific expression ofthe receptor) as well as unchanged expression of its ligand AMwithin the leiomyoma-bearing uterus. This is because cellularcomponents other than just CL and RAMPs could be alsoimportant for the expressed phenotype and the properties ofCL-associated receptor subtypes, such as magnitude of agonist-mediated responses and mechanisms of internalization anddesensitization (reviewed in refs. 19, 43, 44). For example, therole for one of these molecules (i.e., receptor componentprotein) in AM signaling and in endothelial cells in femalereproductive tract in particular has been recently suggested(45, 46). In addition, it has been shown that the GPCR kinasesplay a pivotal role in desensitization of GPCRs without loss oftheir cell surface expression (47). Recently, the role for GPCRkinases in GPCR-mediated signaling in endothelial cells (48) aswell as CL-mediated signaling has been suggested (49). Finally,the internalization and trafficking of the AM receptors can beregulated by the expression of Na+/H+ exchanger regulatoryfactor-1 (44). Findings from these studies suggest that whether

mature CL glycoprotein (CL/RAMP2 or CL/RAMP3 complex)expressed in fibroid vasculature is functionally ‘‘more efficient’’or has higher turnover/recycling rate compared with surround-ing myometrial vasculature remains to be investigated. Thedetailed preclinical expression studies for these components ofAM signaling system and the modulators of CL expression andfunction in particular would provide such information in thefuture. The outcome of such studies would be essential toenable further evaluation of the potential for targetingendothelial GPCR CL for antiangiogenic therapies before theuse of respective inhibitors in clinical trials to avoid adverseeffect on normal tissues within the tumor-bearing organ.

In summary, we present the first report showing theexpression of the functional form of GPCR CL in humantumors. Our findings suggest the role for CL in mediatingangiogenic effects of AM and that the endothelial-specificphenotype determines the alterations in the expression of thefunctional form of the CL in uterine leiomyoma. We concludethat further evaluation of the properties of the CL in normaland tumor endothelium is essential before targeting thisendothelial GPCR for antiangiogenic therapies in uterineleiomyoma and possibly other tumors.

Acknowledgments

We thank Robin Roberts-Gant for assistance with formatting figures and Drs.Veronica Carroll and Cecilia Lai for the critical reading of the article.



References1. Folkman J. Tumour angiogenesis. In: Holland JF,Frei E, Bast RC, Kufe DW, Morton DL,WeichselbaumRR, editors. Cancer medicine. Ontario: Decker; 2000.p.132^52.

2. Carmeliet P, Jain RK. Angiogenesis in cancer andother diseases. Nature 2000;407:249^57.

3. Hurwitz H, Fehrenbacher L, NovotnyW, et al. Beva-cizumab plus irinotecan, fluorouracil, and leucovorinfor metastatic colorectal cancer. New Engl J Med2004;350:2335^42.

4. Kerbel R, FolkmanJ. Clinical translation of angiogen-esis inhibitors. Nat Rev Cancer 2002;2:727^39.

5. Ferrara N, Kerbel RS. Angiogenesis as a therapeutictarget. Nature 2005;438:967^74.

6. LeCouter J, Lin R, Ferrara N. Endocrine gland-derived VEGF and the emerging hypothesis of organ-specific regulation of angiogenesis. Nat Med 2002;8:913^7.

7. Flake GP, Andersen J, Dixon D. Etioligy and patho-genesis of uterine leiomyomas: a review. EnvironHealth Perspect 2002;111:1037^54.

8. Harrison-Woolrych ML, Sharkey AM, Charnock-Jones DS, Smith SK. Localization and quantificationof vascular endothelial growth factor messenger ribo-nucleic acid in human myometrium and leiomyomata.JClin Endocrinol Metab1995;80:1853^8.

9. Hague S, Zhang L, Oehler MK, et al. Expression ofthe hypoxically regulated angiogenic factor adreno-medullin correlates with uterine leiomyoma vasculardensity. Clin Cancer Res 2000;3:2808^14.

10. Kitamura K, Kangawa K, Kawamoto M, et al. Adre-nomedullin: a novel hypotensive peptide isolated fromhuman pheochromocytoma. Biochem Biophys ResCommun1993;192:553^60.

11. Hinson JP, Kapas S, Smith DM. Adrenomedullin, amultifunctional regulatory peptide. Endocr Rev 2000;21:138^67.

12. Poyner DR, Sexton PM, Marshall I, et al. Interna-tional Union of Pharmacology. XXXII. The mammaliancalcitonin gene-related peptides, adrenomedullin,

amylin, and calcitonin receptors. Pharmacol Rev2002;54:233^46.

13. Harris AL. HypoxiaNa key regulatory factor intumor growth. Nat Rev Cancer 2002;2:38^47.

14. Oehler MK, Hague S, Rees MC, Bicknell R.Adrenomedullin promotes formation of xenograftedendometrial tumors by stimulation of autocrinegrowth and angiogenesis. Oncogene 2002;21:2815^21.

15. Ouafik L, Sauze S, Boudouresque F, et al. Neutrali-zation of adrenomedullin inhibits the growth of humanglioblastoma cell lines in vitro and suppresses tumorxenograft growth in vivo. Am J Pathol 2002;160:1279^92.

16. Martinez A,Vos M, Guedez L, et al. The effects ofadrenomedullin overexpression in breast tumor cells.JNatl Cancer Inst 2002;94:1226^37.

17. Nikitenko LL, Fox SB, Kehoe S, Rees MCP, BicknellR. Adrenomedullin and tumor angiogenesis. Br JCancer 2006;94:1^7.

18. McLatchie LM, Fraser NJ, Main MJ, et al. RAMPsregulate the transport and ligand specificity of thecalcitonin-receptor-like receptor. Nature 1998;393:333^9.

19. Sexton PM, Albiston A, Morfis M, Tilakaratne M.Receptor activity modifying proteins. Cell Signal2001;13:73^83.

20. Hilairet S, Foord SM, Marshall FH, Bouvier M.Protein-protein interaction and not glycosylationdetermines the binding selectivity of heterodimersbetween the calcitonin receptor-like receptor and thereceptor activity-modifying proteins. J Biol Chem2001;276:29575^81.

21. KimW,Moon SO, SungMJ, et al. Angiogenic role ofadrenomedullin through activation of Akt, mitogen-activated protein kinase, and focal adhesion kinase inendothelial cells. FASEB J 2003;17:1937^9.

22. Fernandez-Sauze S, Delfino C, Marbrouk K, et al.Effects of adrenomedullin on endothelial cells in themultistep process of angiogenesis: involvement of

CRLR/RAMP2 and CRLR/RAMP3 receptors. Int JCancer 2004;108:797^804.

23. Nikitenko LL, Blucher N, Fox SB, Bicknell R, SmithDM, Rees MCP. Adrenomedullin and CGRP interactwith endogenous calcitonin receptor-like receptor inendothelial cells and induce its desensitisation viadifferent mechanisms. JCell Sci 2006;119:910^22.

24. Nikitenko LL, Brown NS, Smith DM, MacKenzie IZ,Bicknell R, Rees MC. Differential and cell-specificexpression of calcitonin receptor-like receptor andreceptor activity modifying proteins in the humanuterus. Mol Hum Reprod 2001;7:655^64.

25. Hagner S, Stahl U, Knoblauch B, McGregor GP,Lang RE. Calcitonin receptor-like receptor: identifica-tion and distribution in human peripheral tissues. CellTissue Res 2002;310:41^50.

26. LeCouter J, Ferrara N. EG-VEGF and Bv8. a novelfamily of tissue-selective mediators of angiogenesis,endothelial phenotype, and function. Trends Cardio-vasc Med 2003;13:276^82.

27. Vasillatis DK, Hohmann JG, Zeng H, et al. The Gprotein-coupled receptor repertoires of human andmouse. Proc Natl Acad Sci USA 2003;100:4903^8.

28. Nikitenko LL, Smith DM, Bicknell R, Rees MC.Transcriptional regulation of the CRLR gene in humanmicrovascular endothelial cells by hypoxia. FASEB J2003;17:1499^501. Full-length article is available from:http://www.fasebj.org/cgi/reprint/02-0993fjev1.pdf.

29. Nikitenko LL, MacKenzie IZ, Rees MCP, Bicknell R.Adrenomedullin is an autocrine regulator of endotheli-al growth in human endometrium. Mol Hum Reprod2000;6:811^9.

30. Kaipainen A, Korhonen J, Pajusola K, et al. Therelated FLT4, FLT1, and KDR receptor tyrosine kinasesshow distinct expression patterns in human fetal en-dothelial cells. JExp Med1993;178:2077^88.

31.Mailhos C, Modlich U, LewisJ, Harris A, Bicknell R,Ish-Horowicz D. Delta4, an endothelial specific notchligand expressed at sites of physiological and tumorangiogenesis. Differentiation 2001;69:135^44.





32. Kuwasako K, ShimekakeY, Masuda M, et al. Visu-alization of the calcitonin receptor-like receptor andits receptor activity-modifying proteins during inter-nalization and recycling. J Biol Chem 2000;275:29602^9.

33. Yancopoulos GD, Davis S, Gale NW, Rudge JS,Wiegand SJ, Holash J. Vascular-specific growth fac-tors and blood vessel formation. Nature 2000;407:242^8.

34. Carmeliet P. Angiogenesis in life, disease, andmed-icine. Nature 2005;438:932^6.

35. Zudaire E, Martinez A, Cuttitta F. Adrenomedullinand cancer. Regul Pept 2003;112:175^83.

36. Auerbach R, Alby L, Morrissey LW,Tu M, JosephJ.Expression of organ-specific antigens on capillary en-dothelial cells. Microvasc Res1985;29:401^11.

37. Fox SB, Harris AL. Histological quantitationof tumorangiogenesis. APMIS 2004;112:413^30.

38. Casey R, Rogers PA,Vollenhoven BJ. An immuno-histochemical analysis of fibroid vasculature. HumReprod 2000;15:1469^75.

39. Poncelet C, Madelenat P, Feldmann G,Walker F,Darai E. Expression of vonWillebrand’s factor, CD34,CD31, and vascular endothelial growth factor in uter-ine leiomyomas. Fertil Steril 2002;78:581^6.

40. Koenig JA, Edwardson JM. Endocytosis and recy-cling of G protein-coupled receptors. Trends Pharma-col Sci 1997;18:276^87.

41.Gokdeniz R, Mizrak B, Ozen S, Bazoglu N. Endothe-lial nitric oxide synthase expression in leiomyoma andparental myometrium. Gynecol Obstet Invest 2000;49:132^6.

42.Gargett CE, Bucak K, ZaitsevaM, et al. Estrogen re-ceptor-a and -h expression in microvascular endothe-lial cells and smooth muscle cells of myometrium andleiomyoma. Mol Hum Reprod 2002;8:770^5.

43. Hay DL, Smith DM, Poyner D. Desensitisation ofadrenomedullin and CGRP receptors. Regul Pept2003;112:139^45.

44. Bomberger JM, SpielmanWS, Hall CS,WeinmannEJ, Paramesarwaran N. Receptor activity-modifyingprotein (RAMP) isoform-specific regulation of adre-

nomedullin receptor trafficking by NHERF-1. J BiolChem 2005;280:23926^35.

45. Prado MA, Evans-Bain B, Oliver KR, Dickerson IM.The role of the CGRP-receptor component protein(RCP) in adrenomedullin receptor signal transduction.Peptides 2001;11:1773^81.

46. Pokabla MJ, Dickerson IM, Papka RE. Calcitoningene-related peptide-receptor component protein ex-pression in the uterine cervix, lumbosacral spinal cord,and dorsal root ganglia. Peptides 2002;23:507^14.

47. Penn RB, Pronin AN, Benovic JL. Regulation of G-protein coupled receptor kinases. Trends CardiovascMed 2000;10:81^9.

48. Liu S, Premont RT, Kontos CD, Zhu S, Rockey DC.A crucial role for GRK2 in regulation of endothelial cellnitric oxide synthase function in portal hypertension.Nat Med 2005;11:952^8.

49. Aiyar N, Disa J, Dang K, Pronin AN, Benovic JL,Nambi P. Involvement of G protein-coupled receptorkinase-6 in desensitization of CGRP receptors. Eur JPharmacol 2000;403:1^7.



2006;12:5648-5658. Clin Cancer Res Leonid L. Nikitenko, Tanya Cross, Leticia Campo, et al. and Association with Microvascular DensityLike Receptor in Uterine Leiomyoma: Endothelial Phenotype

−Expression of Terminally Glycosylated Calcitonin Receptor

Updated version

http://clincancerres.aacrjournals.org/content/12/19/5648

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2006/10/17/12.19.5648.DC1

Access the most recent supplemental material at:

Cited articles

http://clincancerres.aacrjournals.org/content/12/19/5648.full#ref-list-1

This article cites 47 articles, 7 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/12/19/5648.full#related-urls

This article has been cited by 2 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://clincancerres.aacrjournals.org/content/12/19/5648To request permission to re-use all or part of this article, use this link

http://clincancerres.aacrjournals.org/content/12/19/5648http://clincancerres.aacrjournals.org/content/suppl/2006/10/17/12.19.5648.DC1http://clincancerres.aacrjournals.org/content/12/19/5648.full#ref-list-1http://clincancerres.aacrjournals.org/content/12/19/5648.full#related-urlshttp://clincancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://clincancerres.aacrjournals.org/content/12/19/5648http://clincancerres.aacrjournals.org/

ExpressionofTerminallyGlycosylatedCalcitoninReceptor^Like ... · individual tumor types/stages by...

Documents

Transcript of ExpressionofTerminallyGlycosylatedCalcitoninReceptor^Like ... · individual tumor types/stages by...