A

Eo

ACAa

b

a

ARRAA

KAOS

I

bsafmwt(

dgfobs1n

OP

h0

ARTICLE IN PRESSG ModelCTHIS-50831; No. of Pages 7

Acta Histochemica xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Acta Histochemica

jo ur nal homepage: www.elsev ier .de /ac th is

xpression and localization of Aquaporin 3 (AQP3) in folliculogenesisf ewes

ntonia Debora Salesa, Ivina Rocha Britoa, Laritza Ferreira de Limaa,arlos Henrique Lobob, Ana Beatriz Grac a Duartea, Carlos Eduardo Azevedo Souzab,rlindo Alencar Mourab, José Ricardo de Figueiredoa, Ana Paula Ribeiro Rodriguesa,∗

Oocytes and Ovarian Preantral Follicles Laboratory (LAMOFOPA), State University of Ceará, Fortaleza, CE, BrazilBiology of Reproduction Research Group, Department of Animal Science, Federal University of Ceará, Fortaleza, CE, Brazil

r t i c l e i n f o

rticle history:eceived 1 November 2013eceived in revised form 3 February 2014ccepted 4 February 2014

a b s t r a c t

The mRNA expression and localization of Aquaporin 3 (AQP3) were investigated in the ovarian follicles ofewes at different stages of development (primordial, primary, secondary, small, and large antral). The geneexpression was quantified by qPCR, while the protein identification and localization were determined by

vailable online xxx

eywords:quaporin 3varian follicles

Western blot and immunohistochemistry, respectively. Analysis revealed that AQP3 mRNA was detectedonly in the antral follicles, whereas the protein expression was detected in the oocyte and granulosacells in all stages of follicular development. The latter observation suggests that the presence of AQP3 infollicles of all categories, especially in the antral follicles, provides novel insights on the mechanisms thatregulate the flow of water between cells during the formation of antral follicles in sheep.

© 2014 Elsevier GmbH. All rights reserved.

heep

ntroduction

The plasma membrane consists essentially of a phospholipidilayer, which is responsible for ensuring the exchange of sub-tances between the intracellular and extracellular environmentnd thus, the maintenance of appropriate conditions for theunctioning of cells. Lipid-soluble substances pass through the

embrane by direct passage through the lipid bilayer, whereasater and water soluble ions and small molecules pass through

he membrane by small protein channels called aquaporins (AQPs)Agre et al., 1993).

The AQPs are hydrophobic proteins with six transmembraneomains whose molecular weight ranges from 28 kDa (non-lycosylated form) and 40–50 kDa (glycosylated form) and that areound mostly as homotetramers (Yasui et al., 1999). Thirteen typesf AQPs (AQP0-12) have been identified in mammals, most of themeing permeable only to water (Preston et al., 1992). Functional

Please cite this article in press as: Sales AD, et al. Expression and locaHistochemica (2014), http://dx.doi.org/10.1016/j.acthis.2014.02.001

tudies have identified a subgroup of aquaglyceroporins (3, 7, 9 and0), which besides transporting water, also transport urea, arse-ate, and various polyols (Heller et al., 1980; Hub and DeGroot,

∗ Corresponding author at: Laboratório de Manipulac ão de Oócitos e Folículosvarianos Pré-Antrais (LAMOFOPA), Universidade Estadual do Ceará (UECE), Av.aranjana, 1700, Campus do Itaperi, Fortaleza, CE, CEP: 60740-000, Brazil.

E-mail address: aprrodriguespapers@gmail.com (A.P.R. Rodrigues).

ttp://dx.doi.org/10.1016/j.acthis.2014.02.001065-1281/© 2014 Elsevier GmbH. All rights reserved.

2008), as well as glycerol and other cryoprotectant agents used forthe cryopreservation of embryos and germ cells (Jin et al., 2011).

With the exception of AQP10, all the aquaglyceroporins wereidentified in different tissues of the reproductive system (uterus,ovary and oviduct) of rats (Li et al., 1997; Lindsay and Murphy,2007), mice (Jablonski et al., 2003; Richard et al., 2003), pigs(Skowronski et al., 2009) and humans (Thoroddsen et al., 2011).Specifically in the ovary, AQPs have been reported to facilitatethe homeostasis of water in the early folliculogenesis of pigs(Skowronski et al., 2009), as well as antral cavity formation in thefollicles of rodents and humans (Li et al., 1997; Lindsay and Murphy,2007; Thoroddsen et al., 2011).

The presence of aquaporins in murine species has been identi-fied in the ovarian bursa, the membrane that surrounds the ovary,suggesting coordinated roles in maintenance of local fluid envi-ronments (Zhang et al., 2013). The aquaporins are also involved inrat folliculogenesis with special reference to expanding cumulus-oocyte complexes (COCs), including postovulatory ampullary COCs(Starowicz et al., 2013). Up to date, 13 isoforms of aquaporins(AQP0–12) have been identified in mammals and 12 are expressedin female and male reproductive systems (Zhang et al., 2012).

Among aquaglyceroporins, AQP3 has been most frequently

lization of Aquaporin 3 (AQP3) in folliculogenesis of ewes. Acta

studied because of its important role in cell permeability. Stud-ies have indicated that AQP3 is expressed in the granulosa andtheca cells of pre-ovulatory follicles in women and in the oocytes atthe metaphase (MII) stage in mice (Meng et al., 2008; Thoroddsen

ING ModelA

2 tochem

ea2o

aseeu

etIp1Ma(

M

C

c(

O

wdawal

P

t(

fi(sdnob

T

mpri−

Rtt

ARTICLECTHIS-50831; No. of Pages 7

A.D. Sales et al. / Acta His

t al., 2011). Moreover, during vitrification of bovine embryos, AQP3ssists in the permeability of ethylene glycol (Campos-Chillòn et al.,006) and also functions as a biomarker that indicates the qualityf the embryos following cryopreservation (Camargo et al., 2011).

Based on the published literature, the expression of AQP3ppears to vary with the stages of folliculogenesis or embryonictages in different mammalian species. Despite this evidence, thexpression pattern of AQP3 in the early stages of folliculogen-sis and its localization in different follicular compartments isnknown.

The aim of this study was to analyze AQP3 mRNA and proteinxpression at the cellular distribution of AQP3 in sheep ovary, dueo its similarity to the human ovary in anatomy and physiology.n human folliculogenesis, the period of follicular growth from therimordial to the preovulatory stage is about six months (Gougeon,986), whereas in sheep it is approximately 170 days (Cahill andauleon, 1980; Bartlewski et al., 2011). Sheep are widely used as

n animal model for the development of biotechnology in humansGosden et al., 1994; Oktay et al., 2000; Salle et al., 2002).

aterial and methods

hemicals

Unless otherwise specified, the culture media and other chemi-als used in the present study were purchased from Sigma–AldrichSt. Louis, MO, USA).

varian tissue collection

Ovaries (n = 60) from 30 non-pregnant, adult, mixed-breed ewesere collected at a local abattoir (Fortaleza, CE, Brazil). Imme-iately postmortem, pairs of ovaries were washed once in 70%lcohol and then twice in Minimum Essential Medium bufferedith HEPES (MEM-HEPES) with antibiotics (100 �g/mL penicillin

nd 100 �g/mL streptomycin) and transported within 1 h to theaboratory in tubes containing washing medium at 4 ◦C.

rocessing of ovaries

Some of the ovaries (n = 40) were used for quantitative Real-ime PCR (qPCR) others for Western blot (n = 10), and the remaindern = 10) were used for immunohistochemistry.

For mRNA extraction, the follicles were mechanically isolatedrom the ovaries (n = 40). The primordial and primary follicles weresolated by using a previously described mechanical procedureAmorim et al., 2000) whereas secondary follicles (≥150 �m) andmall (1–3 mm) and large (>3–6 mm) antral follicles were manuallyissected from the strips of ovarian cortex using 26 gauge (26 G)eedles (Luz et al., 2012). For immunohistochemistry the sheepvaries were fixed in 4% paraformaldehyde and for the Westernlot analysis ovarian tissue fragments were lysed in buffer.

otal RNA isolation

In order to have a sufficient RNA amount for the qPCR experi-ents, pools containing 10 secondary follicles, 30 primordial and

rimary follicles and 5 antral follicles, all in triplicates (biologicaleplicates) were used. After isolation, these follicles were washedn MEM-HEPES, placed in separate Eppendorf tubes and stored at80 ◦C until the RNA was extracted.

Please cite this article in press as: Sales AD, et al. Expression and locaHistochemica (2014), http://dx.doi.org/10.1016/j.acthis.2014.02.001

Isolation of total RNA was performed by using the TrizolTM

eagent (Invitrogen, São Paulo, Brazil), following the manufac-urer’s instructions. After isolation, total RNA was purified usinghe column system PureLinkTM RNA Mini Kit (Invitrogen, Carlsbad,

PRESSica xxx (2014) xxx–xxx

CA, USA), according to manufacturer’s instructions. All RNA sam-ples were subjected to DNase I treatment with a PureLinkTM DNase(Invitrogen, USA). RNA quality and concentration were determinedusing a NanoDropTM 2000 spectrophotometer (Thermo Scientific,Waltham, MA, USA). One unit of absorbance at 260 nm corre-sponded to 40 �g/mL RNA.

Reverse transcription-PCR

For reverse transcription, complementary DNA (cDNA) wassynthesized using 1 �g RNA with SuperScriptTM III Reverse Tran-scriptase (Invitrogen Life Technologies, USA). PCR reactions wereconducted in two steps. In the first, 1 �g of RNA, 50 ng/mL of ran-dom hexamer primers, 10 mMdNTP mix, and DEPC treated water(for a total volume of 13 �L) were heated to 65 ◦C for 5 min andimmediately placed on ice for at least 1 min. In the second step,200 U of SuperScriptTM III RT, 10× RT Buffer, 0.1 M DTT, and 40 URNaseOut were added to the reaction mixture. Reverse transcrip-tion was performed at 25 ◦C for 5 min, 50 ◦C for 40 min, and 70 ◦Cfor 15 min. The first strand of cDNA was stored at −20 ◦C.

Real-time PCR

Real time PCR (qPCR) was carried out using an i-cycler iQ5 (Bio-Rad, Hercules, CA, USA). The reaction volume of 20 �L consisted 5 ngof each cDNA, 1× Power SYBRTM Green PCR Master Mix, 10 �M ofboth sense and antisense primer, and ultra-pure water. The qPCRprotocol included initial denaturation step at 95 ◦C for 10 min, fol-lowed by 40 PCR cycles (15 s at 95 ◦C, 1 min at 60 ◦C, 1 min at 72 ◦C),and a final extension step for 10 min at 72 ◦C. The specificity of eachprimer set was determined by the melting procedure, carried outbetween 60 and 95 ◦C for all genes. The fluorescent signals were ini-tially acquired at 60 ◦C followed by subsequent acquisition at 10 sintervals until the temperature reached 95 ◦C. GAPDH was used asa reference gene to normalize the expression levels of the assayedgenes. All samples were run in triplicate and qPCR was repeated atleast twice. As negative controls, samples with reverse transcrip-tase but without RNA were used. The 2−��Ct method (Livak andSchmittgen, 2001) was used to transform CT values into normalizedrelative expression levels.

Primer design

The gene sequences were obtained from the National Center forBiotechnology Information (NCBI, Bethesda, MD, USA). The primerswere designed according to the published OvisariesAQP3 mRNAsequences in the GenBank, using the online, free access program,Primer 3 (Table 1). The primers were tested for their specificity andefficiency using serial dilutions combining three different concen-trations for the primers (10 �M, 5 �M and 0.5 �M) with three cDNAconcentrations (5 ng, 0.5 ng, 1 ng). The combination with the bestresult, for specificity and efficiency (10 �M with 5 ng) was used inthe qPCRs.

Immunohistochemistry

The sheep ovaries were fixed in 4% paraformaldehyde for 12 h,dehydrated, and embedded in paraffin wax. For immunolocal-ization of AQP3, 5 �m thick sections were cut and mounted onpoly-l-lysine-coated glass slides, dried overnight at 37 ◦C, deparaf-finized in xylene and rehydrated in a graded ethanol series,followed by antigen retrieval with citric acid buffered solution (pH

lization of Aquaporin 3 (AQP3) in folliculogenesis of ewes. Acta

6.0) and Tween 20. After blocking endogenous peroxidase activitywith 3% hydrogen peroxide and methanol for 10 min, the sec-tions were incubated for 1 h with blocking solution (25 mL PBScontaining 1.25% bovine serum albumin and 3% triton X-100) at

ARTICLE IN PRESSG ModelACTHIS-50831; No. of Pages 7

A.D. Sales et al. / Acta Histochemica xxx (2014) xxx–xxx 3

Table 1Oligonucleotide primers used for Real-time PCR analysis.

Target gene Primer sequence Genbank accession number Amplicon

AQP3 Sense5′CTTCCTGGGTGCTGGAATTA3′

Antisense5′ACTGGTCGAAGAAGCCATTG3′

AF123316.1 158 pb

GAPDH Sense′ ′

′

NM 00119039.1 76 pb

rAicawhtwTtoFtcmcoawii(

W

i(11t1twifS7bs(pohftIUta(l

technique. Immunoreactivity was detected in different compart-ments of the follicles at various developmental stages (Table 2).In the cytoplasm of the oocyte, we observed strong staining forAQP3 in primordial (Fig. 2A), primary (Fig. 2B), and antral follicles

5 ATGCCTCCTGCACCACCA3Antisense5′AGTCCCTCCACGATGCCAA3

oom temperature, and overnight with the rabbit polyclonal anti-QP3 (contain homology with mouse – 17/18 amino acid residues

dentical; sheep, human – 15/18 amino acid residues identi-al/1:100, antibodies from Alomone Laboratories, Jerusalem, Israel)t 4 ◦C. After repeated washing in PBS, the sections were incubatedith biotin-conjugated goat anti-rabbit IgG (1:200) followed byorseradish peroxidase-conjugated avidin (ABC kit, Vector Labora-ories, Burlingame, CA, USA). The positive reactions were visualizedith 3,3′-diaminobenzidine tetrahydrochloride (DAB) solution.

he sections were counterstained with hematoxylin. Negative con-rols were performed by substituting the primary antibody with IgGbtained from the same species as that of the primary antibody.or positive control, we used sections of rat kidney to confirm pro-ein expression in the collecting duct. The preantral follicles werelassified as primordial (oocyte surrounded by one layer of squa-ous granulosa cells), primary (oocyte surrounded by one layer of

uboidal granulosa cells), or secondary (oocyte surrounded by twor more layers of cuboidal granulosa cells). The presence of smallntral follicles (presence of cavity filled with follicular fluid andell-developed layers of granulosa cells) was also noted. In the var-

ous follicular compartments (oocyte, granulosa or theca cells), themmunostaining was classified as absent (−), weak (+), moderate++) or strong (+++).

estern blot analysis

Ovarian tissue fragments were lysed in buffer (1× PBS, 1% Non-det P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfateSDS), 100 mg/mL phenyl methyl sulphonyl fluoride (PMSF) and00 mg/mL leupeptin), and the cell lysates were centrifuged at1,000 × g at 4 ◦C for 15 min to extract the proteins. Protein concen-ration was determined according to Bradford’s method (Bradford,976), using the Quick Start Bradford Protein Assay quantifica-ion kit (Bio-Rad, Hercules, CA, USA). The ovarian proteins (20 �g)ere separated according to their molecular weight by SDS-PAGE

n 8–16% gradient polyacrylamide gels. Proteins were transferredrom the gels to PVDF membranes (Hybond-P, GE Healthcare Lifeciences, Pittsburgh, PA, USA) using a semi-dry transfer unit (TE0, GE Healthcare Life Sciences, USA) and allowed to air-dry. Mem-ranes were blocked overnight at 4 ◦C with 50 mL of Tris bufferedolution (TBS; pH 8.0) containing 0.5% Tween 20 (TBS-T) and 5%w/v) BSA, with mild agitation, followed by incubation with rabbitolyclonal anti-AQP3 primary antibody (1:1000 contain homol-gy with mouse – 17/18 amino acid residues identical; sheep,uman – 15/18 amino acid residues identical/1:100, antibodies

rom Alomone Laboratories, Jerusalem, Israel). Membranes werehen washed three times in TBS-T and incubated with anti-rabbitgG coupled with alkaline phosphatase (Abcam, Cambridge, MA,SA) for another 2 h, washed again three times in TBS-T, and rinsed

Please cite this article in press as: Sales AD, et al. Expression and locaHistochemica (2014), http://dx.doi.org/10.1016/j.acthis.2014.02.001

wice with Tris–HCl (50 mM; pH 7.4). Immunoreaction was visu-lized by exposing the membranes to a solution containing BCIP®

5-bromo-4-chloro-3-indolyl phosphate 0.15 mg/mL), NBT (nitrob-ue tetrazolium 0.30 mg/mL), Tris (100 mM) and MgCl2 (5 mM), pH

9.5. The reaction was stopped by washing the membranes severaltimes with ultrapure water. Peptides against which the antibodieswere generated served as positive controls, while membranes notexposed to the primary antibody served as negative controls (datanot shown).

Data analysis

For real-time q-PCR analysis, the samples were randomlyassigned in blocks, and the relative expression levels (2−��Ct) weresubjected to the Shapiro–Wilk normality test using the univari-ate analytical procedure of the SAS 9.0 software package (SAS,Cary, NC, USA). The relative expression levels were logarithmicallytransformed (log10(X + 1) for normal distribution adjustment. Log-transformed relative expression levels were evaluated using posthoc test following one-way ANOVA. Differences amongst groupswere considered significant when P < 0.05.

Results

mRNA expression of AQP3

The levels of AQP3 mRNA expression were quantified in sheepfollicles at different developmental stages (primordial, primary,secondary, small and large antral) qPCR (Fig. 1). In antral follicles,AQP3 mRNA expression was detected in both small and large folli-cles. Unlike in antral follicles, in the preantral follicles (primordial,primary and secondary) mRNA expression was not detected.

Immunolocalization of AQP3

The immunolocalization of AQP3 protein was analyzed in cor-tical sections of the sheep ovary using immunohistochemical

lization of Aquaporin 3 (AQP3) in folliculogenesis of ewes. Acta

Fig. 1. The expression of Aquaporin 3 (AQP3) mRNA in ovine ovarian follicles. Theexpression of AQP3 mRNA was normalized to GAPDH and the relative expressionwas presented as mean ± SD. Differences amongst groups were considered signifi-cant when P < 0.05.

ARTICLE IN PRESSG ModelACTHIS-50831; No. of Pages 7

4 A.D. Sales et al. / Acta Histochemica xxx (2014) xxx–xxx

Table 2Relative intensity of immunohistochemical staining for aquaporin 3 (AQP3) in ovine ovarian follicles.

Primordial follicles Primary follicles Secundary follicles Antral follicles

Stromal cells − − − −Oocyte cytoplasm +++ +++ ++ +++Oocyte nucleus − − − −Granulosa cytoplasm + + ++ +++Granulosa nucleus − − − −Theca cells NA NA − +

(NA) not applicable, (−) absent; (+) weak; (++) moderate; (+++) strong immunostaining.

Fig. 2. Imunolocalization of Aquaporin 3 (AQP3) in sheep ovarian sections: (A) primordial follicle, (B) primary follicle, (C) secondary follicle, (D) antral follicle, (E) negativec ns: Oo, oocyte, N, nucleus; Nu, nucleolus; GC, granulosa cells; TC, theca cells. Red arrowsi re legend, the reader is referred to the web version of the article.)

(ttiesf

isc

W

fiia

D

astc

ontrol (no staining), (F) positive control (collecting ducts of rat kidney). Abbreviationdicate staining for AQP3. (For interpretation of the references to color in this figu

Fig. 2D), and moderate staining in secondary follicles (Fig. 2C). Inhe cytoplasm of granulosa cells, a strong staining was observed inhe antral follicles (Fig. 2D), whereas a weak staining was observedn the primordial (Fig. 2A) and primary follicles (Fig. 2B), and mod-rate staining in the secondary follicles (Fig. 2C). In addition, a weaktaining was observed in the cytoplasm of theca cells of the antralollicles (Fig. 2D).

In the positive controls, the reactivity of AQP3 was observedn the apical and basolateral membrane of collecting duct cells ofheep kidneys (Fig. 2F). No staining was observed in the negativeontrols (Fig. 2E).

estern blot

The presence of AQP3 protein in sheep ovarian tissue was con-rmed by Western blot (Fig. 3). A faint band (28 kDa) and a more

ntense band (50 kDa) were detected in tissue samples from allnimals.

iscussion

The present study evaluated for the first time the localization

Please cite this article in press as: Sales AD, et al. Expression and localization of Aquaporin 3 (AQP3) in folliculogenesis of ewes. ActaHistochemica (2014), http://dx.doi.org/10.1016/j.acthis.2014.02.001

nd expression of AQP3, a member of the aquaporin family, in theheep ovary. AQP3 mRNA expression was detected by qPCR only inhe antral follicles, whereas the protein localized by immunohisto-hemistry was detected in different compartments of the follicle in

Fig. 3. Detection of Aquaporin 3 (AQP3) protein in ovine ovarian follicles usingWestern blot. Positive AQP3 protein band is expressed at faint band 28 kDa andband intensity is greater in 50 kDa. The numbers 1–5 refer to samples from fivedifferent ewes.

ING ModelA

tochem

ai

plAtcmattimddSct

ttiAtflet

imwraMwasfl

dwitcmI

pmraeossoototsse2l

ARTICLECTHIS-50831; No. of Pages 7

A.D. Sales et al. / Acta His

ll developmental stages, suggesting a possible role of aquaporinn folliculogenesis of ewes.

Although immunolocalization indicated the presence of thisrotein in the oocyte and granulosa cell cytoplasm of preantral fol-

icles (primordial, primary, and secondary), no detectable levels ofQP3 mRNA were identified by qPCR in these follicles. Since the

ranscriptional and translational processes of AQP3 in these folli-les are highly dynamic, it could be hypothesized that all the AQP3RNA is immediately translated, resulting in the inability to detect

nd quantify AQP3 mRNA by qPCR. It is noteworthy that the pro-ein and mRNA levels are determined by the relationships betweenhe rates of the processes of producing and degrading the partic-pating molecules. In mammalian cells, mRNAs are produced at a

uch lower rate than proteins. On average, a mammalian cell pro-uces two copies of a given mRNA per hour, whereas it producesozens of copies of the corresponding protein per mRNA per hour.imilarly, mRNAs are less stable than proteins. Thus, the proteinoncentration may or may not occur in the same proportions toheir relative mRNA levels (Vogel and Marcotte, 2013).

On the other hand, high levels of AQP3 mRNA were detected inhe antral follicle, which is consistent with the strong staining ofhis protein in the oocyte and granulosa cell cytoplasm observedn the immunohistochemical analysis. The increased expression ofQP3 mRNA in the antral follicles may be related to the formation of

he antral cavity, since this protein is responsible for the transport ofuids across the plasma membrane. It is believed that the differentxpression levels of AQP3 to the pre-antral follicles are to maintainhe metabolism of these follicles as they are in a state of quiescence.

Previous evidence suggests that the granulosa cells can facil-tate water transport transcellularly via AQPs. In women, AQP3

RNA expression levels were 5-fold higher in theca cells comparedith the granulosa cells in the pre-ovulatory follicle, suggesting a

ole of this protein in the formation and expansion of the antrumnd follicular rupture during ovulation (Thoroddsen et al., 2011).cConnel et al. (2002) found a reduction in follicular permeabilityhen the follicles were exposed to a solution containing water and

nother containing inulin in the presence of an inhibitor of AQPs,trengthening the functional role of these proteins in regulating theow of water during antral formation.

The presence of the antral cavity is an important aspect in theevelopment of ovarian follicles and requires a rapid and massiveater flow, which is facilitated by the presence of aquaporins. Stud-

es have also shown that AQPs possibly have an additional role inransducing fluid at ovulation. Imaging studies of ovulating folli-les indicate that large volumes of fluid transudate the granulosaembrane and effectively flush the follicle cavity (Rodgers and

rving-Rodgers, 2010).Western blot analysis of AQP3 expression detected a faint

rotein band at approximately 28 kDa, which corresponds toonomers already described in different regions of the female

eproductive system of other species, such as ovary of mice (Lindsaynd Murphy, 2007), uterus, ovary, and oviduct of gilts (Skowronskit al., 2009), endometrium of mares (Klein et al., 2012), and ovaryf women (Thoroddsen et al., 2011). Incubation with tissues inheep placentas were homogenized with AQP3 antibody demon-trated a major band of 43 kDa for the chorion and faint bandsf 28–32 kDa were also observed (Johnston et al., 2000). We alsobserved another 50 kDa band, which we believe correspondso the glycosylated monomers. This glycosylation is commonlybserved in membrane proteins, specifically in aquaporins, wherehis posttranslational modification assists in stabilizing the foldedtructure of the polypeptide chain (Schey et al., 2013). Using the

Please cite this article in press as: Sales AD, et al. Expression and locaHistochemica (2014), http://dx.doi.org/10.1016/j.acthis.2014.02.001

ame technique, similar results (45–48 kDa) were observed in thendometrium of mares, which verified the location of AQPs 0,, and 5 (Klein et al., 2012). Therefore, it is believed that the

arger bands, even under reducing conditions (denaturation of the

PRESSica xxx (2014) xxx–xxx 5

protein), are observed presumably due to their high hydrophobicity(Van Hoek et al., 1995). Another possibility is that the protein maynot have been completely dissociated in the sample buffer beforethe analysis (Maeda et al., 2008).

In the current study, the presence of AQP3 was observed in allstages of follicular development by immunohistochemistry, includ-ing oocyte and granulosa cells, as well as in theca cells of antralfollicles. According to other studies, AQP3 is in immature andin vitro matured mouse oocytes. Jo et al. (2010) found fluctuatinglevels of Aqp3 mRNA in immature oocytes primed by gonadotropin(eCG) for 24 and 48 h. This result suggests that levels of Aqp3 mRNAare altered during development of immature oocytes and AQP3 iscertainly needed for acquisition of immature oocytes full growingpotential within antral follicles. Corroborating our results, theseresearchers reported that the presence of AQP3 is related to a quickand massive transport of water during antral expansion. Thus, asdescribed by these authors, the increase of AQP3 expression dur-ing follicular development might represent cytoplasmic maturityin more competent immature oocytes. In the present work, AQP3protein and mRNA are strongly present in the oocyte and granulosacells of sheep antral follicles indicating their role in the acquisitionof competence for oocyte development in sheep.

Oocyte-expressed genes are not only important for folliculargrowth and development, but are also crucial for early embryo-genesis. During the initial cleavage postfertilization divisions,embryonic development is supported by maternal mRNAs and pro-teins synthesized and stored during oogenesis (Yao et al., 2004).After fertilization, the embryonic genome becomes transcription-ally active and begins to contribute to the early developmentprocess. In different species the onset of transcription, in otherwords, the embryonic genome activation, begins during differentembryonic stages. In mice, it begins during the 2-cell stage, it beginsduring the 4-cell stage in humans, rats, and pigs and during the 8-cell to 16-cell stage in cattle and sheep (Whitworth et al., 2004).Therefore, the levels of mRNA transcripts of AQP3 detected in thesmall and large antral follicles of sheep may also be part of the com-ponents stored in the oocyte, with blastocoel formation essentialfor the preimplantation embryo development, with some aquapor-ins involved in this cavitation process. Besides this, previously workdemonstrated AQP3 genes in the placenta of ewes, which may beresponsible for maternal–fetal fluid exchange and amniotic fluidbalance (Liu et al., 2004). Other studies reported AQP3, functioningboth as a water and urea channel, and expressed in the trophoblastepithelial cells, as the major AQP, which increases throughout ges-tation, and is quantitatively the most highly expressed AQP gene inthe ovine placenta (Johnston et al., 2000). The results demonstratedin our current work and previous studies highlight the role of AQP3in oogenesis, folliculogenesis and the embryonic development inewes.

In cryopreserved bovine blastocysts, low expression levels ofAQP3 have been correlated with a low viability after warming(Camargo et al., 2011). Yamaji et al. (2011) noted that oocytes offemale mice that expressed AQP3 increased tolerance to cryop-reservation, moreover, these authors obtained the first time thebirth of live offspring from vitrified oocytes that expressed AQP3.In gilts and cows, the expression of AQPs 1 and 5 was observed inthe granulosa cells of primordial follicles (Mobasheri et al., 2008;Skowronski et al., 2009). In cows, AQP3 and 4 were localized inthe oocyte of antral follicles and stroma, respectively. These stud-ies indicate that these AQPs influence both the transport betweenthe stroma and endothelium, as well as follicular development(Mobasheri et al., 2008). In gilts, an evaluation of the expression

lization of Aquaporin 3 (AQP3) in folliculogenesis of ewes. Acta

of AQP1 in all phases of the estrous cycle indicated a higher expres-sion of this protein in the ovarian vascular complex during the lutealphase, which suggests that this increased expression is directlylinked to high levels of progesterone, and possible involvement

ING ModelA

6 tochem

i(

d(tpw

ctdphitf

A

t4tCsD

R

A

A

B

B

C

C

C

G

G

H

H

J

ARTICLECTHIS-50831; No. of Pages 7

A.D. Sales et al. / Acta His

n the exchange of fluids between the tissue and interstitial fluidSkowronski et al., 2011).

In rats, in all follicle categories the presence the AQP5 wasetected as a fluorescent ring encircling the oocyte membraneStarowicz et al., 2013). In our study, the strong presence of this pro-ein in the somatic cells of the follicle suggests that AQP3 activelyarticipates in the flow of water to facilitate antrum formation asell as in the metabolism of preantral follicles in the ovary of sheep.

In conclusion, the present study provides the first report indi-ating the presence of AQP3 mRNA and protein in sheep ovarianissue, suggesting that AQP3 may influence the control of follicularevelopment in this species. In addition, the confirmation of theresence of this aquaglyceroporin in the follicular structure mayelp improve currently established cryopreservation procedures

n order to facilitate an increased survival rate and reduced sensi-ivity of the oocytes in this species. Further research to confirm theunctionality of AQP3 in the sheep ovary is needed.

cknowledgments

This research was supported by the National Council for Scien-ific and Technological Development (CNPq, Brazil, grant number:75628/2011-0). Antonia Debora Sales is a recipient of a grant fromhe Foundation for Scientific and Technological Development ofeara (FUNCAP). Ana Paula R Rodrigues and José R. Figueiredo areupported by a grant from CNPq. The authors are very grateful tor. Giovanna Q. Rodrigues by English assitence.

eferences

gre P, Preston GM, Smith BL, Jung JS, Raina S, Moon C, et al.Aquaporin CHIP: the archetypal molecular water channel. AmJ Physiol 1993;265:F463–76.

morim CA, Lucci CM, Rodrigues APR, Carvalho FC, FigueiredoJR, Rondina D, et al. Quantitative and qualitative analysisof the effectiveness of a mechanical method for the isola-tion of preantral follicles from ovine ovaries. Theriogenology2000;53:1251–62.

artlewski PM, Baby TE, Giffin JL. Reproductive cycles in sheep.Anim Reprod Sci 2011;124:259–68.

radford MM. A rapid and sensitive method for the quantitationof microgram quantities of protein utilizing the principle ofprotein-dye binding. Anal Biochem 1976;72:248–54.

ahill LP, Mauleon P. Influences of season, cycle and breed onfollicular-growth rates in sheep. J Reprod Fertil 1980;58:321–8.

amargo LSA, Boite MC, Viana SW, Mota GB, Serapiao RV, Sa WF,et al. Osmotic challenge and expression of aquaporin 3 and Na/KATPase genes in bovine embryos produced in vitro. Cryobiology2011;63:256–62.

ampos-Chillòn LF, Walker DJ, Torre-Sanchez JF, Seidel GE Jr.In vitro assessment of a direct transfer vitrification procedurefor bovine embryos. Theriogenology 2006;65:1200–14.

osden RG, Baird DT, Wade JC, Webb R. Restoration of fertility tooophorectomized sheep by ovarian autografts stored at −196 ◦C.Hum Reprod 1994;9:597–603.

ougeon A. Dynamics of follicular-growth in the human – a modelfrom preliminary results. Hum Reprod 1986;1:81–7.

eller KB, Lin EC, Wilson TH. Substrate specificity and transportproperties of the glycerol facilitator of Escherichia coli. J Bacteriol1980;144:274–8.

Please cite this article in press as: Sales AD, et al. Expression and locaHistochemica (2014), http://dx.doi.org/10.1016/j.acthis.2014.02.001

ub JS, DeGroot BL. Mechanism of selectivity in aquaporins andaquaglyceroporins. Proc Natl Acad Sci USA 2008;105:1198–203.

ablonski EM, McConnell NA, Hughes FM Jr, Huet-Hudson YM.Estrogen regulation of aquaporins in the mouse uterus:

PRESSica xxx (2014) xxx–xxx

potential roles in uterine water movement. Biol Reprod2003;69:1481–7.

Jin B, Kawai Y, Hara T, Takeda S, Seki S, Nakata Y, et al. Pathway forthe movement of water and cryoprotectants in bovine oocytesand embryos. Biol Reprod 2011;85:834–7.

Jo JW, Jee BC, Suh CS, Kim SH, Choi YM, Kim JG, et al. Effect of matu-ration on the expression of aquaporin 3 in mouse oocyte. Zygote2010;19:9–14.

Johnston H, Koukoulas I, Jeyaseelan K, Armugam A, Earnest L, BairdR, et al. Ontogeny of aquaporins 1 and 3 in ovine placenta andfetal membranes. Placenta 2000;21:88–99.

Klein C, Troedsson MH, Rutllant J. Expression of aquaporin waterchannels in equine endometrium is differentially regulated dur-ing the oestrous cycle and early pregnancy. Reprod DomestAnim 2012;48:529–37.

Li XJ, Yu HM, Koide SS. Regulation of water channel gene (AQP-CHIP) expression by estradiol and anordiol in rat uterus. ActaPharm Sinica 1997;32:586–92.

Lindsay LA, Murphy CR. Aquaporins are upregulated in glandularepithelium at the time of implantation in the rat. J Mol Histol2007;38:87–95.

Liu H, Koukoulas I, Ross MC, Wang S, Wintour EM. Quantitativecomparison of placental expression of three aquaporin genes.Placenta 2004;25:475–8.

Livak KJ, Schmittgen TD. Analysis of relative gene expression datausing real-time quantitative PCR and the 2−��Ct method. Meth-ods 2001;25:402–8.

Luz VB, Santos RR, Araujo VR, Celestino JJH, Magalhaes-Padilha DM,Chaves RN, et al. The effect of LIF in the absence or presence ofFSH on the in vitro development of isolated caprine preantralfollicles. Reprod Dom Anim 2012;47:379–84.

Maeda S, Kuwahara S, Ito I, Tanaka K, Hayakawa T, Seki M.Expression and localization of aquaporins in the kidney of themusk shrew (Suncus murinus). J Histochem Cytochem 2008;56:67–75.

McConnel NA, Yunus RS, Gross SA, Bost KL, Clemens MG, Hughes FMJr. Water permeability of an ovarian antral follicle is predomi-nantly transcellular and mediated by aquaporins. Endocrinology2002;143:2905–12.

Meng QX, Gao HJ, Xu CM, Dong MY, Sheng JZ, Huang HF. Reducedexpression and function of aquaporin-3 in mouse metaphase-IIoocytes induced by controlled ovarian hyperstimulation wereassociated with subsequent low fertilization rate. Cell PhysiolBiochem 2008;2:23–128.

Mobasheri A, Sawran A, Marples D, Luck M. Aquaporin water chan-nels in the bovine ovary. FASEB J 2008;22, 1159.19.

Oktay K, Karlikaya GG, Aydin BA. Ovarian cryopreservationand transplantation: basic aspects. Mol Cell Endocrinol2000;169:105–8.

Preston GM, Carroll TP, Guggino WB, Agre P. Appearance of waterchannels in Xenopus oocytes expressing red cell CHIP28 protein.Science 1992;256:385–7.

Richard C, Gao J, Brown N, Reese J. Aquaporin water channel genesare differentially expressed and regulated by ovarian steroidsduring the periimplantation period in the mouse. Endocrinology2003;144:1533–41.

Rodgers RJ, Irving-Rodgers HF. Formation of the ovarian follicularantrum and follicular fluid. Biol Reprod 2010;82:1021–9.

Salle B, Demirci B, Franck M, Rudigoz RC, Guerin JF, Lornage J. Nor-mal pregnancies and live births after autograft of frozen-thawedhemi-ovaries into ewes. Fertil Steril 2002;77:403–8.

Schey KL, Grey AC, Nicklay JJ. Mass spectrometry of mem-brane proteins: a focus on aquaporins. Biochemistry 2013;52:

lization of Aquaporin 3 (AQP3) in folliculogenesis of ewes. Acta

3807–17.Skowronski MT, Frackowia KL, Skowronsk A. Expression of aqua-

porin 1 in the pig peri-ovarian vascular complex during

ING ModelA

tochem

S

S

T

V

V

ARTICLECTHIS-50831; No. of Pages 7

A.D. Sales et al. / Acta His

the estrous cycle and early pregnancy. Reprod Biol 2011;11:210–23.

kowronski MT, Kwon TH, Nielsen S. Immunolocalization of aqua-porin 1, 5, and 9 in the female pig reproductive system. JHistochem Cytochem 2009;57:61–7.

tarowicz A, Grzesiak M, Mobasherib A, Szoltys M. Immunolocal-ization of aquaporin 5 during rat ovarian follicle developmentand expansion of the preovulatory cumulus oophorus. Acta His-tochem 2013 [in press].

horoddsen A, Dahm-Kahler P, Lind AK, Weijdegard B, Lindenthal B,Muller J, et al. The water permeability channels aquaporins 1–4are differentially expressed in granulosa and theca cells of thepreovulatory follicle during precise stages of human ovulation.J Clin Endocrinol Metab 2011;96:1021–8.

an Hoek AN, Wiener MC, Verbavatz JM, Brown D, Lipniunas PH,Townsend RR, et al. Purification and structure-function analysisof native, PNGase F-treated, and endo-beta-galactosidase-

Please cite this article in press as: Sales AD, et al. Expression and locaHistochemica (2014), http://dx.doi.org/10.1016/j.acthis.2014.02.001

treated CHIP28 water channels. Biochemistry 1995;34:2212–9.ogel C, Marcotte EM. Insights into the regulation of protein abun-

dance from proteomic and transcriptomic analyses. Nat RevGenet 2013;13:227–32.

PRESSica xxx (2014) xxx–xxx 7

Whitworth K, Springer GK, Forrester LJ, Spollen WG, Ries J, Lamber-son WR, et al. Developmental expression of 2489 gene clustersduring pig embryogenesis: an expressed tag project sequence.Biol Reprod 2004;71:1230–43.

Yamaji Y, Seki S, Matsukawa K, Koshimoto C, Kasai M, EdashigeK. Developmental ability of vitrified mouse oocytes expressingwater channels. J Reprod Dev 2011;57:403–8.

Yao J, Ren X, Ireland JJ, Coussens PM, Smith TP, Smith GW. Genera-tion of a bovine oocyte cDNA library and microarray: resourcesfor identification of genes important for follicular developmentand early embryogenesis. Physiol Genomics 2004;19:84–92.

Yasui M, Kwon TH, Knepper MA, Nielsen S, Agre P. Aquaporin-6:an intracellular vesicle water channel protein in renal epithelia.Proc Natl Acad Sci USA 1999;96:5808–13.

Zhang D, Tan YJ, Qu F, Sheng JZ, Huang HF. Functionsof water channels in male and female reproduc-tive systems. Mol Aspects Med 2012;33:676–90,

lization of Aquaporin 3 (AQP3) in folliculogenesis of ewes. Acta

http://dx.doi.org/10.1016/j.mam.2012.02.002.Zhang H, Zhang Y, Zhao H, Zhang Y, Chen Q, Peng H, et al. Hormonal

regulation of ovarian bursa fluid in mice and involvement ofaquaporins. PLOS ONE 2013;8(5):e63823.