Exon Table

1

description

טבלת האקסונים של גן הדיסטרופין

Transcript of Exon Table

Page 1: Exon Table

DECONVOLUTING BAC–GENE RELATIONSHIPS USING A ...stelo/papers/jbcb08.pdfGenes Unigenes exon intron probe Unigene Chromosome exon intron exon BACs BACs contig contig Fig. 1. An illustration

DECONVOLUTING BAC–GENE RELATIONSHIPS USING A ...stelo/papers/jbcb08.pdfGenes Unigenes exon intron probe Unigene Chromosome exon intron exon BACs BACs contig contig Fig. 1. An illustration

CRISPR/Cas9-mediated genome editing induces exon skipping ... · HeLa cells can cause skipping of exon 3, exon 4, or exons 3, 4, and 5 [18]. We also detected infrequent exon skipping

CRISPR/Cas9-mediated genome editing induces exon skipping ... · HeLa cells can cause skipping of exon 3, exon 4, or exons 3, 4, and 5 [18]. We also detected infrequent exon skipping

The Exon-Florio Amendment - PIIE

The Exon-Florio Amendment - PIIE

CircularRNAs from transcripts rat cytochrome P4502C24 gene ... · exon 1 FIG. 2. (a) Agarose gel electro-phoresis ofPCRamplification products using an exon 1 sense and an exon 9 exon5

CircularRNAs from transcripts rat cytochrome P4502C24 gene ... · exon 1 FIG. 2. (a) Agarose gel electro-phoresis ofPCRamplification products using an exon 1 sense and an exon 9 exon5

Response Heterogeneity of EGFR and HER2 Exon 20 Insertions to … · exon 20 mutations were identified (Table 1). The most common mutation resulted in a duplication of codon 772

Response Heterogeneity of EGFR and HER2 Exon 20 Insertions to … · exon 20 mutations were identified (Table 1). The most common mutation resulted in a duplication of codon 772

Posters final - Home - The Exon Singers The Exon Singers · SATURDAY 2 AUGUST, 7.30pm FESTIVAL FINALE GLORIA Baroque masterpieces include Bach's Jesu, meine Freude with he Exon Vivaldi's

Posters final - Home - The Exon Singers The Exon Singers · SATURDAY 2 AUGUST, 7.30pm FESTIVAL FINALE GLORIA Baroque masterpieces include Bach's Jesu, meine Freude with he Exon Vivaldi's

74354267 Exon Mobile Drilling Guide

74354267 Exon Mobile Drilling Guide

Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR.

Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR.

PowerPoint Presentation · Retinoblastoma WT QRX-421 Exon 12 Exon 13 Exon 14 Exon 12 Exon 14 In-frame Exon 11 Exon 14 Out of-frame No AON QRX-421 Exon 12 Exon 13 Exon 14 Erwin van

PowerPoint Presentation · Retinoblastoma WT QRX-421 Exon 12 Exon 13 Exon 14 Exon 12 Exon 14 In-frame Exon 11 Exon 14 Out of-frame No AON QRX-421 Exon 12 Exon 13 Exon 14 Erwin van

Exon Mobile Drilling Guide

Exon Mobile Drilling Guide

Chapter 15mmsalemscienceteacher.weebly.com/uploads/2/3/3/6/... · 2018. 9. 9. · Exon 1 Intron Exon 2 Branch point A snRNA Exon 1 Exon 2 Lariat 5′ 5′ 3′ 3′ 5′ 5′ 3′

Chapter 15mmsalemscienceteacher.weebly.com/uploads/2/3/3/6/... · 2018. 9. 9. · Exon 1 Intron Exon 2 Branch point A snRNA Exon 1 Exon 2 Lariat 5′ 5′ 3′ 3′ 5′ 5′ 3′

Establishment exon- trapping - Fordham University

Establishment exon- trapping - Fordham University

Grupo 5. 5’site 3’site branchpoint site exon 1 intron 1 exon 2 intron 2 AG/GT CAG/NT.

Grupo 5. 5’site 3’site branchpoint site exon 1 intron 1 exon 2 intron 2 AG/GT CAG/NT.

Infantile Epilepsy Panel, Sequence Analysis and Exon ...

Infantile Epilepsy Panel, Sequence Analysis and Exon ...

Exon Autumn 2010

Exon Autumn 2010

Table of Contents - gffcc.orggffcc.org/journal/docs/issue24/pp43-47_M.Alam.pdf · Table of Contents Original articles ... detection Mutations of JaK2 exon 12 in Patients with JaK2

Table of Contents - gffcc.orggffcc.org/journal/docs/issue24/pp43-47_M.Alam.pdf · Table of Contents Original articles ... detection Mutations of JaK2 exon 12 in Patients with JaK2

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.

Dysferlin-Exon-42-deletion in pUC57-Kan 8545 bp€¦ · Dysferlin-Exon-42-deletion_in_pUC57-Kan 5' gcctgccgctggcctccaccactcagtacagccgtgcagtctttgacgggtgccactactactacctacc Dysferlin-Exon-42-deletion

Dysferlin-Exon-42-deletion in pUC57-Kan 8545 bp€¦ · Dysferlin-Exon-42-deletion_in_pUC57-Kan 5' gcctgccgctggcctccaccactcagtacagccgtgcagtctttgacgggtgccactactactacctacc Dysferlin-Exon-42-deletion

Exon mobil new

Exon mobil new

DEFECTIVE(EXON(RECOGNITION( …library/doktorati/genetika/4Alanis.pdf · 2011. 10. 26. · 2.3.2.*Effect*of*modified*U1*snRNAs*on*FIX*exon*5*splicing**61 Section*2.4.!Effect!of!Exon!Specific!U1!snRNAs!(ExSpeU1s)!on!CFTR!exon!

DEFECTIVE(EXON(RECOGNITION( …library/doktorati/genetika/4Alanis.pdf · 2011. 10. 26. · 2.3.2.*Effect*of*modified*U1*snRNAs*on*FIX*exon*5*splicing**61 Section*2.4.!Effect!of!Exon!Specific!U1!snRNAs!(ExSpeU1s)!on!CFTR!exon!