Exon circularization in mammalian nuclear extracts

8

Transcript of Exon circularization in mammalian nuclear extracts

Page 1: Exon circularization in mammalian nuclear extracts
Page 2: Exon circularization in mammalian nuclear extracts
Page 3: Exon circularization in mammalian nuclear extracts
Page 4: Exon circularization in mammalian nuclear extracts
Page 5: Exon circularization in mammalian nuclear extracts
Page 6: Exon circularization in mammalian nuclear extracts
Page 7: Exon circularization in mammalian nuclear extracts
Page 8: Exon circularization in mammalian nuclear extracts

The Exon-Florio Amendment - PIIE

The Exon-Florio Amendment - PIIE

Exon Mobil Mock Case

Exon Mobil Mock Case

Rfa Exon Dairy

Rfa Exon Dairy

Exon Autumn 2010

Exon Autumn 2010

Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR.

Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR.

Exon-Mobile Drilling Guide

Exon-Mobile Drilling Guide

Posters final - Home - The Exon Singers The Exon Singers · SATURDAY 2 AUGUST, 7.30pm FESTIVAL FINALE GLORIA Baroque masterpieces include Bach's Jesu, meine Freude with he Exon Vivaldi's

Posters final - Home - The Exon Singers The Exon Singers · SATURDAY 2 AUGUST, 7.30pm FESTIVAL FINALE GLORIA Baroque masterpieces include Bach's Jesu, meine Freude with he Exon Vivaldi's

PowerPoint Presentation · Retinoblastoma WT QRX-421 Exon 12 Exon 13 Exon 14 Exon 12 Exon 14 In-frame Exon 11 Exon 14 Out of-frame No AON QRX-421 Exon 12 Exon 13 Exon 14 Erwin van

PowerPoint Presentation · Retinoblastoma WT QRX-421 Exon 12 Exon 13 Exon 14 Exon 12 Exon 14 In-frame Exon 11 Exon 14 Out of-frame No AON QRX-421 Exon 12 Exon 13 Exon 14 Erwin van

Plant and Mammalian Tissue Culture Mammalian Cell Culture.

Plant and Mammalian Tissue Culture Mammalian Cell Culture.

4: Genome evolution. Exon Shuffling 3 types of exon shuffling exon duplication = the duplication of one or more exons within a gene (internal duplication)

4: Genome evolution. Exon Shuffling 3 types of exon shuffling exon duplication = the duplication of one or more exons within a gene (internal duplication)

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.

Exon Mobile Drilling Guide

Exon Mobile Drilling Guide

Chapter 15mmsalemscienceteacher.weebly.com/uploads/2/3/3/6/... · 2018. 9. 9. · Exon 1 Intron Exon 2 Branch point A snRNA Exon 1 Exon 2 Lariat 5′ 5′ 3′ 3′ 5′ 5′ 3′

Chapter 15mmsalemscienceteacher.weebly.com/uploads/2/3/3/6/... · 2018. 9. 9. · Exon 1 Intron Exon 2 Branch point A snRNA Exon 1 Exon 2 Lariat 5′ 5′ 3′ 3′ 5′ 5′ 3′

CYP2D6 Variation v1 - PharmVarintron 1, exon 2, intron 2-exon 3, intron 4, exon 5, exon 7-intron 8, intron 7, exon 9 none Panserat et al. 1995 Gaedigk et al. 2010 Gaedigk et al, 2010

CYP2D6 Variation v1 - PharmVarintron 1, exon 2, intron 2-exon 3, intron 4, exon 5, exon 7-intron 8, intron 7, exon 9 none Panserat et al. 1995 Gaedigk et al. 2010 Gaedigk et al, 2010

Intron correlations evolution intron/exon

Intron correlations evolution intron/exon

DECONVOLUTING BAC–GENE RELATIONSHIPS USING A ...stelo/papers/jbcb08.pdfGenes Unigenes exon intron probe Unigene Chromosome exon intron exon BACs BACs contig contig Fig. 1. An illustration

DECONVOLUTING BAC–GENE RELATIONSHIPS USING A ...stelo/papers/jbcb08.pdfGenes Unigenes exon intron probe Unigene Chromosome exon intron exon BACs BACs contig contig Fig. 1. An illustration

Identification of NURR1 (Exon 4) and FOXA1 (Exon 3 ...Parkinson’sDisease 5 100 400 300 200 MNURR1 exon 4 (1) M 349bp (a) 100 200 400 300 500 M NURR1 exon 4 (2) 416bp (b) 100 200

Identification of NURR1 (Exon 4) and FOXA1 (Exon 3 ...Parkinson’sDisease 5 100 400 300 200 MNURR1 exon 4 (1) M 349bp (a) 100 200 400 300 500 M NURR1 exon 4 (2) 416bp (b) 100 200

1 exon 2 exon - Nature · exon 1 p.Arg10Lysfs*60 ... In contrast to control patients with non‐NPHS2 associated glomerulopathies (C1 ... Microsoft Word - Tory-Supplementary data-jav.docx

1 exon 2 exon - Nature · exon 1 p.Arg10Lysfs*60 ... In contrast to control patients with non‐NPHS2 associated glomerulopathies (C1 ... Microsoft Word - Tory-Supplementary data-jav.docx

Research Article A New Exon Derived from a Mammalian ...downloads.hindawi.com/journals/ijg/2013/387594.pdf · ampli ed with a primer pair consisting of GPH-S ( -GAG-CCCCAGCCTTCTCCATG-

Research Article A New Exon Derived from a Mammalian ...downloads.hindawi.com/journals/ijg/2013/387594.pdf · ampli ed with a primer pair consisting of GPH-S ( -GAG-CCCCAGCCTTCTCCATG-

Hepatocellular Carcinoma - Exon Publications

Hepatocellular Carcinoma - Exon Publications