Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

31
Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution

Transcript of Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Page 1: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Evidence of Evolution

Exploring Various Lines of Evidence for the Theory of

Evolution

Page 2: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Lines of Evidence

• DNA Sequences

• Comparative Anatomy

• Embryology

• Transitional Fossils

• Biogeography

• “Genetic Tool Kit”

Page 3: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

DNA Sequences

• Scientists are able to isolate pieces of DNA and determine the actual sequence of nucleotides

• Species that are more closely related tend to have more similarities in their DNA

Page 4: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

DNA Sequences

• Leptin = protein hormone that is important for regulating body weight and metabolism

• Mice without properly functioning leptin gene are morbidly obese (right) compared to normal mice (left)

Leptin protein

Page 5: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

DNA Sequences

• Compare actual sequences of DNA (leptin gene) between three different species= human, chimpanzee, mouse

• Predictions: how much similarity will there be? Who will be most closely related?

Page 6: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

DNA Sequences

• First 60 nucleotides:Human: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct

Chimp: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct

Mouse: gaggga tcc ctgctccagc agctgcaagg taaggcccggggcgcgctact ttctcctcca

(Mouse sequence has been shifted to line up as much as possible.)

REMEMBER: Mutations can arise in the DNA sequence in a variety of forms, including nucleotide replacement, insertion, deletion, sequence inversion, etc.

Page 7: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

DNA Sequences

• Nucleotides 121-180:Human: agtcaggagg gatgcagggc ggatggctta gttctggact atgatagctt tgtaccgagt

Chimp: agtcaggagg gaggcagggc ggatggctta gttctggact atgatagctt tgtaccgagt

Mouse: aggtcatgtg gacagcttgg tgttgaattc agtagttttg cagcgaggga ctctgcagac

Note how the mouse sequence compares, after so many mutations have accumulated.

REMEMBER: Mutations can arise in the DNA sequence in a variety of forms, including nucleotide replacement, insertion, deletion, sequence inversion, etc.

(Human and Chimp sequences are identical between nucleotides 61-120.)

Page 8: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Comparative AnatomySimilarities in structures

between species suggest they descended from a common ancestor.

Note the color-coded bones for the limbs of these 4 mammals – though different, they share many similar bones. Describe the function of each animal’s limb on your handout.

Page 9: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

• http://www.eskeletons.org/

• Click “Comparative Anatomy” link

• Compare: human, chimpanzee, and squirrel monkey

• Predictions: Who would be the most similar and why? What similarities and differences might you expect?

• Follow the directions on your handout!

Comparative Anatomy

Page 10: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Embryology

Ernst von Baer (1828): the more closely related any two species are, the more similar their development as embryos.

In this game, you will look at pictures of embryos and guess what animal it is.

Is it a snake, chicken, possum, cat, bat or human?

Write your guess down on your handout, before you look at the answer!

Page 11: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Embryology

Snake!Are you sure that’s your prediction?

Page 12: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Embryology

Bat!Are you sure that’s your prediction?

Page 13: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Embryology

Cat!Are you sure that’s your prediction?

Page 14: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Embryology

Chicken!Are you sure that’s your prediction?

Page 15: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Embryology

Human!Are you sure that’s your prediction?

Page 16: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Embryology

Possum!Are you sure that’s your prediction?

Page 17: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.
Page 18: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Biogeography

• Marsupial distribution across the globe: http://evolution.berkeley.edu/evolibrary/article/0_0_0/lines_11

• Distribution today split on two sides of globe – how?

• Review a few facts of the distribution and marsupials, as well as the history of the Earth, then formulate hypothesis behind distribution

Biogeography is the study of the large-scale or global pattern of distribution of species, including the history and causes of this distribution.

For this activity, you will explore the history and cause behind the distribution of marsupials.

Page 19: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Biogeography

• Marsupial distribution across the globe: http://evolution.berkeley.edu/evolibrary/article/0_0_0/lines_11

• Distribution today split on two sides of globe – how?

• Review a few facts of the distribution and marsupials, as well as the history of the Earth, then formulate hypothesis behind distribution

Marsupials are a group of mammals that give birth to live young that develop in an outer pouch of the mother.

Koala

KangarooSugar Glider

Opossum

Bandicoot

Page 20: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Biogeography

There is no evidence of any marsupials able to swim across the ocean. No marsupial has been observed wandering across the Asian mainland. There does not appear to be any route of migration between the two populations of marsupials. How do you think some marsupials ended up halfway across the world from the others?

Page 21: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Biogeography

Continental Drift over millions of years – watch the movement of land masses

Page 22: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Biogeography

Continental Drift + Distribution of Marsupials

Page 23: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Biogeography

Similar reptilian Mesosaurus fossils found in both South America and Africa evidence of continental drift

(couldn’t swim the ocean, no land bridge continents once joined)

Page 24: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Biogeography

Similar reptilian Mesosaurus fossils found in both South America and Africa (couldn’t swim the ocean, no land bridge)

evidence of continental drift (continents once joined)

Page 25: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Transitional Fossils

• Archaeopteryx fossils: multiple specimen found in limestone in Germany

Page 26: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Archaeopteryx: Berlin specimen

Page 27: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Archaeopteryx: Eichstatt specimen

Page 28: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Archaeopteryx: Solnhofen specimen

Page 29: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Whale Evolution

• Video about the transitional forms in the evolution of whales – mammals evolving from land back to sea

• http://www.pbs.org/wgbh/evolution/library/03/4/l_034_05.html

Page 30: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

“Genetic Tool Kit”

• Video about Homeobox genes and implications for evolution:

• http://www.pbs.org/wgbh/evolution/library/03/4/l_034_04.html

• Answer the questions on your handout

Page 31: Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution.

Eye Evolution

• Video about the evolution of the eye:

• http://www.pbs.org/wgbh/evolution/library/01/1/l_011_01.html

• Answer the questions on your handout