Evaluation of the Therapeutic Potential of Akt Inhibition in a ......dendritic cells and...
Transcript of Evaluation of the Therapeutic Potential of Akt Inhibition in a ......dendritic cells and...
Evaluation of the Therapeutic Potential of Akt Inhibition in
a Translational Model of Histiocytic Sarcoma
Qizhi Qin
Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State
University in partial fulfillment of the requirements for the degree of
Doctor of Philosophy
In
Biomedical and Veterinary Medicine
Nick Dervisis, Chair
Shawna Klahn
Irving C. Allen
Rafael V. Davalos
September 10, 2018
Blacksburg, VA
Keywords: Histiocytic sarcoma, PI3K/Akt signaling, Akt-targeted therapy
Evaluation of the Therapeutic potential of Akt Inhibition in
a Translational Model of Histiocytic Sarcoma
Qizhi Qin
Abstract
Histiocytic sarcoma (HS) is an exceptionally rare malignant neoplasm derived from
dendritic cells and histiocytes, with no available effective treatment options. Akt
signaling and proteasome dysfunction have been implicated in the pathogenesis of the
disease, both in humans and dogs. Our work aims to investigate the importance of the
Akt signaling pathway and evaluate the potential of Akt-targeted therapy in a canine
model of histiocytic sarcoma.
We demonstrated Akt signaling to be active in 9 out of 10 canine HS tumor samples,
regardless the presence of PTEN. Moreover, the Akt signaling pathway appears to be
constitutively active in DH82 cells – a cell line model of canine HS, when compared to
control canine dendritic cells. Pharmacologic Akt inhibition resulted in significant
decrease in Akt S473 phosphorylation, GSK-3β S9 phosphorylation, Akt activity, cell
viability, increased apoptosis, and resulted in sensitization to proteasome inhibition-
depended cell death in a synergistic manner. Proteasome inhibition using carfilzomib,
an irreversible proteasome inhibitor, induced dose-depended/caspase-3 independent
cell death, at clinically relevant drug concentrations. The therapeutic effect of Akt
inhibition was validated in vivo using a DH82 xenograft murine model. Akt inhibition
lead to reduced tumor growth, prolonged overall survival, and ameliorated
splenomegaly, but not affected the lung metastasis. Moreover, the therapeutic effect of
Akt inhibition was potentiated in combination with carfilzomib.
In conclusion, targeting Akt signaling may represent an attractive potential
therapeutic target for the HS. Future studies are required to examine the clinical efficacy
of Akt-targeted therapy in dogs with HS using novel selective Akt inhibitors.
Evaluation of the Therapeutic potential of Akt Inhibition in
a Translational Model of Histiocytic Sarcoma
Qizhi Qin
General Audience Abstract
Histiocytic sarcoma (HS) is an exceptionally rare cancer of the immune system,
with no effective treatment options available. Canine histiocytic sarcoma (cHS) is an
aggressive tumor of the same cellular lineage, identified at increased relative frequency
in specific dog breeds, with significant translational value. Akt signaling and
proteasome dysfunction have been implicated in the pathogenesis of the disease, both
in humans and dogs. Our study aims to investigate the importance of the Akt signaling
pathway in the dog model of the disease and evaluate the potential of Akt-targeted
therapy in a translational of histiocytic sarcoma. The work presented here demonstrates
that Akt signaling appears aberrantly and constitutively activated in the canine model
of HS. Importantly, Akt inhibition significantly reduced the tumor growth and
prolonged the overall survival of the experimental animals. Moreover, Akt inhibition
potentiated the anti-cancer activities of other anticancer drugs. Collectively, these
findings provide an attractive therapeutic approach for the treatment of HS.
v
Acknowledgement
I would like to express my deepest appreciation to my advisor, Dr. Nick Dervisis, for
giving me the opportunity to join his lab. I have always been grateful for his support
and help both in my study and in my life. I can never be thankful enough for his
mentorship and incredible inspiration!
I would like to thank my committee members Dr. Shawna Klahn, Dr. Irving Allen, and
Dr. Rafael Davalos for their support and guidance throughout my time as a graduate
student.
My sincere thanks to my external examiner, Dr. Vilma Yuzbasiyan-Gurkan. Thank you
for coming a long way to Blacksburg to attend my defense!
I would like to thank Melissa Makris for the use of flow cytometry core facility. I also
would like to thank TRACSS staffs for taking care of my experimental mice.
I appreciate the great help from Dr. Sheryl Coutermarsh-Ott and ViTALS staffs for the
high-quality histopathology analysis.
I owe my sincere gratefulness to my wonderful friends in Blacksburg, for their love,
understanding and company in these five years!
Most importantly, I would like to thank my mother Liying Liu, father Jianming Qin
their endless love. I would also like to thank to my beloved girlfriend Yangxi Jiao for
supporting me for everything.
vi
Table of Contents
Abstract .......................................................................................................................... ii
General Audience Abstract ........................................................................................... iv
Acknowledgement ......................................................................................................... v
List of Figures ................................................................................................................ x
List of Tables ................................................................................................................. xi
Abbreviations ............................................................................................................... xii
CHAPTER 1. Introduction ............................................................................................. 1
CHAPTER 2. Literature Review ................................................................................... 4
2.1 Histiocytes ............................................................................................................ 4
2.1.1 Macrophages .................................................................................................. 5
2.1.2 Dendritic cells ................................................................................................ 8
2.1.3 Langerhans cells ........................................................................................... 14
2.2 Histiocytic disorders ........................................................................................... 15
2.2.1 Langerhans cell histiocytosis ....................................................................... 19
2.2.2 Hemophagocytic lymphohistiocytosis ......................................................... 21
2.2.3 Histiocytic sarcoma ...................................................................................... 24
2.2.3.1 Pathology and epidemiology ................................................................. 25
vii
2.2.3.1.a Human ................................................................................................ 25
2.2.3.1.b Canine ................................................................................................. 26
2.2.3.2 Clinical features and diagnosis .............................................................. 27
2.2.3.2.a Human ................................................................................................ 27
2.2.3.2.b Canine ................................................................................................. 28
2.2.3.3 Current approaches to treatment ............................................................ 31
2.2.3.3.a Human ................................................................................................ 31
2.2.3.3.b Canine ................................................................................................. 32
2.3 PI3K/Akt signaling pathway .............................................................................. 33
2.3.1 PI3K/Akt pathway in Health ........................................................................ 33
2.3.2 PI3K/Akt in Cancer ...................................................................................... 35
2.2.2.1 Inhibition of apoptosis ........................................................................... 36
2.3.2.2 Regulation of cell cycle ......................................................................... 38
2.3.2.3 Promotion of angiogenesis .................................................................... 39
2.3.2.4 Enhancement of metastasis ................................................................... 40
2.3.3 PTEN alteration ........................................................................................... 41
2.3.4 Targeting PI3K/Akt signaling pathway in cancer therapy ........................... 42
2.3.4.1 Targeting upstream regulators of Akt .................................................... 42
2.3.4.2 Akt inhibition ......................................................................................... 45
viii
2.3.4.3 Targeting downstream signaling molecules of Akt ............................... 46
CHAPTER 3. Targeting PI3K/Akt Signaling Pathway in Canine Histiocytic Sarcoma
...................................................................................................................................... 48
3.1 Introduction ........................................................................................................ 48
3.2 Material and Methods ......................................................................................... 48
3.2.1 Cell line and culture ..................................................................................... 48
3.2.2 Reagents ....................................................................................................... 49
3.2.3 Cell viability assay ....................................................................................... 50
3.2.4 Flow cytometry ............................................................................................ 50
3.2.5 Serum starvation test .................................................................................... 51
3.2.6 RT-PCR ........................................................................................................ 52
3.2.7 Western blot ................................................................................................. 53
3.2.8 Akt kinase activity assay .............................................................................. 54
3.2.9 Isobologram ................................................................................................. 55
3.2.10 Caspase-3 activity assay ............................................................................ 56
3.2.11 DH82 xenograft mouse model ................................................................... 56
3.2.12 Immunohistochemistry .............................................................................. 57
3.2.13 LY294002 blood level quantification......................................................... 58
3.2.14 Statistical analysis ...................................................................................... 58
ix
3.3 Results ................................................................................................................ 59
3.3.1 Akt signaling is activated in canine HS tumor samples despite the presence
of PTEN ................................................................................................................ 59
3.3.2 Akt signaling is aberrantly activated in DH82 cells ..................................... 61
3.3.3 Inhibition of Akt signaling leads to decreased cell viability in DH82 cells . 64
3.3.4 Inhibition of Akt signaling potentiates carfilzomib-induced apoptotic cell
death in DH82 cells ............................................................................................... 66
3.3.5 Carfilzomib induces apoptosis in DH82 cells via a caspase-3 independent
pathway. ................................................................................................................ 69
3.3.6 LY294002 and carfilzomib are well tolerated in DH82 xenograft mice and
detectable in peripheral blood. .............................................................................. 72
3.3.7 LY294002 inhibits cHS tumor cell growth in vivo. ..................................... 74
3.3.8 LY294002 does not reduce lung metastasis and not increase necrosis in tumor
tissue. .................................................................................................................... 77
3.5 Discussion .......................................................................................................... 79
CHAPTER 4. Conclusion and Future Directions ........................................................ 86
REFERENCES ............................................................................................................ 88
x
List of Figures
Figure 1. Akt activation and PTEN presence in DH82 cells and cHS clinical tumor
samples……………………………………………………………………………….60
Figure 2. Akt signaling is constitutively activated in DH82 cells………………..63
Figure 3. Pharmacological inhibition of PI3K/Akt signaling leads to decreased cell
viability in DH82 cells…………………………………………………….………….65
Figure 4. Inhibition of Akt synergistically potentiates carfilzomib-induced apoptosis in
DH82 cells…………………………………………………………………………68
Figure 5. Carfilzomib not induces caspase-3 activation……………………...………71
Figure 6. The given treatments are well tolerated and LY294002 are absorbed…….....73
Figure 7. LY294002 inhibits tumor growth in xenograft model of cHS……………..76
Figure 8. LY294002 not affects lung metastasis and necrosis in tumor tissues……...78
xi
List of Tables
Table 2.1. Surface markers of human DCs and murine homologs……………………10
Table 2.2. Classification of histiocytic disorders…………………………………….18
Table 2.3. Diagnostic criteria for hemophagocytic lymphohistiocytosis…………….23
Table 2.4. Differential diagnosis of histiocytic sarcoma……………………………..29
Table 2.5. Differential diagnosis of canine histiocytic sarcoma with other histiocytic
disorders……………………………………………………………………………...30
Table 3.1. Primer sequences………………………………………………………….53
Table 3.2. Concentration combinations……………………………...……………….67
Table 3.3. Individual survival in DH82 xenograft mice……………………………...75
xii
Abbreviations
Apaf-1 apoptotic protease activating factor 1
APC antigen-presenting cell
BCR B cell receptor
CCL C-C motif ligand
CCNU N-(2-chloroethyl)-N’-cyclohexyl-N-nitrosourea
CCR C-C chemokine receptor
CD cluster of differentiation
CDK cyclin-dependent kinase
CFU-GM colony forming unit-granulocyte/macrophage
CLEC7A C-type lectin domain family 7 member A
CNS central nervous system
CTL cytotoxic T lymphocyte
DC dendritic cell
ECD Erdheim-Chester disease
EGFR epidermal growth factor receptor
EMT epithelial-mesenchymal transition
eNOS endothelial nitric oxide synthase
FHL familial hemophagocytic lymphohistiocytosis
Flt-3 fms like tyrosine kinase-3
xiii
GM-CSF granulocyte-macrophage colony stimulating factor
GSK3 glycogen synthase kinase 3
HLH hemophagocytic lymphohistiocytosis
HSC hematopoietic stem cell
HSCT hematopoietic stem cell transplantation
HSP heat shock protein
IAHS infection-associated hemophagocytic syndrome
ICAM intercellular adhesion molecule
IFN-γ interferon gamma
IKK IκB kinase
IL interleukin
ILT3 immunoglobulin-like transcript 3
IR incidence rate
IRS1 insulin receptor substrate 1
IκB inhibitor of κB
JXG Juvenile xanthogranuloma
LC Langerhans cell
LCH Langerhans cell histiocytosis
LFA-1 lymphocyte function-associated antigen-1
LPS lipopolysaccharide
MAC-1 macrophage receptor-1
xiv
MAHS malignancy-associated hemophagocytic syndrome
MAS macrophage activation syndrome
Mcl-1 myeloid cell leukemia 1
M-CSF macrophage colony stimulating factor
MDM2 mouse double minute 2
MHC II major histocompatibility complex class II
MMP matrix metalloproteinase
MPS mononuclear phagocyte system
mTOR mammalian target of rapamycin
NF-κB nuclear factor-kappa B
NO nitric oxide
NSCLC non-small-cell lung cancer
PBMC peripheral blood mononuclear cell
PDK1 3-phosphoinositide dependent kinase-1
PD-L1 programmed death ligand-1
PHLPP PH domain leucine-rich repeat protein phosphatase
PI3K phosphoinositide-3-kinase
PIP2 phosphatidylinositol (4, 5)-bisphosphate
PIP3 phosphatidylinositol (3, 4, 5)-trisphosphate
PTEN phosphatase and tensin homolog
RD Rosai-Dorfman disease
xv
RTK receptor tyrosine kinase
SHIP2 SH2 domain-containing 5-inositol phosphatase 2
TAM tumor-associated macrophage
TGF-β ransforming growth factor beta
TKI tyrosine kinase inhibitor
TLR Toll-like receptor
TNF-α tumor necrosis factor alpha
VEGF vascular endothelial growth factor
1
CHAPTER 1
Introduction
Histiocytic disorders represent a group of rare hematological malignancies
characterized by aberrant proliferation and accumulation of histiocytes that include
dendritic cells and macrophages [1]. Among these diseases, histiocytic sarcoma is
extremely rare but aggressive and lethal cancer, demonstrating morphologic and
immunophenotypic characteristics of dendritic cells and account for less than 1% of
neoplasms that affecting the lymphatic and hematopoietic system [2].
Histiocytic sarcoma can manifest itself in various organs such as skin, lymph nodes,
lung, spleen, liver, and central nervous system; affecting over a wide age range from
infant to elderly [3, 4]. The diagnosis of histiocytic sarcoma requires morphologic and
immunophenotypic verification of histiocyte markers on biopsy samples. However, the
rarity of this disease often impedes a timely and definitive diagnosis and contributes to
misdiagnosis as other histiocytic malignancies [5-7]. It has been hypothesized that due
to the difficulty of accurate diagnosis, histiocytic sarcoma often presents at an advanced
clinical stage. Moreover, the delayed diagnosis and rapid clinical course of histiocytic
sarcoma allow for limited responses to conventional chemotherapy. The prognosis of
histiocytic sarcoma is frustrating, and most patients die within two years after diagnosis
[2]. The high mortality rate requires a better understanding of this fatal disease and
more effective treatment approaches.
2
The understanding of histiocytic sarcoma biologic behavior has been hindered by
the rarity of the individual patient and lacking a suitable animal model for histiocytic
sarcoma. However, the spontaneously developed canine tumors can provide us with a
useful model to understand corresponding human cancers. Canine cancers parallel the
natural development of human cancer due to the shared living environment with their
human owner, develop in an immunocompetent host, and present the similar features
as human cancer, including clinical presentations, histological appearances, and tumor
genetics [8]. Furthermore, molecular studies on canine cancers shed light on the
understanding of human cancers include histiocytic sarcoma [9, 10]. While still
uncommon (account for less than 1% of all canine tumors), histiocytic sarcoma is
relatively more common in specific dog breeds such as Bernese Mountain Dogs and
Flat-coated Retrievers [11, 12].
The PI3K/Akt signaling pathway is involved in regulation of variable of cellular
functions including proliferation, cell growth, apoptosis, cell cycle, cellular metabolism,
and angiogenesis [13, 14]. The constitutive activation of PI3K/Akt signaling has been
reported in numerous human cancers, such as non-small cell lung cancer, breast cancer,
melanoma, and histiocytic sarcoma [15-18]. Given that Akt signaling plays a vital role
in tumorigenesis, targeting the PI3K/Akt pathway represents a potential strategy for
cancer therapy. Akt inhibition not only kills the cancer cells directly but also sensitize
cancer cell to anti-cancer drugs. Thus the Akt signaling pathway has long been
recognized as a significant target in cancer drug discovery [19, 20].
Collectively, we hypothesized that aberrant activation of Akt signaling is the
3
critical component for the devastating behavior of histiocytic sarcoma. For the
aggressive neoplasms such as histiocytic sarcoma, there is an urgent demand for
effective therapies. In the present study, we utilize both cell line model and murine
xenograft tumor model of canine histiocytic sarcoma, in addition to canine clinical
tumor samples, to investigate the rationality and efficacy of Akt-targeting based therapy,
with the objective to develop novel therapeutic approaches for the clinical treatment of
histiocytic sarcoma in both human and canine patients.
4
CHAPTER 2
Literature review
2.1 Histiocytes
Histiocyte represents a group cell of the mononuclear phagocyte system (MPS),
and typically found in lymph nodes and spleen. These histiocytes are arising from a
common bone marrow precursor and share common morphological and functional
characteristics. Currently, histiocytes can be categorized into two major lineages,
macrophages and dendritic cells (DCs) [21, 22].
Histiocytes differentiate into macrophages and DCs from cluster of differentiation
34 positive (CD34+) hematopoietic stem cells (HSCs) under the influence of a variety
of cytokines, such as granulocyte-macrophage colony stimulating factor (GM-CSF),
interleukin-3 (IL-3), and tumor necrosis factor α (TNF-α) [23, 24]. Both the
macrophages and dendritic cells originate from stem cells that originated in bone
marrow. These stem cells develop to pro-monocytes and mature into monocytes in bone
marrow, which then circulate in the peripheral blood and migrate into tissues to
complete the process of maturation into macrophages [21]. Dendritic cells also derived
from bone marrow hematopoietic stem cells, but unlike the macrophages, dendritic cells
complete the maturation process in lymph nodes that are in rich in T lymphocytes [24].
Functionally, macrophages are professional phagocytes that play a critical role in
defending against pathogens and in the removal of unwanted organelle and particles by
5
means of phagocytosis [25]. Dendritic cells are poor phagocytes but critical antigen-
presenting cells (APCs) which highly involved in presenting antigens to CD4+ T cells
to initiate the adaptive immune response [26]. In addition to macrophages and dendritic
cells, histiocytes also embrace cells that reside in healthy tissues such as the Langerhans
cells of the skin, the Kupffer cells in the liver, and microglial cells in the central nervous
system (CNS) [21, 27].
2.1.1 Macrophages
Macrophages are first discovered by Nobel laureate Ilya Mechnikov and described
as professional phagocytes that engulf and digests pathogens, cellular debris, dead cells
and foreign microorganisms [25, 28]. The macrophages are derived from the peripheral
blood mononuclear cells (PBMC), which developed from a common myeloid
hematopoietic stem cell (HSCs) in bone marrow. These myeloid HSCs commit to
monoblasts, pro-monocytes, and monocytes sequentially during the monocyte
development. In response to granulocyte/macrophage colony-stimulating factor (GM-
CSF) and macrophage colony-stimulating factor (M-CSF), HSCs divide and
differentiate into colony forming unit-granulocyte/macrophage (CFU-GM), monoblasts,
pro-monocytes and then mature into monocytes in bone marrow. Monocytes then
briefly circulate in the bloodstream, to migrate into various tissues to complete their
differentiation process to macrophages [29-31]. Macrophages present in almost all
tissues. Their morphological and biological characteristics are different due to the subtle
microenvironment in local tissues. Regional macrophages and related tissue-specific
6
macrophages also described in the skin (Langerhans cells), bone (osteoclasts), lung,
liver (Kupffer cells), spleen, kidney, gastrointestinal tract, and central nervous systems
(microglial cells) [21, 27, 29-31].
Macrophages are professional phagocytes that highly specialized in the removal of
microbes and foreign substances. Besides its phagocytic function, macrophages are also
APCs that play a crucial role in host defense by recruiting immune cells and activating
immune responses. After engulfing and digesting foreign pathogens, macrophages can
present the antigens of the pathogens to helper T cells through the major
histocompatibility complex class II (MHC II) [32]. Macrophages also present antigens
to antigen-specific B cells through macrophage receptor-1 (MAC-1) and disrupted
macrophage function may diminish B cell responses to secondary infections [33, 34].
On the other hand, macrophages can receive antigens from B lymphocytes. A recent
study illustrates that the antigen presented by B cells can transfer to macrophages
through B cell receptor (BCR), and then further activate CD4+ T cell proliferation [35].
Macrophages can be identified by specific cell surface markers such as CD11b,
CD14, CD40, CD64, CD68, F4/80 (mice), EMR1 (human), lysozyme and MAC-1 [36].
Macrophages can be split into two major groups according to their effect on
inflammation: pro-inflammatory M1 macrophages (classically activated macrophages)
and anti-inflammatory M2 macrophages (alternatively activated macrophages). M1
macrophages play a vital role in adaptive immune response, while M2 macrophages
involved in tissue repair and wound healing. M1 macrophages are activated by pro-
inflammatory cytokines like lipopolysaccharide (LPS) and interferon-gamma (IFN-γ),
7
after that promoting inflammation by secreting a high level of interleukin-12 (IL-12)
and low level of interleukin-10 (IL-10). Whereas M2 macrophages are activated by
interleukin-4 (IL-4) and interleukin-13 (IL-13), and inhibiting inflammation via
producing anti-inflammatory cytokines like IL-10 [37-39]. Although M1 macrophages
are dominant in the early stage of inflammation, there is a phenotype shift from M1 to
M2 during the inflammatory progression. The switch of different phenotypes of
macrophages is an important mechanism in the regulation of initiation and development
of infectious and inflammatory diseases [40-42].
M2 macrophages are also known as tumor-associated macrophages (TAMs) that
promote tumor growth by producing high levels of IL-10, transforming growth factor
beta (TGF-β) and low level of IL-12 [43]. TAMs are an essential component in the
tumor microenvironment of various solid tumors. TAMs maintain the
immunosuppressive condition in tumor microenvironment via expressing immune
checkpoint inhibitor programmed death-ligand 1 (PD-L1) to suppress T cell responses
and facilitate cancer cells escape from immune attack [44-46]. In addition, TAMs can
stimulate angiogenesis and enhance cancer cell invasion by secreting vascular
endothelial growth factor A (VEGF-A). In turn, VEGF-A recruits macrophage
progenitors that subsequently differentiate to TAMs in response to IL-4 to further
suppress the T-cell mediated anti-tumor immune response [47, 48].
Furthermore, TAMs also produce matrix metalloproteinases (MMPs) to enhance
cancer cell invasion and metastasis [49]. Due to the plasticity of macrophages, it is
possible to repolarize TAMs into anti-tumor M1 macrophages to suppress tumor
8
progression by modifying the caspase recruitment domain-containing protein 9
(CARD9), and RelB/p52 mediated signalings [50, 51]. Thus, TAMs could be
considered as a target for cancer immunotherapy.
2.1.2 Dendritic cells
In contrast to macrophages that are characterized as professional phagocytes,
dendritic cells (DCs) are distinguished as cells that efficiently present antigens to the
major histocompatibility complex class II (MHC II) and activate CD4+ T cells [52, 53].
DCs arise from the ordinary progenitor cells in bone marrow and widely distributed
within almost all body sites as immature cells. They complete the differentiation
process into classical/conventional DC (cDC) in lymphoid organs such as lymph nodes
and spleen [54]. DCs can also be derived from peripheral blood mononuclear cells
(PBMCs). Studies have shed light on in vitro differentiation of DCs from PBMC in
response to fms like tyrosine kinase-3 (Flt-3) ligand, GM-CSF, and IL-4 in vitro [55,
56].
Since the original description of DCs, the application of flow cytometry allowed
the accurate assessment of different cell surface markers of DCs and enabled the
characterization of distinct DC subsets. In humans, all DCs express high levels of MHC
class II but missing lineage markers such as CD3 (T cell marker), CD19/20 (B cell
marker) and CD56 (natural killer cell marker), while DCs are identified as CD11c+ and
MHC II+ cells in mouse [57, 58]. Recent phenotypic and functional studies have
illustrated distinct DC subsets that distribute in both human and mouse (Table 2.1) and
9
refined the cDCs with lineage markers that identify DCs as myeloid or plasmacytoid
[57].
10
Table 2.1. Surface markers of human DCs and murine homologs. (Adopted
from ref. [59])
Human Mouse
Major subset CD1c+
Declin-1/CLEC7A
Declin-2/CLEC6A
CD11b+ (tissues)
CD4+CD11b+ (lymphoid)
ESAM
Cross-presenting CD141+
CLEC9A
XCR1
CD103+ (tissues)
CD8+ (lymphoid)
CLEC9A
XCR1
Langerin
Plasmacytoid CD303/CLEC4A
CD304/Neuropilin
CD123/IL-3R
B220
SiglecH
Monocyte-related CD14+
CD209/DC-SIGN
Factor XIIIA
CD16+ monocyte
CX3CR1hi
SLAN
Inflammatory DC
CD1c
CD16-
CD11b+CD64+ (tissues)
CX3CR1
CD14
Gr-1/Ly6Clow monocyte
CX3CR1hi
CCR2 negative
Monocyte-derived DC
CD209/DC-SIGN
CD206
11
Myeloid DCs (mDCs) express myeloid markers such as CD11b, CD11c, CD13,
and CD33, corresponding to CD11c+ cDCs in the mouse. Both monocytes and mDCs
express CD11c but mDCs are lacking CD14 or CD16 in humans, and can be further
divided into CD1c+ and CD141+ subsets [59]. These two subsets share the same
homology with CD4+/CD11b+ and CD8+/CD103+ cDCs in mouse, respectively.
Meanwhile, plasmacytoid DCs (pDCs) express CD123, CD303, and CD304 but lack
myeloid markers, and share homology to mouse B220+ DCs (Table 2.1) [60-62].
Anatomical studies delineated that DCs function is intimately related to their
location [63]. Blood DCs are probably to be precursors of non-lymphoid tissue (NLT)
DCs and lymphoid tissue (LT) DCs, given that blood contains immature forms of pDCs,
CD1c+ and CD141+ cDCs that found in tissues and lymph nodes [64, 65]. Moreover,
most epithelial tissues contain NLT-DCs or “migratory” DCs those who are patrolling
for antigens and migrating to lymph nodes (LN) via afferent lymphatics. Interstitial
tissues contain CD1c+ and CD141+ mDCs, and these interstitial NLT-DCs also can
migrate to the draining lymph nodes via afferent lymphatics. Lymphoid tissues contain
a large crowd of LT-DCs or “resident” DCs; these LT-DCs are CD1c+ mDCs, CD141+
mDCs, and pDCs under steady-state conditions [59, 62, 66].
CD14+ DCs are the third subset that initially described as interstitial DCs (iDCs).
These DCs are more like monocytes than the CD1c+ and CD141+ mDCs, and may be
derived from CD14+ blood monocytes. In the presence of inflammation, the content of
tissues and lymphoid organs is altered dramatically due to the recruitment of immune
cells such as granulocytes and monocytes [59]. The monocyte-derived inflammatory
12
DCs (also known as (Inf-moDC) play a crucial role in the inflammatory response such
as stimulate naïve CD4+ T cells, cross-present to CD8+ T cell, and secrete cytokines
such as IL-1, IL-12, IL-6, and tumor necrosis factor alpha (TNF-α), and have been
identified in both human and mouse [59, 67-69].
Functional maturation is one of the most critical features of DCs biology, upon
which DCs can regulate the immune response. Functional maturation of DCs is a
complicated process characterized by the acquisition of specific essential properties:
antigen processing, antigen presentation, migration, and T-cell stimulation [54, 70].
Various factors can induce DC maturation, including bacterial-derived antigens (e.g.,
LPS), viral products (e.g., double-stranded RNA, dsRNA), ligation of cell surface
receptors (e.g., CD40), and inflammatory cytokines. Pathogen invasion recruits
immature DCs to inflammatory sites in peripheral tissues; the foreign antigens
subsequently trigger maturation and migration of DCs from peripheral tissues to
lymphoid organs.
Immature DCs capture antigens by phagocytosis or via antigen receptors. The
primary antigen receptor expressed by DCs is CD205 (also known as DEC205), which
up-regulated significantly during the DCs maturation [71]. The CD205 can capture and
direct antigens to antigen-processing compartments within DCs and then process and
present the antigens on the cell surface of DCs in complex with MHC class II molecules
[72, 73]. Besides CD205, DCs also express a variety of additional cell surface receptors
that induce the maturation of immature DCs, such as immunoglobulin-like transcript 3
(ILT3), mannose receptor (CD206), Toll-like receptors (TLRs), and heat shock protein
13
(HSP) receptor (e.g., CD40) [74-77]. As they mature, DCs are capable of presenting
antigens to either CD4+, CD8+ or memory T cells via MHC class II on the cell surface
of DCs. Simultaneously, DCs express increased co-stimulatory molecules, such as
CD80 and CD86, which are critical for T cell activation [78]. Furthermore, DCs present
antigens in complex with MHC class I to CD8+ T cells to induce cytotoxic T
lymphocyte (CTL) and to cross-prime T cells in the condition of virus infection [79,
80]. Other cell surface receptors of immature DCs like CD36 and CD91 also function
in antigen capture and present antigens via MHC class I [81, 82].
DCs migration to T cell-rich areas of lymphoid organs post-maturation is regulated
by chemokine/chemokine receptor interaction. For instance, DCs express chemokine
receptors such as C-C chemokine receptor type 1 (CCR1), CCR5 and CCR7. Thus they
can be attracted to the inflammation sites by chemokine C-C motif ligand 3 (CCL3) and
CCL20 [83, 84]. Cell surface receptors also mediate the physical interaction between
DCs and T cells. Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing
Non-integrin (DE-SIGN, also known as CD209) on DCs cell surface has a high affinity
for the intercellular adhesion molecule 3 (ICAM3, also known as CD50) expressed on
naïve T cells. Binding of DE-SIGN to ICAM3 can enhance primary immune response
and promote T cell transfection [85, 86]. Adhesion receptors such as ICAM-1,
lymphocyte function-associated antigen-1 (LFA-1), and Dectin-1/C-type lectin domain
family 7 member A (CLEC7A) may also express on mature DCs and function to
enhance T cells adhesion and promote T cells proliferation [87, 88]. The mature DCs
secrete a large number of cytokines including IL-1, IL-12, IL-15, IFN-γ, IL-4, IL-10,
14
IL-6, and TNF-α. Although the exact cytokine secretion depends on the simulation, the
stage of DCs maturation and the existing cytokine microenvironment, the cytokines
secreted by mature DCs eventually determine the Th1/Th2 polarization. Typically, IL-
12 secretion can induce Th1 differentiation, whereas inhibition of IL-12 production
leads to Th1 differentiation [89-91].
2.1.3 Langerhans cells
Langerhans cells (LCs) are unique self-renewing cell populations that reside in the
epidermis, the outermost layer of the skin. LCs can also present in other epithelia, such
as oral mucosa and vaginal epithelium [92, 93]. The LCs can differentiate into
migratory DCs during the inflammatory response of the skin. Human LCs express a
high level of C-type lectin Langerin/CD207 and CD1a and can present antigens to T
cells in the skin. Unlike human LCs, LCs express CD11c and F4/80 in the mouse. LCs
establish a tight epidermal immune barrier incorporate with other immune cells in the
skin.[94].
There has been amount of debate about the classification of LCs. Functionally, LCs
bear a resemblance to dermal DCs that able to present antigens to T cells and actively
migrate to the draining lymph nodes [93, 95]. Moreover, LCs express the same cell
surface marker as dermal DCs, such as Langerin/CD207 [96, 97]. However, LCs share
common precursors with macrophages, whereas dermal DCs are more closely related
to cDC subsets that reside in lymphoid tissues [93, 98]. Furthermore, LCs contain an
organelle called Birbeck granules which exclusively found in LCs [99]. It is rational to
15
classify LCs into the macrophage-lineage based on the developmental origin [58]. A
recent study of the transcription factor ZBTB46 emphasizes the cDC identity of LCs
[100, 101]. Transcription factor MafB was reported to regulate a network of genes that
control self-renew in the proliferation of resident macrophages. Recently, a Mafb
lineage tracing study confirmed the dual identity of LCs as the researchers show that
the ZBTB46-expressing LCs originate from a progenitor express Mafb, indicating
macrophage origin [93, 98, 102]. These findings support the current persuasiveness that
LCs being macrophages with DC functions. Phenotypically, LCs share common
characteristics with cDCs, while their ontology classifies them as tissue-resident
macrophages. Collectively, LCs represent a highly distinct cell type, sharing
characteristics with cDCs but developing from a different origin distinguishes them
from cDCs [93].
In summary, the MPS represent a group of functionally distinct cell types that
derived from the common bone marrow progenitors that subsequently differentiate into
specific lineages in response to environmental stimulant and regulated by intrinsical
gene network, leading to the generation of a variety of cell types with distinct cellular
functions. The right understanding of the biological heterogeneity of histocytes is a
pivotal key for the accurate diagnosis and treatment of the histiocytic disorders [103].
2.2 Histiocytic disorders
Histiocytic disorders are a group of rare, malignant and non-malignant disorders
that characterized by the accumulation and infiltration of excessive proliferation of the
16
cells of the mononuclear phagocytic system. This group is consist of a wide variety of
syndromes that can affect both children and adults. The Histiocyte Society classified
these disorders into three categories in 1987 based on the types of histiocytic cells
present in the lesion [103, 104]:
Class I: Langerhans cell histiocytoses and other dendritic cell-related histiocytic
disorders.
Class II: non-Langerhans cell histiocytoses and other macrophage-related
histiocytic disorders.
Class III: malignant histiocytosis.
The World Health Organization Committee on histiocytic/reticulum cell
proliferation and re-classification working group of the histiocytic society revised the
classification in 1997. The disorders of various biological behaviors have been
consistently classified into dendritic cell histiocytoses (class I) and macrophage
histiocytoses (class II) [103]. The Langerhans cell histiocytosis is the most ordinary
type of dendritic cell-related disorders, in addition to other less common subtypes such
as Juvenile xanthogranuloma (JXG) and Erdheim-Chester disease (ECD). The primary
and secondary hemophagocytic lymphohistiocytosis, in addition to Rosai-Dorfman
disease (RD, also known as sinus histiocytosis with massive lymphadenopathy), are the
two major subtypes of macrophage-related disorders. The central theme of the re-
classification is clearly distinguished the malignant histiocytoses from other subtypes.
Chronic myelomonocytic leukemia, acute myelomonocytic leukemia (AMMoL), Acute
17
monocytic leukemia (AMoL), and histiocytic sarcoma are classified in the malignant
histiocytoses (class III) [103-105]. The specific re-classification schema is summarized
in Table 2.2.
18
Table 2.2. Classification of histiocytic disorders. [1, 103-106]
Class I: dendritic cell-related histiocytoses
Langerhans cell histiocytosis (LCH)
Secondary dendritic cell processes
Juvenile xanthogranuloma (JXG) and related disorders
Erdheim-Chester disease (ECD)
Solitary histiocytomas of various dendritic cell phenotypes
Class II: Macrophage-related histiocytoses
Primary hemophagocytic lymphohistiocytosis
Familial hemophagocytic lymphohistiocytosis (FHL)
Secondary hemophagocytic lymphohistiocytosis
Infection-associated hemophagocytic syndrome (IAHS)
Malignancy-associated hemophagocytic syndrome (MAHS)
Macrophage activation syndrome (MAS)
Rosai-Dorfman disease (RD)
Solitary histiocytoma with macrophage phenotype
Class III: malignant histiocytoses
Monocyte related
Leukemias (FAB classification)
Acute myelomonocytic leukemia (FAB M4)
Acute monocytic leukemia (FAB M5a and M5b)
Chronic myelomonocytic leukemia
Extramedullary monocytic tumor or sarcoma
Dendritic cell-related histiocytic sarcoma
Macrophage-related histiocytic sarcoma
FAB: French-American-British classification of Acute Myeloid Leukemias.
19
2.2.1 Langerhans cell histiocytosis
The Langerhans cell histiocytosis (LCH), formerly known as histiocytosis X, is the
most ordinary type of the dendritic cell-related histiocytic disorders. The biological
hallmark of LCH is the aberrant proliferation and accumulation of immature
Langerhans cells within the granulomatous lesions [1, 103]. The clinical manifestations
of the LCH may variable and related mainly to organs that may be involved, including
skin, bone, lymph nodes (non-risk organs), lung, liver, spleen and bone marrow (risk
organs) [1, 103, 107].
Although the pathogenesis of the LCH largely remains elusive, it is believed that
the abnormal cytokine and chemokine microenvironment is involved in the
development of LCH [108]. Both Langerhans cells and LCH cells contain Birbeck
granules. However, LCH cells, in contrast to standard Langerhans cells, lacking typical
markers of mature DCs such as CD83 and CD86 [103]. LCH cells express CCR6 which
is the characteristic of immature DCs. Meanwhile, these cells secrete CCL11 and
CCL20, which are functioning in recruiting more LCH cells [108].
Moreover, LCH cells express MHC class II and CD40 but are inefficient antigen-
presenting cells and may acquire mature DCs features after exposure to the CD40 ligand
[103, 109]. Immunohistochemistry reveals abnormal secretion of cytokines in LCH.
The excessive secretion of GM-CSF, IL-10, TGF-β, and TNF-γ, in turn, magnify the
autocrine and paracrine of these cells and associated with the systematic symptoms such
as skin rashes, fever, and hypotension [103, 110, 111]. Other factors like infectious,
inflammatory and neoplastic may also contribute to the etiology of LCH, but the exact
20
contribution of each process to the pathogenesis of LCH remains controversial. More
and more studies acknowledge that LCH is the outcome of abnormal proliferative
disorder of immature Langerhans cells induced by complex interactions between
environmental factors and intrinsic genetic changes [103, 110, 112, 113].
The actual incidence of LCH is not reported, the estimated prevalence is 1:50,000
to 1:150,000 and may vary according to age and ethnicity. A French epidemiological
study from 2000 to 2004 estimated the incidence rate (IR) of LCH in children is less
than 15 years old to be 4.6 with a female to male ratio of 1.2 [114]. This IR is similar
to that reported 5.4 per million children per year by the first national epidemiological
study in Denmark [115]. An epidemiological study has estimated an incidence rate of
around 9 per million children per year in Sweden [106]. However, it is considered to be
an underestimation of IR in the adults [116].
The diagnosis of LCH is based on the biopsy and immunophenotypic examination
of lesion tissues. The definitive diagnosis requires the morphologic identification of
Birbeck granules and positive staining of CD1a and CD207 [1, 116].
Clinically, LCH might manifest as either localized single-system disease or multi-
system disease. The organ involvement is strongly associated with the prognosis of
LCH. Patients with LCH localized in non-risk organs, such as skin and lymph nodes,
only require minimal treatment and usually carry a good prognosis. However, patients
with LCH in risk organs often have a worse prognosis and higher mortality [1]. Patients
with LCH that affecting vertebrae, cranial bones with intracranial soft tissue extension
are considered to be CNS risk, and patients may develop sequelae like
21
neurodegenerative syndrome after treatment [117].
The goal of treatment of the LCH is to remit the disease activity and decrease
proliferation of histiocytes that contribute to disease activity [1]. Surgical resection
followed by anti-inflammatory treatment and local steroid injection is the standard
protocol for the patients with localized LCH affecting skin and lymph nodes [103].
Systemic therapy including surgery, radiotherapy, multi-drug chemotherapy is
recommended for patients with LCH affecting multiple organs [1, 103, 106]. Patients
with limited responses to standard chemotherapy may direct to stem cell therapy such
as hematopoietic stem cell transplantation (HSCT) [1, 118, 119].
2.2.2 Hemophagocytic lymphohistiocytosis
Hemophagocytic lymphohistiocytosis (HLH) is the predominant type of the class
II histiocytoses, which is characterized by the abnormal accumulation of the
macrophages along with T lymphocytes in the normal tissues. HLH is non-malignant
but frequently life-threatening and can further classify into primary HLH and secondary
HLH. Primary HLH also refers to familial hemophagocytic lymphohistiocytosis (FHL)
and is often a heritable disorder, while secondary HLH is a sporadic disease that usually
associated with pre-existing infection or malignancy [1, 103, 106].
The immunologic abnormalities, such as dysfunction of natural killer (NK) cell and
cytotoxic T cells, have been observed in both primary and secondary HLH. The defect
in NK cell function favors the pathological expansion of immune responsiveness and
facilitates the infiltration of inflammatory cells. The sustaining release of inflammatory
22
cytokines (hypercytokinemia) by these infiltrated inflammatory cells resulting in the
accumulation of macrophages which in turn contribute to the symptoms of HLH [120-
122]. Genetic testing identified three gene mutation in FHL: UNC13-D (Munc13-4),
PRF1 (perforin) and STX11 (syntaxin 11), which play a critical role in NK cell and T
cell function [123-126]. The observation of NK cell dysfunction along with mutation
of PRF1, UNC13-D, and STX11 in HLH patients explicitly manifest the critical role of
the regulatory pathway of the immune/inflammatory response in the pathogenesis of
HLH.
As similar with LCH, the exact incidence of HLH is unknown. The estimated incidence
of HLH is around 1:50,000 to 1:300,000 live borns based on several retrospective
studies [127, 128]. The epidemiological study of HLH in Sweden reported a slight
increase from 1.2 to 1.5 cases per million children per year from 1987 to 2011 [127,
129, 130]. Most of the primary HLH occur during the first year after birth, but
secondary HLH occurs sporadically at any age with a male to female ratio close to 1:1
[131].
Primary and secondary HLH are clinically indiscernible, the most common
symptoms including persistent fever, cytopenias, hepatosplenomegaly,
hemophagocytosis, hypertriglyceridemia, coagulopathy, hypofibrinogenemia, and CNS
abnormalities [103, 132, 133]. The Histiocyte Society developed the diagnostic
guidelines that include both clinical signs and laboratory findings [133]. With recent
studies and the development of genetic examination, the HLH-2004 diagnostic criteria
are modestly modified and listed in Table 2.3.
23
Table 2.3. Diagnostic criteria for hemophagocytic lymphohistiocytosis. [1, 103,
106, 129, 133])
Clinical
1. Fever
2. Hepatosplenomegaly
Laboratory
Hematologic
3. Cytopenias (affecting more than two of three lineages in peripheral blood)
Hemoglobin < 9 g/dL
Platelets < 100 × 103/mL
Neutrophils < 1 ×103/mL
4. Hemophagocytosis (in bone marrow, spleen, lymph nodes, or liver)
Biochemical
5. Hypertriglyceridemia (fasting triglycerides ≥ 265 mg/dL) and/or
Hypofibrinogenemia (≤ 150 mg/dL)
6. Ferritin (> 500 ng/mL)
Immunologic
7. Low or absent NK cell function
8. Elevated soluble CD25 serum levels
Additional
Molecular demonstration of gene mutation (e.g., PRF1, UNC13-D, and STX11)
Presence of familial disease
Note:Diagnosis requires at least five of the eight clinical and laboratory criteria.
24
Because HLH has a rapid clinical course and may be fatal without medical
intervention, the early treatment is encouraged when there is high clinical suspicion.
The chemo-immunotherapy is prescribed in the HLH-2004 protocol, including
etoposide, dexamethasone, cyclosporine, and intrathecal therapy with methotrexate and
corticosteroids in patients with cerebrospinal fluid abnormalities [133]. Primary HLH
usually to be recurrent and have limited responses to chemotherapy. Thus subsequent
HSCT is recommended as a potentially curative therapy [132]. However, secondary
HLH can be effectively treated by standard chemotherapy recommended by HLH-2004.
Remarkably, in the case of infection-/malignancy-associated HLH, the sequential
treatment of both HLH and the associated disease is necessary to achieve the complete
remission.
2.2.3 Histiocytic sarcoma
Histiocytic sarcoma (HS) is a rare but aggressive neoplasm characterized by the
abnormal proliferation of mature histiocytes with hematopoietic origin [134, 135]. With
rapidly clinical progress and poor prognosis, HS represents less than 1% of all
neoplasms of the hematopoietic system [136, 137]. The overall rarity of this disease
and lack of suitable animal models impeded the progression in understanding the basic
knowledge of molecular biology and genetics underlying the tumorigenesis of HS.
Although genetic analysis in human HS patients indicated genetic/epigenetic
inactivation of tumor suppressor p14 (ARF), p16 (INK4A), BRAF V600E and PTEN, the
etiology of this disorder remains unknown [18, 138, 139].
25
While still uncommon, HS has a relatively higher incidence in some breed of dogs.
Pet dogs share the living environment of their human owners and may develop HS
spontaneously, which provide us with an excellent model to better understand human
HS. A recent study sheds light on the genetic mutation in canine HS, molecular
cytogenetic profiling study revealed DNA copy number aberrations (CNAs) of several
tumor suppressor genes in spontaneous canine HS, such as CDKN2A/B, RB1 and PTEN
[9].
2.2.3.1 Pathology and epidemiology
2.2.3.1.a Human
Histiocytic sarcoma is an extremely rare neoplasm derived from histiocytic cells
with an unknown etiology. Although the exact incidence is unclear, histiocytic sarcoma
is representing less than 1% of all neoplasms that affect hemato-lymphoid system [136].
The World Health Organization defines HS as a malignancy with morphologic and
immunophenotypic characteristics that resemble those of mature tissue histiocytes [2].
HS can occur in a wide age range. The age of patients at onset are widely ranged from
6 months to 89 years. Male predisposition (male to female ratio 1.5 : 1) is reported in
the literature [2-4]. Histiocytic sarcoma can occur as either the primary tumor or
secondary malignancy following the diagnosis of lymphoma/leukemias such as acute
monocytic leukemia [140], diffuse large B-cell lymphoma [141], and chronic
lymphocytic leukemia [142]. Most secondary HS occur after B-cell lymphomas with
26
an interval between 2 months to 17 years [2, 134, 141, 143-145].
Morphologically, the tumor usually is comprised of large cells contain a round or
oval nucleus and foamy cytoplasm, but multinucleated cells are frequently observed [4].
Immunohistochemically, the HS tumor cells are positive for one or more histocyte
markers such as CD45, CD68 and CD163 [4, 136], and usually absence of Langerhans
cell markers (CD1a, langerin/CD207) [94, 96]. HS can occur in both localized and
disseminated pattern. The localized HS often affects the skin, soft tissue, and the
regional lymph node, while the disseminated HS originates in the lung, stomach, spleen
and central nervous system [4, 143, 144, 146].
2.2.3.1.b Canine
Histiocytic sarcoma is a very rear and highly aggressive neoplasm, representing
less than 1% of all tumors in canine patients [11]. However, it is relatively more
common in specific breeds, such as Bernese mountain dog (BMD) and Flat-coated
Retriever. BMD carries a high prevalence with an incidence of approximately 20-25%,
as well as Flat-coated Retriever [12]. Other predisposed breeds are the Golden
Retrievers and Rottweilers. The affected dogs are often middle-aged (8-10 years) and
males and females equally affected [147, 148]. The cause of oncogenesis of HS is
mostly unknown, and there are no studies indicated dietary or environmental risk
factors are involved in the development of canine HS. However, the high prevalence of
HS in specific breeds may suggest the existence of hereditary risk factors that influence
the development of HS. An epidemiologic study in a large population of BMD indicated
27
that 70% of the affected dogs had relatives with an identified diagnosis of HS [12].
Histiocytic sarcoma can present either a localized or a disseminated manner in dogs.
Localized histiocytic sarcoma most frequently occurs in the skin and subcutis of the
extremities, peri-articular tissues of appendicular joints, and locally invasive to satellite
lymph nodes [149-151]. The disseminated histiocytic sarcoma is a disease involves
multi-systems such as lymph nodes, lung, spleen, liver, and bone marrow [150, 152].
2.2.3.2 Clinical features and diagnosis
2.2.3.2.a Human
Histiocytic sarcoma most commonly affects the lymph nodes and other extranodal
sites, such as skin, soft tissue, spleen, and gastrointestinal tract. The other involved sites
include breast, lung, liver, pancreas, kidney, head and neck, and central nervous system
[3, 4, 134, 135]. HS may present as localized or disseminated disease and has variable
clinical presentations include fever, weight loss, anorexia, asthenia,
hepatosplenomegaly, and lymphadenopathy [137]. Definitive diagnosis of HS is often
impeded due to the variety of clinical presentation, and it is frequently misdiagnosed
with B-cell lymphoma, interdigitating dendritic cell sarcoma, and myeloid sarcoma.
This diagnostic challenge is further complicated due to the similarities to other
histiocytic disorders include the malignant histiocytosis, hemophagocytic syndrome,
and monocyte leukemia [5-7].
The diagnosis of HS relies predominantly on the immunophenotypic verification
of histiocytic lineage markers on tissue biopsies. In addition to lack of Langerhans cell
28
marker CD1a, CD68 is a marker most frequently used to identify the histiocytic
differentiation. Furthermore, CD163, a high-affinity scavenger receptor, is a more
specific marker that restricts histiocytic derivation [153]. The expression pattern of
CD45+, CD68+, CD163+, and CD1a− is considered to establish the diagnosis of human
HS [154, 155]. However, the overall rarity of these neoplasms continuously obscures
the definitive diagnosis of HS. HS must be differentially diagnosed from other
histiocytic disorders, the morphological features and immunophenotypes of HS and
other histiocytic disorders are summarized in Table 2.4.
2.2.3.2.b Canine
As in human patients, the clinical presentations of dogs with HS include
nonspecific clinical symptoms such as mass, lethargy, lameness, anorexia, weight loss,
swelling, weakness, cough, vomiting, and lymphadenomegaly [151, 152, 156].
However, the initial clinical signs may vary according to the location of the primary
tumor and the different stages of the disease.
The immunohistochemistry verification is critical for the distinguish HS from the
other canine histiocytic disorders and the definitive diagnosis of canine HS. The key
morphological features and immunophenotypes of canine histiocytic disorders are
summarized in Table 2.5. The HS tumor cell immunophenotype is consistent with the
antigen presenting cells (APCs), which is CD1+, CD11c+, CD80+, CD86+, ICAM-1+,
and MHC class II+ [152, 157]. The expression of CD3−, CD11d−, CD79a−, and CD18+
is a most used pattern to in clinic to establish the definitive diagnosis [150, 152, 156,
29
158].
Table 2.4. Differential diagnosis of histiocytic sarcoma. (Adopted from ref. [145])
Disease Morphological Features Immunophenotype
Histiocytic
sarcoma
Large and round/oval nuclei with focal
areas of spindling
CD45+, CD68+,
CD163+, CD1a−,
CD33−, CD35−
Reactive
histiocytic
proliferation
Bland and distinctive round nuclei with
a subtle chromatin pattern
CK7−, CK20−,
CD68−, CD163−
Dendritic cell
sarcoma
Spindle to ovoid cells with whorls CD4+, CD21+,
CD34+, CD35+,
CD68+/−, Fascin+, S-
100+
Langerhans cell
histiocytosis
Numerous atypical histiocytes singly
and in loose cohesive clusters.
Grooved, indented, folded, or lobulated
nuclei
CD1a+,
Langerin/CD207+,
CD68−, CD163−
Malignant
melanoma
Irregular nested and single growth of
melanoma cells within the epidermis
and an underlying inflammatory
response
S-100+, HMB-45+,
Tyrosinase+, MITF+,
MART-1/Melan A+,
CD68−, CD163−
30
Table 2.5. Differential diagnosis of canine histiocytic sarcoma with other histiocytic disorders. (Adopted from ref. [159])
Disease Cell of Origin Key Morphological Features Immunophenotype
Histiocytoma
LC Lesions have epidermal and intraepidermal foci are common.
Histiocytes have a wide variety of nuclear morphology (ovoid, indented,
round, or complex nuclear contours)
CD1a, CD11c/CD18,
E-cadherin
Cutaneous histiocytosis iDC activated Vasicentric lesions are focused on mid-dermis to subcutis. Histiocytes
and lymphocytes are predominant in the lesions. Histiocytes lack
cytologic atypia
CD1a, CD4,
CD11c/CD18, CD90
Systemic histiocytosis iDC activated Lesions are identical to cutaneous histiocytosis in the skin. Lesions may
extend to lymph nodes, ocular and nasal mucosa, and internal organs.
CD1a, CD4,
CD11c/CD18, CD90
Histiocytic sarcoma iDC Mass lesions are observed in lymph nodes, lung, spleen, and other tissue
sites. Histiocytes are mononuclear, pleomorphic, and multinucleated
giant cells with typical cytological atypia.
CD1a, CD11c/CD18
Hemophagocytic HS Macrophage Mass lesions are lacking. The splenic red pulp is extended by
erythrophagocytic histiocytes. Mononuclear and multinucleated giant
cells with cytologic atypia are ordinary.
CD1a (low),
CD11d/CD18
31
2.2.3.3 Current approaches to treatment
2.2.3.3.a Human
HS is highly aggressive with limited response to chemotherapy and poor prognosis.
HS often has a rapid clinical course and high mortality rate. Treatment options are
limited and include complete surgical resection, multi-drug chemotherapy, radiotherapy
and combinations of thereof [160]. Due to the rarity of this neoplasm, there have no
standard treatment approaches for HS. Most patients present with disseminated disease
at diagnosis. For patients with advanced disease, multi-agent chemotherapy is used as
a primary therapeutic approach for human HS patients, and CHOP (cyclophosphamide
+ doxorubicin + vincristine + prednisone) is the most commonly used regimen [136,
161-163]. Other regimens such as CHOP-E (CHOP plus etoposide) and BEAM
(carmustine + etoposide + cytarabine + melphalan) have been tried.
Nevertheless, only a few patients with localized disease respond well to
chemotherapy and have a relatively slow clinical progress and favorable long-term
outcome. The most patients with HS have limited response, and the prognosis is poor,
many patients die from rapid disease progression within two years after diagnosis [2, 3,
136]. Novel antineoplastics such as alemtuzumab and vemurafenib have shown
promising therapeutic responses in a few individual patients [139, 164]. Recently, the
pilot clinical study showed that chemotherapy in combination with autologous stem cell
transplantation had an excellent therapeutic effect in small group patient with HS [161,
163, 165, 166]. An extensive population analysis in the United States indicated that the
incidence of HS significantly increased from 2000 to 2014, and the overall median
32
survival in the entire patients of HS (159 cases) is only six months [167]. The increasing
incidence and unimproved survival emphasizing the unmet need for novel and
efficacious treatment.
2.2.3.3.b Canine
Similarly to human patients, canine histiocytic sarcoma is a fatal disease with rapid
progression and high metastatic rate [156]. The treatment approaches for canine HS
include surgical resection, chemotherapy, and radiotherapy. Although the two forms of
HS have particular clinical courses, the localized HS often accompanied with a high
metastatic rate of 70-91% [149-151]. All dogs with HS carry a grave prognosis despite
any treatment approaches, the reported median survival time can be as short as only 2-
4 months [151, 152, 156].
Although dogs with HS have limited response to chemotherapeutics, the most
effective drug in dogs is CCNU (N-(2-chloroethyl)-N’-cyclohexyl-N-nitrosourea) and
doxorubicin. The response rate to CCNU is ranging from 29% to 40% with a median
survival time of 85 to 96 days [149, 168]. A study using doxorubicin-based
chemotherapy regimens reported a response rate of 58% for a median survival time of
185 days [169].
In most of the cases, the disease usually has an advanced progression when the
definitive diagnosis established, and the tumor is disseminated to multiple organs. For
dogs with metastasis, systemic therapy in a combination of two or more approaches is
recommended [149].
33
2.3 PI3K/Akt signaling pathway
The phosphoinositide-3-kinase/Akt (PI3K/Akt) signaling pathway was identified
in the early 1980s [170, 171]. It is one of the most crucial signal transduction pathways
in the cell. By affecting the activation state of a variety of downstream effector
molecules, PI3K/Akt signaling pathway plays an essential role in the regulation of
proliferation, survival, apoptosis, metabolism, angiogenesis, and it is closely associated
with the pathogenesis and development of various human cancers [172, 173].
2.3.1 PI3K/Akt pathway in Health
Phosphatidylinositide 3-kinases (PI3Ks) are a family of intracellular signal
transducer kinases involved in various cellular functions such as proliferation, cell
growth, survival, differentiation, and angiogenesis. PI3Ks family consist of three
different classes: class I, class II, and class III, among which the most widely studied
are class I PI3Ks that can be activated by G protein-coupled receptors (GPCRs) and
receptor tyrosine kinases (RTKs) [174]. Class I PI3Ks are heterodimeric that composed
of a regulatory and a catalytic subunit and can be further categorized into IA and IB
subsets. Class IA PI3K is composed of a p110 catalytic subunit and a p85 regulatory
subunit [175]. Akt, also known as protein kinase B (PKB), is a serine/threonine kinase
belonged to AGC protein kinases family and composed of three homologous isoforms:
Akt1 (PKBα), Akt2 (PKBβ) and Akt3 (PKBγ) [173, 176].
The PI3K/Akt signaling pathway is highly conserved and regulated. Its activation
is a multi-step process involves sequential activation and phosphorylation of
34
downstream molecules. Upon binding of the extracellular simulator to RTKs on the cell
surface, the dimerization of RTKs causes cross-phosphorylation of tyrosine residues in
the intracellular domains. Phosphorylated RTKs stimulate binding of PI3K kinase via
either their regulatory subunit directly or adaptor molecules such as insulin receptor
substrate 1 (IRS1). Activated PI3K triggers phosphorylation of phosphatidylinositol (4,
5)-bisphosphate (PIP2) lipids to phosphatidylinositol (3, 4, 5)-trisphosphate (PIP3) by
its catalytic domain. PIP3 services as a second messenger to relocalize cytoplasmic Akt
kinase to the plasma membrane, and phosphorylates Akt at two regulatory sites: Thr308
and Ser473 [13, 14, 172]. Activated Akt can activate or inhibit downstream targets such
as mTOR (mammalian target of rapamycin), Bad (Bcl-2-associated death promoter),
caspase-9, and NF-κB (nuclear factor-kappa B) by phosphorylation. It is an essential
anti-apoptotic regulator that mediates cell growth and promotes cell survival through
various growth factors and pathways. Akt signaling regulates different cell functions
depending on the downstream target proteins [177-180].
PTEN (phosphatase and tensin homolog) is a tumor suppressor and acts as the
primary negative regulator of the PI3K/Akt signaling pathway. PTEN negatively
regulates the intracellular level of PIP3 through its lipid phosphatase activity to
dephosphorylate PIP3 to produce PIP2, leading to inhibition of the PI3K/Akt signaling
pathway [181]. Recent studies report that Akt signaling is also negatively regulated by
other protein phosphatases such as SHIP2 (SH2 domain-containing 5-inositol
phosphatase 2) and PHLPP (PH domain leucine-rich repeat protein phosphatase).
SHIP2 hydrolyzes the 5-phosphate of PIP3 to produce PIP2, thereby negatively
35
regulating the PI3K/Akt signaling pathway. PHLPP phosphatase family functions as a
tumor suppressor that attenuate Akt kinase activity by directly dephosphorylating and
inactivating Akt at Ser473 [182, 183].
Akt signaling enhances the cell survival by blocking the function of pro-apoptotic
proteins. Akt regulates the function of Bcl-2 (B-cell lymphoma 2) protein family
members such as Bad and Bax (Bcl-2 associated X protein) by phosphorylation. Akt
can promote the degradation of p53, an oncogene that mediates apoptosis, through
phosphorylation of MDM2 (Mouse double minute 2). Akt can also regulate the
apoptosis and glucose metabolism via phosphorylation of GSK3 (glycogen synthase
kinase 3) isoforms on N-terminal regulatory site [184].
Moreover, the PI3K/Akt signaling pathway also involved in the regulation of cell
cycle. The p21 family members, cyclin, and CDKs (cyclin-dependent kinases) are
regulating the cell cycle precisely. The function of the p21 and related family member
p27/Kip1 is inducing cell cycle arrest and maintain the cell at the G1 phase of the cell
cycle by inhibiting cyclin-CDK complex [184, 185]. Akt can phosphorylate p21 and
p27/Kip1 and inhibits their anti-proliferative effects by sequestering them in the
cytoplasm so that it can promote the cell passes the G1 phase to proliferation [186].
In summary, the function of the PI3K/Akt signaling pathway is to stimulate the cell
proliferation, cell growth and promote cell survival by inhibiting apoptosis.
2.3.2 PI3K/Akt in Cancer
The aberrant activation of the PI3K/Akt signaling pathway results in abnormal cell
36
proliferation, and it is associated with the oncogenesis of various tumors such as ovarian
cancer, breast cancer, glioblastoma, endometrial carcinoma, medulloblastoma, and
multiple myeloma. Akt signaling induces tumorigenesis and promotes cancer
progression through activating its downstream targets such mTOR, Bad, caspase-9, NF-
κB, Forkhead, and P21, thereby conferring the tumor cell the ability of resisting cell
death, evading growth suppressor signaling, inducing angiogenesis, and activating
invasion and metastasis.
2.2.2.1 Inhibition of apoptosis
p53
p53 is critical in regulating DNA damage-mediated apoptosis. MDM2 is the major
regulator of p53, which can inactivate the transcriptional regulatory function of p53 by
binding with it and tagging it for destruction through poly-ubiquitination. Akt can
induce increased MDM2 activity and promote its translocation into the nucleus via
phosphorylating MDM2 at Ser166 and Ser186, thereby inducing the deactivation and
degradation of p53 and blocking its pro-apoptotic function [187, 188].
Bad
Multicellular organisms maintain their stability through proliferation and apoptosis.
The tumor will format if the dynamic balance between these two is imbalanced.
Bad belongs to the Bcl-2 protein family, and it is localized at the mitochondrial outer
membrane and involved in the regulation of apoptosis. Usually, Bad combines with
37
Bcl-2 on the mitochondrial outer membrane and promotes apoptosis. Activated Akt can
block the formation of the heterodimer between Bad and Bcl-2 through phosphorylating
Bad at Ser136, thereby inhibiting the pro-apoptotic effect of Bad. Akt can also inhibit
apoptosis through enhancing the heterodimerization of Bax and Mcl-1 (myeloid cell
leukemia 1) by phosphorylating Bax at Ser184 [189-191].
Caspase 9
In the process of apoptosis, pro-caspase 9 is binding to Apaf-1 (Apoptotic protease
activating factor 1) to form the apoptosome, thereby initiating the caspase-cascade. Akt
can inhibit the kinase activity of pro-caspase 9 by phosphorylating the regulatory site
Ser196 and prevent its pro-apoptotic effect [192].
Forkhead
Forkhead transcription factor locates in the nucleus and promotes apoptotic gene
transcription by binding to the cis-acting element. Some studies indicate Akt can
phosphorylate the forkhead transcription factor and relocate it from nucleus to
cytoplasm, leading to its binding to 14-3-3 proteins and accumulation in the cytoplasm,
in which location it cannot induce the transcription of apoptosis-related genes [193].
NF-κB
NF-κB is a protein complex that involved in regulation of multiple gene
transcription. Typically, NF-κB enhances cell survival by inhibiting apoptotic in tumor
38
cells. In normal condition, NF-κB is sequestered in the cytoplasm and is remaining
inactive in the form of binding with its inhibitor IκB (Inhibitor of κB). The activation
of NF-κB depends on the phosphorylation of IKK (IκB kinase) complex followed by
ubiquitination and degradation of IκB. Jeong et al. reported that Akt could regulate the
activation of IKK complex and induce degradation of IκB, thereby promoting NF-κB
activation and translocation from cytoplasm to nucleus to active transcription of anti-
apoptotic genes. Moreover, Akt can facilitate NF-κB activation via phosphorylating IκB
directly [194].
2.3.2.2 Regulation of cell cycle
Akt regulates the cell cycle in multiple ways. c-myc is a proto-oncogene, and its
activity is precisely regulated at both transcriptional and translational level. Over-
expression of c-myc drives cell from G0 to S phase transition. Akt can accelerate cell
cycle progression through up-regulating c-myc at the transcriptional level [195, 196].
Akt can regulate p21/Cip1 directly by determining its intracellular location. Typically,
the p21/Cip1 inhibits the CDKs in the nucleus. However, p21/Cip1 can be
phosphorylated by Akt, and the phosphorylated p21/Cip1 will translocate from nucleus
to cytoplasm and loose its inhibition effect, thereby promoting the cell cycle
progression [197]. Akt also regulates the CDK inhibitor p27/Kip1 indirectly. The
forkhead transcription factor is required for transcription of p27/Kip1, which negatively
regulates the cell cycle. As above mentioned, Akt can phosphorylate the forkhead
transcription factor, phosphorylated forkhead is binding to 14-3-3 proteins and
39
sequestered in the cytoplasm, where it cannot induce transcription of p27/Kip1 [198,
199]. Studies also indicate that down-regulation of Akt activity by tumor suppressor
gene PTEN leads to increased level of p27/Kip1 and arrest of cell cycle at the G1 phase
[200, 201]. Moreover, Akt can regulate G1 phase progression through mTOR/P70S6K
signaling. Akt can phosphorylate mTOR at Ser2448, upon which mTOR further
activates downstream target P70S6K and leads to activation of cyclin D1, CDK4, and
CDC25A, thereby driving G1 cell cycle progression [202].
2.3.2.3 Promotion of angiogenesis
The formation of new blood vessels and adequate blood supply is significant for
tumor growth. The eNOS (endothelial nitric oxide synthase) is required for the
generation of nitric oxide (NO) in the vascular endothelium. The NO produced by
eNOS plays a crucial role in maintaining an anti-apoptotic environment in the vascular
endothelium and regulating the diameter of blood vessels [203]. eNOS-derived NO
stimulates the cell growth and proliferation, increases vascular permeability, dilates
blood vessels, thereby promoting blood vessel formation and increasing blood flow
[204, 205]. eNOS expression and activity are regulated at either transcriptional,
translational or post-translational levels, and phosphorylation is one post-translational
modification of eNOS. The activation of eNOS is dynamically regulated by
phosphorylation sites such as tyrosine, serine, and threonine residues [206]. Akt induces
eNOS activation via phosphorylating this enzyme at Ser617 and Ser1179, resulting in
the up-regulated eNOS activity, increased production of NO, and enhanced
40
angiogenesis [207-212].
Moreover, The VEGF protein family plays a crucial role in the regulation of
angiogenesis, Akt can promote angiogenesis through mTOR/p70S6K signaling cascade
[213]. VEGF is regulated by HIF-1 (hypoxia-inducible factor 1) in response to growth
stimulation or hypoxia stress. The Akt/mTOR/p70S6K signaling can trigger the
activation of HIF-1/VEGF and result in angiogenesis [214].
2.3.2.4 Enhancement of metastasis
The mTOR/P70S6K signaling activated by Akt kinase not only involved in the
regulation of angiogenesis but also plays a role in cell migration. The eNOS-derived
NO enhances cancer cell migration, and activated P70S6K can promote the actin
filaments remodeling and lead to an increase in cell migration [215, 216]. Moreover,
Akt signaling can increase the cell motility and production of MMP-9 (matrix
metallopeptidase 9) by promoting the transcriptional activity of NF-κB. MMP-9
expression then can further increase cancer cell invasion by the degradation of the
extracellular matrix [217, 218].
The epithelial-mesenchymal transition (EMT) is an essential process during
metastasis by which epithelial cells lose intercellular adhesion capabilities and acquire
increased motility - the properties of fibroblast-like cells [219]. In engineered squamous
cell carcinoma lines that constitutively express active Akt, the cells underwent EMT
and lost epithelial cell morphology [220]. E-cadherin is an important cell adhesion
molecule to help bind cells with each other. These engineered cells exhibit reduced cell-
41
cell adhesion, increased motility and invasiveness due to down-regulation of E-cadherin
[220]. The Akt-driven EMT has been reported in numerous human neoplasms such as
breast cancer, non-small cell lung cancer (NSCLC), and pancreatic cancer [221-223].
2.3.3 PTEN alteration
PTEN functions as a tumor suppressor and as the primary negative regulator of
PI3K/Akt signaling pathway. PTEN was first identified as a tumor suppressor gene in
1997 by three research groups simultaneously [224, 225]. Loss of PTEN is frequently
observed in numerous human cancers including histiocytic sarcoma [9, 18].
Pten gene is located on the human chromosome 10q23, and the protein encoded by
the Pten gene comprises of 403 amino-acids and contains both tensin-like domain and
phosphatase catalytic domain. The PTEN protein is a dual lipid and protein phosphatase
that capable of dephosphorylating phospho-lipids as well as phospho-peptides [181,
226]. The biological function of PTEN is dephosphorylating PIP3 back to PIP2, leading
to decreased signaling transduction via PIP3, thus acts as a negative regulator of the
PI3K/Akt signaling pathway [181, 227]. As a tumor suppressor, PTEN plays a vital role
in various biological processes via regulation of PI3K/Akt signaling pathway.
Inactivation mutations or deletion of PTEN lead to increased level of PIP3 and aberrant
activation of the PI3K/Akt signaling pathway that increases cell proliferation,
accelerates cell cycle and reduces cell death, all of which may eventually lead to tumor
formation. These PTEN mutations and deletions are frequently observed during tumor
development, including prostate cancer [228], breast cancer [229], ovarian cancer [230],
42
glioblastoma [231], lymphoid neoplasms [232], as well as histiocytic sarcoma [9, 18].
In addition to negatively regulating PI3K/Akt signaling pathway, inactivation of
PTEN enhances anti-apoptotic signaling. PTEN deletion impairs Fas-mediated
apoptosis in tans-genetic mice [233]. Moreover, loss of PTEN promotes activation of
Bcl-xl and Bcl-2, and other anti-apoptotic members of the Bcl-2 protein family [234].
The well-studied role of PTEN in tumorigenesis provides an essential weapon for
cancer defense. Transgenic over-expression of PTEN in the murine model shown a
modest increase of PTEN activity results in a substantial increase in cancer protection
[235]. Additionally, PTEN activity is associated with response to chemotherapy. PTEN
activation enhanced the tumor suppressive effect of drugs such as doxorubicin,
vincristine, and trastuzumab [234, 236], while suppression of PTEN increases drug
resistance [237].
2.3.4 Targeting PI3K/Akt signaling pathway in cancer therapy
The frequent observations of PTEN alterations and overactivation of the PI3K/Akt
pathway in wide variable human neoplasms make Akt as a potential therapeutic target
for anti-cancer drug discovery. Inhibition of PI3K/Akt signaling pathway can reverse
the anti-apoptotic effect of Akt and increase sensitivity to chemotherapeutic drugs.
2.3.4.1 Targeting upstream regulators of Akt
Receptor tyrosine kinases inhibition
Receptor tyrosine kinases (RTKs) are cell surface receptors responsible for
43
extracellular signal transduction, with approximately 20 RTK families have been
identified so far. RTKs are not only the critical regulators of normal cellular functions
but also related to tumorigenesis of a variety of human cancers [238]. In general, the
inhibition of RTKs impedes their activation by ligands such as growth factors and
cytokines, and promotes receptor internalization, thereby downregulates kinase
autophosphorylation and activation.
The most prominent RTK-targeted therapies in clinical practice and trials are EGFR
(epidermal growth factor receptor) and HER2/ErbB2 tyrosine kinase inhibitors (TKIs).
EGFR inhibitor ZD-1839 (gefitinib) and OSI-774 (erlotinib) have shown significant
anti-tumor activity in patients diagnosed with NSCLC. First-line treatment with these
EGFR inhibitors leads to prolonged progression-free survival (PFS) versus
conventional chemotherapy [239, 240]. The second generation EGFR TKI afatinib
significantly improved PFS and health-related quality of life in phase III trials in
NSCLC patients with specific EGFR mutations [241]. Recently, afatinib has been
approved by the U.S. Food and Drug Administration (FDA) for first-line treatment of
NSCLC. The aforementioned TKIs potently inhibit EDFR and HER2/ErbB2 leads to
the reduced Akt kinase activity, thereby inducing apoptosis and inhibiting tumor growth
[242, 243].
PI3K inhibition
Wortmannin and LY294002 are two widely used PI3K inhibitors. Wortmannin and
LY294002 are both ATP-competitive inhibitors and wortmannin covalently binding to
44
lysine residues on the ATP-binding site and leading to irreversible inhibition of PI3K
activity, whereas LY294002 blocks the enzymatic activity of PI3K reversibly. Although
wortmannin and LY294002 alone have shown anti-proliferative and pro-apoptotic
activities in the laboratory setting, combinations of wortmannin or LY294002 with
conventional therapeutic approaches promotes the effectiveness of these treatments
[244].
It is noteworthy that wortmannin and LY294002 have no selectivity for different
class I PI3K members. Wortmannin inhibits class III PI3K, and LY294002 inhibits
casein kinase 2 as well [245, 246]. Non-selective inhibition of PI3K may result in
undesirable side effects, in addition to the insolubility of wortmannin and LY294002 in
an aqueous environment, limit their use in clinical settings.
Recently, several selective PI3K inhibitors have been described, such as buparlisib and
idelalisib. Buparlisib is in Phase III clinical trials for patients with breast cancer.
Idelalisib, specific inhibitor of the p110δ subunit of PI3K, has been approved by FDA
for chronic lymphocytic leukemia treatment in combination with rituximab, and it is
also in Phase II trials for Hodgkin's lymphoma [247].
PDK1 inhibition
PDK1 (3-phosphoinositide dependent kinase-1) is a serine/threonine protein kinase
that can phosphorylate the activation loop of Akt on residue Thr308 [13]. Therefore,
inhibition of PDK1 should significantly block activation of Akt. Numbers of PDK1
inhibitors were identified and had an IC50 range of 11-30 nM. These PDK1 inhibitors
45
effectively blocked Akt signaling and induced apoptosis in various tumor cell lines,
including PTEN-negative tumor cell lines [248].
UCN-01 is a staurosporine derivative, nonselective PDK1 inhibitor. UCN-01
potently inhibits PDK1 both in vitro and in vivo, and UCN-1 mediated PDK1 inhibition
were observed in murine and human tumor xenografts [249]. UCD-01 also has been
evaluated in clinical trials in combination with conventional chemotherapy. However,
the anti-tumor activities were diminished due to constitutive activation of Akt in
advanced cancer patients [250].
2.3.4.2 Akt inhibition
As above mentioned, Akt signaling protects tumor cell from death by suppressing
apoptotic pathway, and Akt are overexpressed in various human cancers. Hence, the
Akt inhibition has been extensively studied as a weapon to defeat cancers.
Perifosine is an Akt inhibitor which is known initially as a CDK inhibitor that inducing
cell cycle arrest via p21Cip1/WAF1 [251]. A recent study demonstrated that perifosine
inhibits Akt phosphorylation by suppressing membrane translocation of Akt, and it is
under phase II clinical trials for patients with ovarian and endometrial cancers [252,
253]. GSK690693 is another pan-Akt inhibitor that displays significant anti-cancer
activity in vitro and in vivo with limited side effect observed [254, 255].
However, non-selective pan-Akt inhibition leads to more undesirable off-target
effects, whereas specific Akt inhibition could achieve clinical efficacy without
significant side effects. Akt kinase inhibitor TCN/API-2 inhibits Akt explicitly and
46
effectively, and appears to induce apoptosis and anti-proliferation effect at a
concentration of 10 μM. Moreover, TCN/API-2 significantly inhibited tumor growth in
human cancer xenografts without detectable side effects [256].
2.3.4.3 Targeting downstream signaling molecules of Akt
A number of molecules downstream of Akt were identified responsible for
intracellular signaling transduction. It is doubted that inhibition of one or two Akt
downstream target could effectively abolish the overactivation of Akt in human cancers.
However, studies have shown that inhibition of mTOR leading to apoptosis and cell
cycle arrest in Akt overexpression tumors [202]. Rapamycin and its derivatives CCI-
779 and RAD-001 are mTOR kinase inhibitor and display significant anti-cancer
activity. CCI-799 (Temsirolimus) showed anti-tumor activity and improved survival in
a clinical trial in patients with advanced patients with advanced refractory renal cell
carcinoma [257]. Inhibition of mTOR by RAD-001 (Everolimus) inhibited proliferation,
induced apoptosis, and ultimately reversed prostate neoplasm in Akt1 transgenic mice
[258]. Temsirolimus and Everolimus are in phase III and phase II clinical trials.
Although rapamycin is used as an immunosuppressive drug, no immunosuppressive
effects were observed in patients administrated with rapamycin analogs Temsirolimus
and Everolimus [259].
Collectively, Akt represents a potential therapeutic target for anti-tumor drug
discovery. The understanding of the PI3K/Akt pathway, mechanisms of Akt regulated
cellular functions, and discovery of small molecule Akt inhibitors developed
47
remarkably. More and more Akt indirect and direct inhibitors entered clinical trials and
approved for cancer therapy. However, critical issues regarding Akt specificity and
selectivity remain unsolved. Akt inhibition in combination with inhibition of another
signaling pathway may represent an attractive therapeutic strategy for cancer
management. Furthermore, Akt inhibition in combination with conventional
therapeutic approaches, such as chemotherapy and radiotherapy, may provide more
effective treatment to help to overcome drug resistance, prolong PFS and improve
quality of life for cancer patients.
48
CHAPTER 3
Targeting PI3K/Akt Signaling Pathway in Canine Histiocytic Sarcoma
3.1 Introduction
So far, there is no effective therapy against histiocytic sarcoma in both human and
canine patients. The goal of our study is to develop a novel therapeutic strategy for
histiocytic sarcoma. The therapeutic effect of Akt-targeted therapy in histiocytic
sarcoma was investigated both in vitro and in vivo. Also, the therapeutic effect of Akt
inhibition alone was compared to combinatorial treatment with carfilzomib, an FDA
approved anti-cancer drug for multiple myeloma. Furthermore, we investigated the
mechanism underlying Akt inhibition and carfilzomib induced anti-cancer activity.
3.2 Material and Methods
3.2.1 Cell line and culture
The canine histiocytic sarcoma cell line DH82 and canine peripheral blood
mononuclear cells were used in this study. DH82 cells were purchased from American
Type Culture Collection (ATCC®-CRL-10389™, Manassas, VA), and then cultured in
Minimum Essential Media (MEM, Gibco, Grand Island, NY) supplemented with 15%
fetal bovine serum (FBS, Gibco, Grand Island, NY) and 1X Anti-Anti (Gibco, Grand
Island, NY) in a humidified incubator with 5% CO2 at 37°C.
Canine peripheral blood mononuclear cells were freshly isolated from canine
49
cancer patients with no evidence of disease and under no treatment (chemotherapy,
kinase therapy, corticosteroid, or experimental therapies), using a previously described
methodology [55]. Peripheral blood collections were performed with owners’ informed
consent and approved by our institution’s Institutional Animal Care and Use Committee
(IACUC). The peripheral blood sample was collected in EDTA, mixed 1:1 with Hank's
Balanced Salt Solution (HBSS) and centrifuged on the top of 1/2 volume of Histopaque-
1077 (Sigma-Aldrich Inc., St. Louis, MO). After centrifugation, the mononuclear layer
was transferred to a new 50 ml tube and washed with 30 ml HBSS/EDTA three times.
Then cells were incubated with 3 ml Ack Lysing Buffer (Gibco, Grand Island, NY) for
3 minutes at room temperature. After that, cells were washed and resuspended in RPMI-
1640 (Gibco, Grand Island, NY) supplemented with 10% FBS and 1X Anti-Anti in a
humidified incubator with 5% CO2 at 37°C for 2 hours; floating cells were discarded
and fresh growth medium was provided. After 24 hours, 25 μg/ml Flt3L, 20 μg/ml IL-
4 and 20 μg/ml GM-CSF (Genscript, Piscataway, NJ) were added to the growth medium
(day 1). Growth medium and cytokines were refreshed every three days, and
differentiated dendritic cells were harvested on day 7. Differentiation to dendritic cells
was confirmed via flow cytometry. To eliminate the influence of cytokines on activation
of PI3K/Akt signaling pathway, differentiated dendritic cells were cultured in fresh
growth medium containing no cytokines for 3 h after dendritic cell differentiation.
3.2.2 Reagents
PI3K/Akt signaling pathway inhibitor LY294002 (Cell Signaling Technology,
50
Beverly, MA), proteasome inhibitor carfilzomib and doxorubicin (Biovision, Milpitas,
CA) were reconstituted in dimethyl sulfoxide (DMSO, Sigma-Aldrich Inc., St. Louis,
MO) at a concentration of 10 mM, 10 mg/ml, and 10 mM, respectively. The aliquots
were stored at -20°C as a stock solution.
3.2.3 Cell viability assay
Cell viability was evaluated by Cell Proliferation Kit II (XTT, Roche Life Science,
Indianapolis, IN) according to the manufacturer’s instructions. Briefly, DH82 cells were
plated in a 96-well plate and cultured in the normal condition for 24 hours. Then cells
were treated with either DMSO (vehicle control) or LY294002 at the concentration of
10, 25, 50, 75 and 100 μM, or carfilzomib at the concentration of 0.005, 0.025, 0.05,
0.25 and 0.5 μg/ml for 24 hours. Afterward, 50 μl XTT labeling mixture was added to
each well after treatment and cells were incubated at 37°C and 5% CO2 for 4 hours.
Cells were then shaken for 1 minute, and the absorbance of each well was measured at
a wavelength of 570 nm using Multiskan FC microplate spectrophotometer (Thermo
Scientific, Waltham, MA).
3.2.4 Flow cytometry
Apoptosis was evaluated using flow cytometry and the FITC Annexin V/Dead Cell
Apoptosis Kit (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.
Briefly, DH82 cells were plated in 6-well plate and treated with DMSO and carfilzomib
as aforementioned, or with carfilzomib in combination with 50 μM LY294002 for 24
51
hours. Cells were harvested and resuspended in 400 μl Annexin-binding buffer after
treatment. Then, 5 μl of FITC Annexin V and 1 μl of 100 μg/ml propidium iodide (PI)
working solution were added to cell suspensions. Afterward, cell suspensions were
incubated at room temperature for 15 minutes in the dark for staining. Stained cells
were then analyzed by flow cytometry. Annexin V positive cells were considered as
early apoptosis and Annexin V/PI double positive cells were considered as late
apoptosis.
The differentiation of dendritic cells were verified by flow cytometry using cell
surface marker CD11c-APC and CD1a-PE (GeneTex, Irvine, CA) according to the
manufacturer’s instructions. Briefly, differentiated dendritic cells were suspended in
100 μl binding buffer. Then 10 μl of CD11c-APC and CD1a-PE working solution were
added to cell suspensions, and incubated at room temperature for 15 minutes in the dark
for staining. Stained cells were then analyzed by flow cytometry.
3.2.5 Serum starvation test
DH82 cells were plated in 96-well plate and cultured in the normal condition for
24 hours. Then the growth medium were replaced by MEM supplemented with 1X
Anti-Anti and 0%, 1%, 5%, 10% and 15% FBS, respectively (day 0). Growth medium
was refreshed daily, cell viability was evaluated as above described on day 1, day 2,
day 3, and day 4, respectively.
52
3.2.6 RT-PCR
Expression of PTEN mRNAs in DH82 cells and eight clinical tumor samples from
dogs diagnosed with HS were evaluated using reverse transcription-polymerase chain
reaction (RT-PCR). Trizol (Invitrogen, Carlsbad, CA) was used for isolation of total
RNA. The quantity and quality of isolated RNA were assessed by spectrophotometer at
A260/A280 (ratio had to be between 1.8 and 2.0). Reverse transcription for cDNA
synthesis was performed using ThermoScriptTM Reverse Transcriptase (Invitrogen,
Carlsbad, CA) according to the manufacturer’s instruction. All target primer sequences
were designed by Primer 3 Plus (http://primer3plus.com/cgi-bin/dev/primer3plus.cgi)
and synthesized by Invitrogen (Carlsbad, CA). Primer sequences were listed in Table
3.1. PCR was performed using Taq DNA Polymerase (Invitrogen, Carlsbad, CA)
according to the manufacturer’s instructions. All cDNA samples were subjected to
initial denaturation at 95°C for 3 minutes, then 35 cycles of denaturation at 95°C for 45
seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds,
followed by final extension at 72°C for 10 minutes. PCR products were subjected to
agarose gel electrophoresis and visualized by ethidium bromide staining under
ultraviolet light. All PCR products were sequenced by Sanger sequencing.
Expression of caspase-3 was evaluated using quantitative RT-PCR. The DH82
cells were treated with LY294002 and carfilzomib at indicated concentration and
prepared for RNA extraction and quality examination as aforementioned. The qRT-
PCR was performed using CellsDirectTM One-Step qRT-PCR Kit (Invitrogen, Carlsbad,
CA) and reactions were run on 7500 Fast Real-Time PCR System (Applied Biosystems,
53
Foster City, CA) in the fast model. The reaction profile consisted of incubation at 50°C
for 5 minutes, initial denaturation at 95°C for 2 minutes, and 45 cycles of denaturation
at 95°C for 3 seconds and annealing/extension at 60°C for 30 seconds. The cDNA
synthesis was quantified using TaqManTM gene expression assay (Applied Biosystems,
Foster City, CA). Relative expression of the caspase-3 (Assay ID: Cf02622236_m1)
was calculated using the ΔΔCt method. In the ΔΔCt method, the expression of the target
gene was normalized by the housekeeping gene HPRT1 (Assay ID: Cf02690456_g1)
first (ΔCt), and then the difference between experimental and control groups (ΔΔCt)
was calculated. The fold-change in expression of the target gene equal to 2-ΔΔCt.
Table 3.1. Primer sequences.
Gene Primer sequence (5’-3’) Length of product (bp)
PTEN F: TGGTCTGCCAGCTAAAGGTG
R: AGGTTTCCTCTGGTCCTGGT 213
HPRT1 F: TTCTTTGCTGACCTGCTGGA
R: GGTCCTTTTCACCAGCAAGC 285
3.2.7 Western blot
Protein was extracted from DH82 cells, differentiated canine dendritic cells, 10
tumor tissue samples from dogs diagnosed with HS, and tumor tissues from DH82
xenograft mouse model using 200 μl cell lysis buffer supplemented with 1X PMSF and
1X phosphatase inhibitor cocktail (Cell Signaling Technology, Beverly, MA). The
54
protein concentration of each lysate was determined using the BCA Protein Assay Kit
(Cell Signaling Technology, Beverly, MA) according to manufacturer’s instructions,
and 20 µg of protein was used for each sample. Protein extracts were mixed with 5X
loading buffer, 10X sample reducing agent (Life Technologies, Grand Island, NY) and
double distilled H2O (ddH2O). Mixed loading samples were denatured at 95°C for 10
minutes and placed on ice for 10 minutes, then subjected to 4-12% SDS-PAGE
polyacrylamide gel electrophoresis (Life Technologies, Grand Island, NY), and
electrotransferred to nitrocellulose membranes (Life Technologies, Grand Island, NY).
Membranes were blocked with blocking buffer (LI-COR Bioscience, Lincoln, NE,
USA) for 1 h at room temperature. Membranes were incubated at 4°C overnight with
primary antibodies against β-actin, Akt, phospho-Akt S473, GSK3β, phospho-GSK3β
S9, PTEN, caspase-3 and PARP (Cell Signaling Technology, Beverly, MA) at a dilution
of 1:1,000 in blocking buffer. Membranes were washed 5 minutes for 3 times with
TBST and incubated with anti-rabbit or anti-mouse conjugate IgG (Cell Signaling
Technology, Beverly, MA) at a dilution of 1:10,000 in blocking buffer. The OdysseyTM
Infrared Imaging System (LI-COR Bioscience, Lincoln, NE) was used for protein
visualization and image capture. The analysis of protein expression was carried out by
quantification of grayscale values of the protein bands using Image Studio Lite software
version 5.2.5 (LI-COR Bioscience, Lincoln, NE).
3.2.8 Akt kinase activity assay
Akt kinase activity was evaluated using a commercially available Akt Kinase
55
Assay Kit (Cell Signaling Technology, Beverly, MA) according to manufacturer’s
instructions. Briefly, DH82 cells were plated in T25 cell culture flask followed by
treatment with DMSO or 50 μM LY294002 for 24 hours. After treatment, the protein
was extracted as described above. Then 20 μl of immobilized antibody bead slurry was
added to 200 μl cell lysate and incubated overnight at 4°C with gentle shaking. Cell
lysate/immobilized antibody was centrifuged at 14,000 × g for 30 seconds at 4°C and
washed twice with 500 μl of cell lysis buffer. The pellet was resuspended in 50 μl of
kinase buffer supplemented with 1 μl of 10 mM ATP and 1μl of kinase substrate and
then incubated at 37°C for 30 minutes. After incubation, 25 μl 3X SDS sample buffer
was added to terminate the reaction. Protein expression of phospho-GSK3α/β was
evaluated by western blotting using antibodies targeting phospho-GSK3α/β as
described above, and β-actin was used as loading control.
3.2.9 Isobologram
DH82 cells were plated in a 96-well plate and treated with LY294002 and
carfilzomib at indicated concentrations alone or with LY294002 (0, 10, 25, 50, 75 and
100 μM) in combination with carfilzomib (0, 0.005, 0.025, 0.05, 0.25 and 0.5 μg/ml) in
a series of concentrations. After 24 hour treatment, cell viability assay was performed
as aforementioned. The combinatorial effect of LY294002 and carfilzomib was
analyzed by isobologram using CompuSyn software (ComboSyn Inc., Paramus, NJ).
56
3.2.10 Caspase-3 activity assay
Caspase-3 activity was tested using a Caspase-3 Colorimetric Assay Kit (MBL,
Nagoya, Japan) according to manufacturer’s instructions. Briefly, DH82 cells were
treated in T25 cell culture flask with DMSO, 50 μΜ LY294002, 0.025 μg/ml
carfilzomib, and 50 μΜ LY294002 plus 0.025 μg/ml carfilzomib, and protein was
extracted from the DH82 cells as described above. Then 50 μl protein samples and 50
μl of 2X reaction buffer containing 10 mM DTT were added to each well in 96-well
plate. Afterward, 5 μl of the caspase-3 substrate was added to each well, and the plate
was incubated at 37°C for 1h. To verify the detected signal by the assay is due to
caspase-3 protease activity, the treated protein samples were incubated with 1 μl of 1
mM Z-DEVD-FMK before adding substrate (negative control). After incubation, the
absorbance was measured at 400 nm using the Multiskan FC microplate
spectrophotometer (Thermo Scientific, Waltham, MA). All the measured caspase-3
activity were normalized according to protein concentration that quantified by BCA
protein assay.
3.2.11 DH82 xenograft mouse model
NOD scid gamma mice (NSG mice) were used to establish the DH82 xenograft
model. All experiments were performed under the approval of our institutional IACUC
and in compliance with Guide for the Care and Use of Laboratory Animals.
6-8 weeks old NSG mice were implanted subcutaneously in the right flank with 1.5 ×
106 DH82 cells suspended in Matrigel Matrix (Corning Life Sciences Inc., Corning,
57
NY) and randomly assigned to mock (control), LY294002 (25 mg/kg), carfilzomib (5
mg/kg), and LY294002 plus carfilzomib treatment groups (n = 8 mice/group). All the
mice were maintained under SPF condition and received irradiated diet and water ad
libitum and monitored three times per week. The tumor growth was measured over time
using a caliper, and tumor volumes were calculated according to the modified ellipsoid
formula:
V = length × width2/2 [mm3]
When the solid tumor reached a minimum of 5×5 mm in the top cross-sectional
area, the mice received the treatment above three times a week for two weeks
intraperitoneally. At 24 hours after the last treatment, the mice were euthanized and
blood, spleen, lung and tumor tissues were collected. One fraction of tumor tissue was
fixed in formalin and embedded in paraffin, the other fraction was flash frozen in liquid
nitrogen and stored at -80°C.
For survival analysis, all the treated tumor-bearing mice were carefully monitored
after treatment. Mice were euthanatized 60 days post-treatment or earlier for humane
reasons if tumors reach 18 mm in any given dimension or any health issue was observed.
3.2.12 Immunohistochemistry
Formalin-fixed and paraffin-embedded tissues were processed for histopathology
and hematoxylin and eosin (H&E) staining as previously described [260]. The paraffin-
embedded tissue blocks were sectioned at 5 μm and prepared for H&E staining. H&E
stained sections were evaluated, and necrosis in lung tissue was scored by a board-
58
certified veterinary pathologist. Immunohistochemical staining against canine CD18
(Cell Signaling Technology, Beverly, MA) at a dilution of 1:100 using standard
methodology was used to quantity metastasis in the lung.
3.2.13 LY294002 blood level quantification
Peripheral blood from NSG mice was collected via cardiac puncture blood
collection and stored in tubes with lithium heparin (Becton Dickinson Biosciences,
Franklin Lakes, NJ). Plasma was isolated by centrifugation at 2,000 × g for 10 minutes
using a refrigerated centrifuge. Blood concentration of LY294002 was detected by
liquid chromatography-mass spectrometry (LC-MS).
3.2.14 Statistical analysis
Experimental data were processed with GraphPad Prism 6 (GraphPad Software, La
Jolla, CA) and presented as the mean ± standard error (SD) of at least three independent
triplicates. Significance for individual data was analyzed by two-tailed Student’s t-test.
Multiple intergroup comparisons were assessed by one-way analysis of variance
(ANOVA) followed by Tukey post-test. Survival curves were constructed using the
Kaplan-Meier product limit method and compared by log-rank test. Difference between
groups at a value of p < 0.05 was considered as statistically significant.
59
3.3 Results
3.3.1 Akt signaling is activated in canine HS tumor samples despite the presence
of PTEN
In order to assess the activation status of Akt signaling in canine histiocytic
sarcoma (cHS), we performed immunoblotting for p-Akt S473 in 10 cHS clinical tumor
samples. Phospho-Akt S473 (upper band) was observed in 9 out of 10 tumor samples
(Figure 1A). The tumor suppressor PTEN is frequently mutated and reported to be
deleted in human and canine malignant tumors, including histiocytic sarcoma [18]. So,
we further tested PTEN expression in DH82 cells and cHS tumor samples at both the
mRNA and protein levels. PTEN mRNA was detected in all 10 of the tumor samples,
but not tested in DH82 cells (Figure 1B). Given that PTEN mRNA was not detected in
DH82 cells, the normal spleen tissue was used as a positive control when we tested
PTEN protein since PTEN is highly expressed in spleen tissue. Similar to the mRNA
results, PTEN protein was detected in spleen and all 10 of the tumor samples, but not
observed in DH82 cells (Figure 1C). Together, these data suggest that Akt signaling is
activated in DH82 cells partially associated with deletion of PTEN, and Akt signaling
is activated in cHS tumor samples at the presence of PTEN.
60
Figure 1. Akt activation and PTEN presence in DH82 cells and cHS clinical
tumor samples.
61
3.3.2 Akt signaling is aberrantly activated in DH82 cells
Canine histiocytic sarcoma is considered to originate from inactivated dendritic
cells [159]. To compare the baseline level of Akt activation in DH82 cells with normal
canine dendritic cells, we isolated peripheral blood monocytes from healthy dogs and
induced dendritic cell differentiation using a previously described method [55].
However, the cytokines used to induce dendritic cell differentiation were reported
activating Akt signaling in vitro [261, 262], indicating Akt signaling might be activated
during the dendritic cell differentiation. To minimize the impact of cytokines on Akt
activation, we removed cytokines dendritic cell differentiation and cultured cells in a
fresh growth medium for 3 hours. Western blotting showed that the baseline level of
Akt and GSK3β in DH82 cells is much higher than that in normal canine dendritic cells
(Figure 2A). Moreover, the protein p-Akt S473 and p-GSK3β S9 were highly
expressed in DH82 cells, but not expressed in normal dendritic cells (Figure 2A). These
results suggest that Akt signaling pathway is activated in DH82 cells, but not in normal
canine dendritic cells.
To exclude the Akt activation by external growth factors, we cultured the DH82
cells in a serum starvation condition. Significantly decreased cell viability in DH82
cells was observed in 0% of FBS groups start from day 2, and in the 1% FBS groups
start from day 3 (p < 0.05 and p < 0.05 vs. control, respectively; Figure 2B). At day 3,
DH82 cells demonstrated significantly decreased cell viability in 0% and 1% FBS
groups compared to the corresponding group on day 1 (p < 0.01 and p < 0.01,
respectively; Figure 2B). These results suggest that the significant reduction or
62
elimination of supplemented growth factors could result in decreased cell viability in
DH82 cells. We then compared the level of Akt S473 phosphorylation and Akt kinase
activity in DH82 cells cultured in 0% and 1% FBS at day 3 to that at day 1. At day 1,
the same level of Akt S473 phosphorylation and Akt kinase activity (shown as protein
level of p-GS3Kα/β) were observed in both 0% and 1% FBS groups when compared to
control group (Figure 2C). To our surprise, although cell viability of DH82 cells were
significantly decreased at day 3, the level of p-Akt S473 and Akt kinase activity in
DH82 cells cultured with 0% and 1% FBS remained the same as the control group, as
well as compared to the control group at day 1 (Figure 2C). These data suggest Akt
signaling is aberrantly and constitutively activated in DH82 cells.
63
Figure 2. Akt signaling is constitutively activated in DH82 cells.
64
3.3.3 Inhibition of Akt signaling leads to decreased cell viability in DH82 cells
The LY294002 was used to inhibit the PI3K/Akt signaling pathway in DH82 cells.
After 24 hours of treatment with LY294002, DH82 cells demonstrated a significant
decrease in cell viability in a dose-dependent manner (Figure 3A). Based on the XTT
assay, 50 μM of LY294002 efficiently lead to a decrease in cell viability (p < 0.01 vs.
control, Figure 3A), so the dose of 50 μM was used in the following experiments. Over
the course of 24 hours, LY294002 treatment resulted in a significant decrease in the
Akt S473 phosphorylation, as well as Akt downstream target p-GSK3β S9 (Figure 3B
upper panel). The protein level of p-Akt S473 decreased more than 30-fold in
LY294002 treated DH82 cells (p < 0.01 vs. control, Figure 3B lower panel). Moreover,
DH82 cells showed lower level of p-GSK3α/β after 24 hours of LY294002 treatment,
suggesting LY294002 effectively inhibited Akt kinase activity in DH82 cells (Figure
3C). Collectively, these data demonstrate that inhibition of Akt signaling could result
in significant proliferation inhibition in DH82 cells.
65
Figure 3. Pharmacological inhibition of PI3K/Akt signaling leads to decreased cell
viability in DH82 cells.
66
3.3.4 Inhibition of Akt signaling potentiates carfilzomib-induced apoptotic cell
death in DH82 cells
Carfilzomib (CFZ), an active proteasome inhibitor, which irreversibly inhibits
proteasome function, has been approved by the FDA for treatment of human multiple
myeloma. Inhibition of Akt signaling synergistically enhances carfilzomib-induced
anti-tumor activity were observed in human multiple myeloma cell lines [263]. We
tested if this synergistic effect between Akt inhibition and proteasome inhibition exists
in DH82 cells. After 24 hours of treatment, carfilzomib induced significantly decreased
cell viability in DH82 cells in a dose-dependent manner (Figure 4A) and accumulation
of poly-ubiquitinated protein in a time-dependent manner (DH82 cells were treated with
0.025 μg/ml of carfilzomib, Figure 4B). Based on these results, the concentration of
0.025 μg/ml was selected to treat the DH82 cells in following experiments.
Furthermore, both LY294002 and carfilzomib induced apoptosis in DH82 cells.
The apoptosis induced by carfilzomib was increased when in combination with
LY294002 (Figure 4C). Interestingly, DH82 cells displayed morphologic change after
carfilzomib treatment. A spindle cell morphology was observed in carfilzomib-treated
and combinatorial-treated cells (red arrows, Figure 4D).
We performed Isobologram to determine the combinatorial effect of LY294002
and carfilzomib on DH82 cell death. Isobologram analysis showed that all 5 of the
combination doses (shown in Table 3.2) were laid below the additive line, indicating
the combinatorial effect of LY294002 and carfilzomib are synergistic (Figure 4E).
67
These results suggest that Akt inhibition can synergistically augment carfilzomib-
induced apoptotic cell death in DH82 cells.
Table 3.2. Concentration combinations
LY294002 (μM) Carfilzomib (μg/ml)
Point 1 10 0.005
Point 2 25 0.025
Point 3 50 0.05
Point 4 75 0.25
Point 5 100 0.5
68
Figure 4. Inhibition of Akt synergistically potentiates carfilzomib-induced
apoptosis in DH82 cells.
69
3.3.5 Carfilzomib induces apoptosis in DH82 cells via a caspase-3 independent
pathway.
Apoptosis is characterized by mitochondrial failure and formation of the
apoptosome. As a result, activation of the caspase cascade leads to the cleavage of final
apoptosis executor caspase-3. We first tested the caspase-3 activation in DH82 cells.
The decreased protein level of procaspase-3 was observed in LY294002-treated cells,
but not in carfilzomib-treated group, suggesting carfilzomib may induce apoptotic cell
death via a caspase-3 independent manner (Figure 5A). The western blot results also
showed a lower level of p-Akt S473 in combinatorial-treated cells, indicating a further
inhibition of Akt signaling when cells treated with LY294002 plus carfilzomib.
However, a higher level of procaspase-3 was detected in combinatorial-treated cells
(Figure 5A). These results suggest LY294002 in a combination of carfilzomib could
further inhibit PI3K/Akt signaling pathway, but reduce the activation of caspase-3.
To test the effect of carfilzomib on the activation of caspase-3 directly, we
performed caspase-3 activity assay and used a caspase-3 inhibitor Z-DEVD-FMK to
manipulate caspase-3 activity. A significant increase in caspase-3 activity was observed
in LY294002-treated cells (p < 0.01 vs. control, Figure 5B), but carfilzomib treatment
did not affect the caspase-3 activity. Moreover, there was a significant reduction of
caspase-3 activity in the combinatorial-treated cells compared to the cells treated with
LY294002 alone (p < 0.01, Figure 5B). This is consistent with our previous western
blotting result that carfilzomib reversed the cleavage of procaspase-3 induced by
LY29402 (Figure 5A).
70
To verify that carfilzomib did not activate caspase-3 signaling in DH82 cells, we
used doxorubicin as a positive control to activate caspase-3 and used PAC-1
(procaspase-activating compound-1) to sensitize caspase-3 for activation [264]. The
western blotting result indicated that both LY294002 and doxorubicin can induce
cleavage of procaspase-3, which is reversed by the caspase-3 inhibitor Z-DEVD-FMK
(Figure 5C). Moreover, doxorubicin treatment also induced cleavage of PARP (Poly
(ADP-ribose) polymerase) - a downstream target of activated caspase-3. The
doxorubicin-induced activation of PARP is further enhanced by PAC-1 (Figure 5D).
However, carfilzomib treatment did not induce cleavage of procaspase-3, even under
the condition of sensitization of procaspase-3 by PAC-1 (Figure 5C and 5D). The
results of protein analysis were further verified in the caspase-3 activity assay. PAC-1
enhanced LY294002- and doxorubicin-induced caspase-3 activity, but had no effect on
carfilzomib (p < 0.05 and p < 0.01, respectively; Figure 5E). Quantitative RT-PCR was
used to test the caspase-3 mRNA expression. Intriguingly, LY294002 did not affect
caspase-3 gene expression, but carfilzomib treatment down-regulated caspase-3 mRNA
level (Figure 5F).
Collectively, these results indicate carfilzomib induces caspase-3 independent cell
death. Chemotherapeutics can induce tumor cell death via either caspase-3 dependent
or independent pathway. The caspase-3 independent apoptotic pathway exists in
mammalian cells, which may function as a backup mechanism to maintain homeostasis
when caspase-3 dependent pathway fails.
71
Figure 5. Carfilzomib does not induce caspase-3 activation.
72
3.3.6 LY294002 and carfilzomib are well tolerated in DH82 xenograft mice and
detectable in peripheral blood.
Although the above data demonstrated Akt inhibition effectively induced DH82
cell death in vitro, we verified the therapeutic effect of Akt inhibition in vivo using the
DH82 xenograft model. To evaluate the safety of the LY294002, carfilzomib and their
combination, healthy NSG mice (n=4 mice/group) received the treatments for 2 weeks.
All the treatments were well tolerated without significant body weight loss (Figure 6A).
To verify the absorbance of LY294002, we collected peripheral blood from the treated
tumor-bearing mice and quantified LY294002 by LC-MS. The LY294002 was detected
in blood samples. Moreover, difference in LY294002 concentration was not observed
between LY294002-treated mice and combinatorial-treated mice (p = 0.4846, Figure
6B), indicating carfilzomib did not affect the absorbance of LY294002.
73
Figure 6. The given treatments are well tolerated, and LY294002 are absorbed.
74
3.3.7 LY294002 inhibits cHS tumor cell growth in vivo.
To evaluate the in vivo therapeutic effect of Akt inhibition, we used a subcutaneous
xenograft model of canine HS in immunodeficient NSG mice [265]. Intraperitoneal
administration of LY294002 at a daily dose of 25 mg/kg, 3 days a week for 2 weeks
significantly reduced DH82 tumor growth versus vehicle control (on day 12, p < 0.01;
Figure 7A and 7B). Although carfilzomib treatment had no significant effect on tumor
growth, LY294002 in combination with carfilzomib prevented the tumor growth and
showed significantly smaller tumor compared to the other three groups (on day 12, p <
0.01 vs. control, p < 0.01 vs. LY294002 and p < 0.01 vs. CFZ, respectively; Figure 7A
and 7B). Importantly, the overall survival of LY294002-treated and combinatorial-
treated mice (with a median survival of 26 days and 35 days, respectively) were
significantly prolonged compared to mock-treated mice (p < 0.01 and p < 0.01 vs.
control, respectively; Figure 7C). The survival of combinatorial-treated mice was
significantly longer than that of carfilzomib-treated mice (p < 0.05, Figure 7C). The
detailed individual survival data were listed in Table 3.3.
We further examined the spleen tissue in our xenograft mice since splenomegaly
was reported in canine histiocytic sarcoma. The splenomegaly was observed in our
murine xenografts. All the treatments significantly ameliorated the splenomegaly,
showed as reduced spleen weight compared to mock-treated mice (p < 0.01, p < 0.05,
and p < 0.01 vs. control, respectively; Figure 7D).
To examine target inhibition by LY294002 in vivo, we performed western blotting
in tumor tissues. The protein level of p-Akt S473 was reduced in tumor tissues
75
harvested from LY294002-treated and combinatorial-treated mice (Figure 7E),
indicating suppression of tumor growth in DH82 xenografts is associated with
inhibition of Akt signaling. Furthermore, tumor tissues harvested from combinatorial-
treated mice showed a significantly lower level of p-Akt S473 compared to LY294002-
treated mice (p < 0.05, Figure 7E), which is consistent with in vitro result showed in
Figure 5A.
Table 3.3. Individual survival in DH82 xenograft mice.
Treatment group Median survival in days (95% CI)
Mock 5.00 (4.00, 9.00)
LY294002 26.00 (11.00, 35.00)**
Carfizomib 19.00 (7.00, 26.00)
LY294002 + Carfilzomib 35.00 (19.00, 35.00)**#
**: significant difference compared to the mock-treated mice, p<0.01
#: significant difference compared to the carfilzomib-treated mice, p<0.05
76
Figure 7. LY294002 inhibits tumor growth in cHS xenograft model.
77
3.3.8 LY294002 does not reduce lung metastasis and not increase necrosis in tumor
tissue.
Typically, metastasis may occur during the tumor development. Histopathological
evaluation of H&E stained section of lung tissues revealed lung metastasis in our
xenograft model (arrow, Figure 8A), which is further verified by immunohistochemical
staining using an antibody against canine CD18 (arrow, Figure 8B). To determine
whether Akt inhibition reduces the number of metastatic foci, we counted the total
number of metastatic tumors in lung tissue sections. The number of lung metastasis was
increased in carfilzomib-treated mice, but the difference in number of lung metastasis
between each treatment group was not statistically significant (Figure 8C). Moreover,
we observed necrosis in H&E stained tumor tissues, but there was still no significant
difference between each group (Figure 8D and 8E).
78
Figure 8. LY294002 not affects lung metastasis and tumor necrosis.
79
3.5 Discussion
Histiocytic sarcoma is an extremely rare tumor, and the clinical course is generally
aggressive. The overall rarity of this tumor obscured the diagnosis and prevented a full
appreciation of its clinical behavior [135, 136]. Canine HS is originated from histiocytes
including dendritic cells and macrophages, which is a spontaneously developed model
for better understanding human HS. Although the PI3K/Akt signaling pathway plays a
crucial role in many human and canine malignant tumors [172, 173], the role of Akt
signaling in both human and canine HS remains poorly studied. PTEN is the primary
negative regulator of the Akt signaling pathway and is frequently mutated and deleted
in both human and canine malignancies. Hedan et al. reported that PTEN is likely
deleted in 40% of 113 canine HS cases [9, 18, 266]. We used ten tumor samples from
canine patients diagnosed with HS to determine the activation status of Akt signaling
and PTEN alteration in canine HS. In the present study, we first demonstrated that the
tumor suppressor PTEN was deleted in DH82 cells at both the mRNA and protein levels.
However, PTEN mRNA and protein were detected in all 10 of the canine HS tumor
samples. Our results also demonstrated Akt signaling was activated in 9 out of 10 canine
HS cases, suggesting that Akt signaling involved in pathogenesis of canine HS despite
the presence of PTEN. These findings imply the potential efficacy of Akt-targeted
chemotherapeutic strategies for the clinical treatment of HS.
We used the DH82 cells as a cell line model of canine HS and induced dendritic
cell differentiation from canine peripheral blood mononuclear cells to compare the Akt
activation between HS and healthy condition in this study. The baseline level of Akt
80
signaling in DH82 cells and monocyte-derived dendritic cells were evaluated by
western blot using an antibody against p-Akt S473. Our results indicated that p-Akt
S473 was overexpressed in DH82 cells, but not detected in monocyte-derived dendritic
cells. The same scenario was observed in Akt downstream target p-GSK3β S9.
Collectively, these results suggest the PI3K/Akt signaling had not been activated in
normal canine dendritic cells, but aberrantly activated in DH82 cells. This further
supports the rationale of Akt-targeted therapy for HS.
The activation of Akt signaling requires the activation of upstream receptor
tyrosine kinases by growth factors [267]. The complete growth medium used for DH82
cell culture contained 15% of fetal bovine serum, which supplied plenty of exogenous
growth factors that activated the Akt signaling in DH82 cells. In order to exclude the
effect of exogenous growth factors on Akt signaling and verify the activation status of
Akt signaling in DH82 cells, we performed the serum starvation test. Beginning on day
3, a significant decrease in cell viability was observed in DH82 cells cultured with 0%
and 1% FBS, as compared to the control cells and the corresponding cells on day 1.
However, the protein level of p-Akt S473 and Akt kinase activity (indicated by the
protein level of p-GS3Kα/β) remained the same while the cell viability decreased
significantly. These results suggest that the Akt signaling pathway is constitutively
activated in DH82 cells even though there were no exogenous growth factors. These
findings also suggest to us that the Akt signaling by itself is not sufficient to guarantee
the cellular survival of DH82 cells. Other unknown factors required for cell
81
proliferation and survival besides Akt signaling need to be determined by further
research.
In order to determine the role of Akt signaling involved in cellular survival and
tumorigenesis of HS, we investigated the effects of Akt inhibition in DH82 cells using
Akt inhibitor LY294002. Our results demonstrated that pharmacological inhibition of
Akt signaling resulted in decreased Akt S473 phosphorylation and decreased Akt kinase
activity, and led to a significant decrease of cell viability in DH82 cells. These results
suggest that Akt signaling is crucially involved in cellular survival of canine HS. The
findings of our study coupled with the reported Akt inhibitors uesed in clinical
applications [20, 250, 252, 255] suggest Akt signaling pathway may represent a novel
potential therapeutic target for the clinical treatment of both human and canine HS.
The Akt signaling pathway is associated with multidrug resistance, which is a
considerable obstacle during tumor chemotherapy [268]. Meanwhile, Mimura et al.
reported Akt inhibition synergistically enhances carfilzomib-induced cytotoxicity in
human multiple myeloma cell lines [263]. In this study, we demonstrated that Akt
inhibition potentiated carfilzomib-induced apoptosis in DH82 cells, and the
combination of LY294002 and carfilzomib worked in a synergistic manner. We
postulated that inhibition of Akt pathway sensitize tumor cells to chemotherapy or
suppress the expression and function of chemoresistance factors, suggesting the
combination of Akt inhibitors and other anti-tumor chemotherapeutic drugs may
represent a potential strategy to overcome chemoresistances observed in both human
and canine cancers. Surprisingly, carfilzomib-treated cells showed a spindle cell
82
morphology. Further studies are required to reveal the mechanisms causing the
synergistic effect of Akt inhibition and proteasome inhibition and the carfilzomib-
induced morphological change in DH82 cells.
Apoptosis, also known as programmed cell death, is an important mechanism to
keep homeostasis in the body. The failure of apoptosis may result in prolonged cell
survival and excessive cell growth and, eventually, lead to tumorigenesis. The apoptotic
cell death can be triggered by intrinsic and extrinsic pathways. Both intrinsic and
extrinsic pathways can induce apoptosis by initiating activation of caspase-cascade and
thereby activating executioner caspase-3. To investigate the mechanism causing the
combinatorial effect of LY294002 and carfilzomib, we examined the activation of
caspase-3. Protein analysis revealed that LY294002 induced caspase-3 activation, but
carfilzomib did not. Interestingly, carfilzomib enhanced LY294002-induced Akt
inhibition, but attenuated LY294002-induced activation of caspase-3 at the same time.
The combinatorial effect of LY294002 and carfilzomib was also observed in caspase-3
activity assay, suggesting carfilzomib may induce caspase-3 independent apoptotic cell
death. Doxorubicin is a conventional chemotherapeutic drug that induces apoptotic cell
death in tumor cells, and PAC-1 is a recently discovered small molecule that sensitizes
caspase-3 for activation. We used doxorubicin as a positive control to verify the
activation of caspase-3. The doxorubicin-induced caspase-3 activation could be either
attenuated by caspase-3 inhibitor Z-DEVD-FMK or enhanced by caspase-3 sensitizer
PAC-1. However, Z-DEVD-FMK and PAC-1 showed no effect in carfilzomib-treated
cells. Moreover, quantitative RT-PCR revealed decreased caspase-3 mRNA in
83
carfilzomib-treated cells. These results suggest the existence of caspase-3 independent
apoptosis that may function as a backup mechanism when caspase-3 pathway fails.
LY294002 displayed great efficacy in Akt inhibition and inducing apoptosis in HS
in vitro. To investigate the therapeutic efficacy in vivo, we used a murine xenograft
model of canine HS. The treatments at indicated doses were well tolerated, and no
difference in absorbance of LY294002 was observed. LY294002 effectively reduced
tumor growth, prolonged the overall survival, and attenuated the splenomegaly via
inhibition of Akt signaling in vivo. However, carfilzomib only slightly ameliorated the
splenomegaly. Although LY294002 treatment showed admirable outcomes and
carfilzomib barely affected tumor development, the combinatorial treatment of
LY294002 and carfilzomib displayed the significantly better prognosis. Metastasis is
often observed during the clinical course of HS. We examined the lung metastasis and
necrosis in the tumor in xenograft mice using H&E staining. Additionally, we verified
lung metastasis using immunohistochemistry staining against canine CD18, but no
significant differences were found between each treatment group. Considering the low
average number of lung metastasis in mock-treated mice, the therapeutic effect of Akt
inhibition on lung metastases should be further studied.
Our data demonstrated Akt activation in the presence of PTEN in 10 canine HS
tumors. Considering the sample size was small, the activation status of Akt and
presence of PTEN need to be evaluated in a large dataset of HS tumor samples.
Moreover, the status of Akt activation and the effect of Akt inhibition were tested only
in DH82 cells in vitro and in vivo. The role of Akt signaling involved in cellular survival
84
and tumorigenesis of HS need to be further verified in an extensive range of HS cell
lines and animal models. Although we revealed the Akt signaling was barely active in
normal canine dendritic cells, the effects of Akt inhibition on cellular functions were
not determined due to the limit acquisition of peripheral blood from healthy dogs.
LY294002 is a widely used non-selective Akt inhibitor. Although it was well tolerated
in experimental mice without observed side effects in two weeks, the safety of Akt
inhibition should be determined in a long time exposure. Recently, many selective small
molecule inhibitors of Akt have been discovered and displayed anti-cancer activities.
Future studies are needed to validate the therapeutic effect and efficacy of these new
Akt inhibitors in HS treatment.
In conclusion, we demonstrated that Akt signaling was aberrantly and
constitutively activated in DH82 cells due to the mutation of the tumor suppressor
PTEN. However, Akt signaling was activated in canine HS tumor samples despite the
presence of PTEN. Akt inhibition led to decreased cell viability in DH82 cells, as well
as enhanced carfilzomib-induced cytotoxicity. Our results suggest that Akt signaling
supports the cellular survival and pathogenesis of histiocytic sarcoma in vitro, and
suggest Akt inhibition synergistically potentiate carfilzomib-induced caspase-3
independent apoptotic cell death. The in vivo experiments using murine xenograft
model verified the therapeutic efficacy of Akt inhibition, which is enhanced by the
combinatorial administration of carfilzomib. The in vitro and in vivo data provide an
attractive target for the development of novel chemotherapeutic drugs and bring up
85
combinatorial therapeutic strategies using Akt inhibitors and other anti-cancer drugs for
HS treatment.
86
CHAPTER 4
Conclusion and Future Directions
In the present study, we demonstrated that Akt signaling is aberrantly and
constitutively activated in canine histiocytic sarcoma and the Akt-targeted anti-cancer
therapy is a promising approach for canine histiocytic sarcoma, especially when used
in combination with other anti-cancer drugs.
The PI3K/Akt inhibitor LY294002 effectively inhibited HS cell growth both in
vitro and in vivo. Proteasome inhibitor carfilzomib, an FDA-approved anti-cancer agent
for human multiple myeloma treatment, also induced growth inhibition of HS cells in
vitro. Moreover, the anti-cancer activity of carfilzomib was potentiated when used in
combination with LY294002 in our cell line model and HS xenograft model. This was
particularly demonstrated in our in vivo experiments, where carfilzomib treatment did
not result in any tumor growth inhibition, but Akt inhibition in combination with
carfilzomib treatment, resulted in significant tumor response and prolonged survival.
This further supports our hypothesis that Akt inhibition may have a certal role in the
treatment of Histiocytic Sarcoma.
Although the LY294002 was absorbed and was well tolerated in our murine
xenografts, the unfavorable pharmacokinetic properties and high toxicity profile of this
compound has impeded the broad application of LY294002 in vivo. Recently, more and
more Akt inhibitory compounds were discovered and were used in clinical trials. Anti-
87
cancer drug screening experiments using Akt-targeted compounds can be used to
evaluate the therapeutic effect of these compounds on canine HS in vitro. Murine
xenograft models are helpful to verify the potential anti-cancer effect in vivo and to
evaluate the safety of these Akt inhibitors, thereby following clinical trials in canine
patients with HS can be performed. Ultimately, I hope the results from my studies can
be translated to clinical use in treatment for not only dogs with HS, but also for humans
with this devastating disease.
88
REFERENCES
1. Filipovich, A., K. McClain, and A. Grom, Histiocytic disorders: recent insights
into pathophysiology and practical guidelines. Biol Blood Marrow Transplant,
2010. 16(1 Suppl): p. S82-9.
2. Takahashi, E. and S. Nakamura, Histiocytic sarcoma : an updated literature
review based on the 2008 WHO classification. J Clin Exp Hematop, 2013. 53(1):
p. 1-8.
3. Hornick, J.L., E.S. Jaffe, and C.D. Fletcher, Extranodal histiocytic sarcoma:
clinicopathologic analysis of 14 cases of a rare epithelioid malignancy. Am J
Surg Pathol, 2004. 28(9): p. 1133-44.
4. Tomita, S., G. Ogura, C. Inomoto, et al., Histiocytic Sarcoma Originating in the
Lung in a 16-Year-Old Male. J Clin Exp Hematop, 2015. 55(1): p. 45-9.
5. Cattoretti, G., A. Villa, P. Vezzoni, et al., Malignant histiocytosis. A phenotypic
and genotypic investigation. Am J Pathol, 1990. 136(5): p. 1009-19.
6. Gonzalez, C.L. and E.S. Jaffe, The histiocytoses: clinical presentation and
differential diagnosis. Oncology (Williston Park), 1990. 4(11): p. 47-60;
discussion 60, 62.
7. Lauritzen, A.F., G. Delsol, N.E. Hansen, et al., Histiocytic sarcomas and
monoblastic leukemias. A clinical, histologic, and immunophenotypical study.
Am J Clin Pathol, 1994. 102(1): p. 45-54.
8. Rowell, J.L., D.O. McCarthy, and C.E. Alvarez, Dog models of naturally
89
occurring cancer. Trends Mol Med, 2011. 17(7): p. 380-8.
9. Hedan, B., R. Thomas, A. Motsinger-Reif, et al., Molecular cytogenetic
characterization of canine histiocytic sarcoma: A spontaneous model for human
histiocytic cancer identifies deletion of tumor suppressor genes and highlights
influence of genetic background on tumor behavior. BMC Cancer, 2011. 11: p.
201.
10. Alvarez, C.E., Naturally occurring cancers in dogs: insights for translational
genetics and medicine. ILAR J, 2014. 55(1): p. 16-45.
11. Bruner, S.R., Updates in therapeutics for veterinary dermatology. Vet Clin
North Am Small Anim Pract, 2006. 36(1): p. 39-58, vi.
12. Abadie, J., B. Hedan, E. Cadieu, et al., Epidemiology, pathology, and genetics
of histiocytic sarcoma in the Bernese mountain dog breed. J Hered, 2009. 100
Suppl 1: p. S19-27.
13. Hemmings, B.A. and D.F. Restuccia, PI3K-PKB/Akt pathway. Cold Spring Harb
Perspect Biol, 2012. 4(9): p. a011189.
14. Cantley, L.C., The phosphoinositide 3-kinase pathway. Science, 2002.
296(5573): p. 1655-7.
15. Guerrero-Zotano, A., I.A. Mayer, and C.L. Arteaga, PI3K/AKT/mTOR: role in
breast cancer progression, drug resistance, and treatment. Cancer Metastasis
Rev, 2016. 35(4): p. 515-524.
16. Sun, Z., Z. Wang, X. Liu, et al., New development of inhibitors targeting the
PI3K/AKT/mTOR pathway in personalized treatment of non-small-cell lung
90
cancer. Anticancer Drugs, 2015. 26(1): p. 1-14.
17. Fowles, J.S., C.L. Denton, and D.L. Gustafson, Comparative analysis of MAPK
and PI3K/AKT pathway activation and inhibition in human and canine
melanoma. Vet Comp Oncol, 2015. 13(3): p. 288-304.
18. Carrasco, D.R., T. Fenton, K. Sukhdeo, et al., The PTEN and INK4A/ARF tumor
suppressors maintain myelolymphoid homeostasis and cooperate to constrain
histiocytic sarcoma development in humans. Cancer Cell, 2006. 9(5): p. 379-90.
19. Falasca, M., PI3K/Akt signalling pathway specific inhibitors: a novel strategy
to sensitize cancer cells to anti-cancer drugs. Curr Pharm Des, 2010. 16(12): p.
1410-6.
20. Kumar, A., V. Rajendran, R. Sethumadhavan, et al., AKT kinase pathway: a
leading target in cancer research. ScientificWorldJournal, 2013. 2013: p.
756134.
21. Cline, M.J., Histiocytes and histiocytosis. Blood, 1994. 84(9): p. 2840-53.
22. Emile, J.F., O. Abla, S. Fraitag, et al., Revised classification of histiocytoses and
neoplasms of the macrophage-dendritic cell lineages. Blood, 2016. 127(22): p.
2672-81.
23. Caux, C., I. Durand, I. Moreau, et al., Tumor necrosis factor alpha cooperates
with interleukin 3 in the recruitment of a primitive subset of human CD34+
progenitors. J Exp Med, 1993. 177(6): p. 1815-20.
24. Caux, C., C. Dezutter-Dambuyant, D. Schmitt, et al., GM-CSF and TNF-alpha
cooperate in the generation of dendritic Langerhans cells. Nature, 1992.
91
360(6401): p. 258-61.
25. Das, R., S. Ganapathy, M. Settle, et al., Plasminogen promotes macrophage
phagocytosis in mice. Blood, 2014. 124(5): p. 679-88.
26. Reis e Sousa, C., P.D. Stahl, and J.M. Austyn, Phagocytosis of antigens by
Langerhans cells in vitro. J Exp Med, 1993. 178(2): p. 509-19.
27. Ginhoux, F., S. Lim, G. Hoeffel, et al., Origin and differentiation of microglia.
Front Cell Neurosci, 2013. 7: p. 45.
28. Nathan, C., Metchnikoff's Legacy in 2008. Nat Immunol, 2008. 9(7): p. 695-8.
29. Gordon, S. and P.R. Taylor, Monocyte and macrophage heterogeneity. Nat Rev
Immunol, 2005. 5(12): p. 953-64.
30. Gordon, S., A. Pluddemann, and F. Martinez Estrada, Macrophage
heterogeneity in tissues: phenotypic diversity and functions. Immunol Rev, 2014.
262(1): p. 36-55.
31. Mosser, D.M. and J.P. Edwards, Exploring the full spectrum of macrophage
activation. Nat Rev Immunol, 2008. 8(12): p. 958-69.
32. Schenk, M., M. Fabri, S.R. Krutzik, et al., Interleukin-1beta triggers the
differentiation of macrophages with enhanced capacity to present
mycobacterial antigen to T cells. Immunology, 2014. 141(2): p. 174-80.
33. Batista, F.D. and N.E. Harwood, The who, how and where of antigen
presentation to B cells. Nature Reviews Immunology, 2009. 9(1): p. 15-27.
34. Gaya, M., A. Castello, B. Montaner, et al., Host response. Inflammation-induced
disruption of SCS macrophages impairs B cell responses to secondary infection.
92
Science, 2015. 347(6222): p. 667-72.
35. Harvey, B.P., R.J. Gee, A.M. Haberman, et al., Antigen presentation and
transfer between B cells and macrophages. European Journal of Immunology,
2007. 37(7): p. 1739-1751.
36. Khazen, W., P. M'Bika J, C. Tomkiewicz, et al., Expression of macrophage-
selective markers in human and rodent adipocytes. FEBS Lett, 2005. 579(25):
p. 5631-4.
37. Moganti, K., F. Li, C. Schmuttermaier, et al., Hyperglycemia induces mixed
M1/M2 cytokine profile in primary human monocyte-derived macrophages.
Immunobiology, 2017. 222(10): p. 952-959.
38. Hesketh, M., K.B. Sahin, Z.E. West, et al., Macrophage Phenotypes Regulate
Scar Formation and Chronic Wound Healing. Int J Mol Sci, 2017. 18(7).
39. Mills, C.D., M1 and M2 Macrophages: Oracles of Health and Disease. Crit Rev
Immunol, 2012. 32(6): p. 463-88.
40. Labonte, A.C., A.C. Tosello-Trampont, and Y.S. Hahn, The role of macrophage
polarization in infectious and inflammatory diseases. Mol Cells, 2014. 37(4): p.
275-85.
41. Parisi, L., E. Gini, D. Baci, et al., Macrophage Polarization in Chronic
Inflammatory Diseases: Killers or Builders? J Immunol Res, 2018. 2018: p.
8917804.
42. Liu, Y.C., X.B. Zou, Y.F. Chai, et al., Macrophage polarization in inflammatory
diseases. Int J Biol Sci, 2014. 10(5): p. 520-9.
93
43. Galdiero, M.R., C. Garlanda, S. Jaillon, et al., Tumor associated macrophages
and neutrophils in tumor progression. J Cell Physiol, 2013. 228(7): p. 1404-12.
44. Noy, R. and J.W. Pollard, Tumor-associated macrophages: from mechanisms to
therapy. Immunity, 2014. 41(1): p. 49-61.
45. Fujimura, T., Y. Kambayashi, Y. Fujisawa, et al., Tumor-Associated
Macrophages: Therapeutic Targets for Skin Cancer. Front Oncol, 2018. 8: p. 3.
46. Chanmee, T., P. Ontong, K. Konno, et al., Tumor-Associated Macrophages as
Major Players in the Tumor Microenvironment. Cancers, 2014. 6(3): p. 1670-
1690.
47. Riabov, V., A. Gudima, N. Wang, et al., Role of tumor associated macrophages
in tumor angiogenesis and lymphangiogenesis. Front Physiol, 2014. 5: p. 75.
48. Linde, N., W. Lederle, S. Depner, et al., Vascular endothelial growth factor-
induced skin carcinogenesis depends on recruitment and alternative activation
of macrophages. J Pathol, 2012. 227(1): p. 17-28.
49. Baay, M., A. Brouwer, P. Pauwels, et al., Tumor Cells and Tumor-Associated
Macrophages: Secreted Proteins as Potential Targets for Therapy. Clinical &
Developmental Immunology, 2011.
50. Liu, M., F. Luo, C. Ding, et al., Dectin-1 Activation by a Natural Product beta-
Glucan Converts Immunosuppressive Macrophages into an M1-like Phenotype.
J Immunol, 2015. 195(10): p. 5055-65.
51. Tan, H.Y., N. Wang, K. Man, et al., Autophagy-induced RelB/p52 activation
mediates tumour-associated macrophage repolarisation and suppression of
94
hepatocellular carcinoma by natural compound baicalin. Cell Death Dis, 2015.
6: p. e1942.
52. Bernhard, H., E.S. Huseby, S.L. Hand, et al., Dendritic cells lose ability to
present protein antigen after stimulating antigen-specific T cell responses,
despite upregulation of MHC class II expression. Immunobiology, 2000. 201(5):
p. 568-82.
53. Itano, A.A., S.J. McSorley, R.L. Reinhardt, et al., Distinct dendritic cell
populations sequentially present antigen to CD4 T cells and stimulate different
aspects of cell-mediated immunity. Immunity, 2003. 19(1): p. 47-57.
54. Dalod, M., R. Chelbi, B. Malissen, et al., Dendritic cell maturation: functional
specialization through signaling specificity and transcriptional programming.
EMBO J, 2014. 33(10): p. 1104-16.
55. Catchpole, B., A.J. Stell, and J.M. Dobson, Generation of blood-derived
dendritic cells in dogs with oral malignant melanoma. J Comp Pathol, 2002.
126(2-3): p. 238-41.
56. Poulin, L.F., M. Salio, E. Griessinger, et al., Characterization of human DNGR-
1+ BDCA3+ leukocytes as putative equivalents of mouse CD8alpha+ dendritic
cells. J Exp Med, 2010. 207(6): p. 1261-71.
57. Ziegler-Heitbrock, L., P. Ancuta, S. Crowe, et al., Nomenclature of monocytes
and dendritic cells in blood. Blood, 2010. 116(16): p. e74-80.
58. Guilliams, M., F. Ginhoux, C. Jakubzick, et al., Dendritic cells, monocytes and
macrophages: a unified nomenclature based on ontogeny. Nat Rev Immunol,
95
2014. 14(8): p. 571-8.
59. Collin, M., N. McGovern, and M. Haniffa, Human dendritic cell subsets.
Immunology, 2013. 140(1): p. 22-30.
60. Robbins, S.H., T. Walzer, D. Dembele, et al., Novel insights into the
relationships between dendritic cell subsets in human and mouse revealed by
genome-wide expression profiling. Genome Biology, 2008. 9(1).
61. Crozat, K., R. Guiton, M. Guilliams, et al., Comparative genomics as a tool to
reveal functional equivalences between human and mouse dendritic cell subsets.
Immunological Reviews, 2010. 234: p. 177-198.
62. Haniffa, M., A. Shin, V. Bigley, et al., Human Tissues Contain CD141(hi)
Cross-Presenting Dendritic Cells with Functional Homology to Mouse
CD103(+) Nonlymphoid Dendritic Cells. Immunity, 2012. 37(1): p. 60-73.
63. Shortman, K. and S.H. Naik, Steady-state and inflammatory dendritic-cell
development. Nature Reviews Immunology, 2007. 7(1): p. 19-30.
64. Dzionek, A., A. Fuchs, P. Schmidt, et al., BDCA-2, BDCA-3, and BDCA-4: three
markers for distinct subsets of dendritic cells in human peripheral blood. J
Immunol, 2000. 165(11): p. 6037-46.
65. MacDonald, K.P., D.J. Munster, G.J. Clark, et al., Characterization of human
blood dendritic cell subsets. Blood, 2002. 100(13): p. 4512-20.
66. Segura, E., J. Valladeau-Guilemond, M.H. Donnadieu, et al., Characterization
of resident and migratory dendritic cells in human lymph nodes. J Exp Med,
2012. 209(4): p. 653-60.
96
67. Ebner, S., G. Ratzinger, B. Krosbacher, et al., Production of IL-12 by human
monocyte-derived dendritic cells is optimal when the stimulus is given at the
onset of maturation, and is further enhanced by IL-4. Journal of Immunology,
2001. 166(1): p. 633-641.
68. Onishi, H., H. Kuroki, K. Matsumoto, et al., Monocyte-derived dendritic cells
that capture dead tumor cells secrete IL-12 and TNF-alpha through IL-12/TNF-
alpha/NF-kappaB autocrine loop. Cancer Immunol Immunother, 2004. 53(12):
p. 1093-100.
69. Segura, E. and S. Amigorena, Inflammatory dendritic cells in mice and humans.
Trends Immunol, 2013. 34(9): p. 440-5.
70. Mellman, I. and R.M. Steinman, Dendritic cells: specialized and regulated
antigen processing machines. Cell, 2001. 106(3): p. 255-8.
71. Guo, M., S. Gong, S. Maric, et al., A monoclonal antibody to the DEC-205
endocytosis receptor on human dendritic cells. Hum Immunol, 2000. 61(8): p.
729-38.
72. Mahnke, K., M. Guo, S. Lee, et al., The dendritic cell receptor for endocytosis,
DEC-205, can recycle and enhance antigen presentation via major
histocompatibility complex class II-positive lysosomal compartments. J Cell
Biol, 2000. 151(3): p. 673-84.
73. Jiang, W., W.J. Swiggard, C. Heufler, et al., The receptor DEC-205 expressed
by dendritic cells and thymic epithelial cells is involved in antigen processing.
Nature, 1995. 375(6527): p. 151-5.
97
74. Cella, M., C. Dohring, J. Samaridis, et al., A novel inhibitory receptor (ILT3)
expressed on monocytes, macrophages, and dendritic cells involved in antigen
processing. J Exp Med, 1997. 185(10): p. 1743-51.
75. Engering, A.J., M. Cella, D. Fluitsma, et al., The mannose receptor functions as
a high capacity and broad specificity antigen receptor in human dendritic cells.
Eur J Immunol, 1997. 27(9): p. 2417-25.
76. Hertz, C.J., S.M. Kiertscher, P.J. Godowski, et al., Microbial lipopeptides
stimulate dendritic cell maturation via Toll-like receptor 2. J Immunol, 2001.
166(4): p. 2444-50.
77. Kuppner, M.C., R. Gastpar, S. Gelwer, et al., The role of heat shock protein
(hsp70) in dendritic cell maturation: hsp70 induces the maturation of immature
dendritic cells but reduces DC differentiation from monocyte precursors. Eur J
Immunol, 2001. 31(5): p. 1602-9.
78. van Rijt, L.S., N. Vos, M. Willart, et al., Essential role of dendritic cell
CD80/CD86 costimulation in the induction, but not reactivation, of TH2 effector
responses in a mouse model of asthma. J Allergy Clin Immunol, 2004. 114(1):
p. 166-73.
79. Brossart, P. and M.J. Bevan, Presentation of exogenous protein antigens on
major histocompatibility complex class I molecules by dendritic cells: pathway
of presentation and regulation by cytokines. Blood, 1997. 90(4): p. 1594-9.
80. Yewdell, J.W. and J.R. Bennink, Mechanisms of viral interference with MHC
class I antigen processing and presentation. Annu Rev Cell Dev Biol, 1999. 15:
98
p. 579-606.
81. Albert, M.L., S.F. Pearce, L.M. Francisco, et al., Immature dendritic cells
phagocytose apoptotic cells via alphavbeta5 and CD36, and cross-present
antigens to cytotoxic T lymphocytes. J Exp Med, 1998. 188(7): p. 1359-68.
82. Tobian, A.A., D.H. Canaday, W.H. Boom, et al., Bacterial heat shock proteins
promote CD91-dependent class I MHC cross-presentation of chaperoned
peptide to CD8+ T cells by cytosolic mechanisms in dendritic cells versus
vacuolar mechanisms in macrophages. J Immunol, 2004. 172(9): p. 5277-86.
83. Sallusto, F., B. Palermo, D. Lenig, et al., Distinct patterns and kinetics of
chemokine production regulate dendritic cell function. Eur J Immunol, 1999.
29(5): p. 1617-25.
84. Dieu, M.C., B. Vanbervliet, A. Vicari, et al., Selective recruitment of immature
and mature dendritic cells by distinct chemokines expressed in different
anatomic sites. J Exp Med, 1998. 188(2): p. 373-86.
85. Geijtenbeek, T.B., R. Torensma, S.J. van Vliet, et al., Identification of DC-SIGN,
a novel dendritic cell-specific ICAM-3 receptor that supports primary immune
responses. Cell, 2000. 100(5): p. 575-85.
86. Geijtenbeek, T.B., D.S. Kwon, R. Torensma, et al., DC-SIGN, a dendritic cell-
specific HIV-1-binding protein that enhances trans-infection of T cells. Cell,
2000. 100(5): p. 587-97.
87. Scheeren, R.A., G. Koopman, S. Van der Baan, et al., Adhesion receptors
involved in clustering of blood dendritic cells and T lymphocytes. Eur J
99
Immunol, 1991. 21(5): p. 1101-5.
88. Ariizumi, K., G.L. Shen, S. Shikano, et al., Identification of a novel, dendritic
cell-associated molecule, dectin-1, by subtractive cDNA cloning. J Biol Chem,
2000. 275(26): p. 20157-67.
89. Kalinski, P., H.H. Smits, J.H. Schuitemaker, et al., IL-4 is a mediator of IL-
12p70 induction by human Th2 cells: reversal of polarized Th2 phenotype by
dendritic cells. J Immunol, 2000. 165(4): p. 1877-81.
90. Vieira, P.L., E.C. de Jong, E.A. Wierenga, et al., Development of Th1-inducing
capacity in myeloid dendritic cells requires environmental instruction. J
Immunol, 2000. 164(9): p. 4507-12.
91. Braun, M.C., J. He, C.Y. Wu, et al., Cholera toxin suppresses interleukin (IL)-
12 production and IL-12 receptor beta1 and beta2 chain expression. J Exp Med,
1999. 189(3): p. 541-52.
92. Hussain, L.A. and T. Lehner, Comparative investigation of Langerhans' cells
and potential receptors for HIV in oral, genitourinary and rectal epithelia.
Immunology, 1995. 85(3): p. 475-84.
93. Deckers, J., H. Hammad, and E. Hoste, Langerhans Cells: Sensing the
Environment in Health and Disease. Front Immunol, 2018. 9: p. 93.
94. Hunger, R.E., P.A. Sieling, M.T. Ochoa, et al., Langerhans cells utilize CD1a
and langerin to efficiently present nonpeptide antigens to T cells. J Clin Invest,
2004. 113(5): p. 701-8.
95. Romani, N., A. Lenz, H. Glassel, et al., Cultured human Langerhans cells
100
resemble lymphoid dendritic cells in phenotype and function. J Invest Dermatol,
1989. 93(5): p. 600-9.
96. Valladeau, J., C. Dezutter-Dambuyant, and S. Saeland, Langerin/CD207 sheds
light on formation of birbeck granules and their possible function in langerhans
cells. Immunologic Research, 2003. 28(2): p. 93-107.
97. Poulin, L.F., S. Henri, B. de Bovis, et al., The dermis contains langerin(+)
dendritic cells that develop and function independently of epidermal
Langerhans cells. Journal of Experimental Medicine, 2007. 204(13): p. 3119-
3131.
98. Wu, X., C.G. Briseno, V. Durai, et al., Mafb lineage tracing to distinguish
macrophages from other immune lineages reveals dual identity of Langerhans
cells. J Exp Med, 2016. 213(12): p. 2553-2565.
99. Mc Dermott, R., U. Ziylan, D. Spehner, et al., Birbeck granules are subdomains
of endosomal recycling compartment in human epidermal Langerhans cells,
which form where langerin accumulates. Molecular Biology of the Cell, 2002.
13(1): p. 317-335.
100. Satpathy, A.T., R.A. Brown, E. Gomulia, et al., Expression of the transcription
factor ZBTB46 distinguishes human histiocytic disorders of classical dendritic
cell origin. Mod Pathol, 2018.
101. Satpathy, A.T., K.C. Wumesh, J.C. Albring, et al., Zbtb46 expression
distinguishes classical dendritic cells and their committed progenitors from
other immune lineages. Journal of Experimental Medicine, 2012. 209(6): p.
101
1135-1152.
102. Soucie, E.L., Z. Weng, L. Geirsdottir, et al., Lineage-specific enhancers activate
self-renewal genes in macrophages and embryonic stem cells. Science, 2016.
351(6274): p. aad5510.
103. Amir H. SHalaee, R.J.A., Chapter 15 Histiocytic disorders. 2006, Pediatric
Hematology, 3rd Edition: Blackwell Publishing Ltd. Page 340-359.
104. Histiocytosis syndromes in children. Writing Group of the Histiocyte Society.
Lancet, 1987. 1(8526): p. 208-9.
105. Favara, B.E., A.C. Feller, M. Pauli, et al., Contemporary classification of
histiocytic disorders. The WHO Committee On Histiocytic/Reticulum Cell
Proliferations. Reclassification Working Group of the Histiocyte Society. Med
Pediatr Oncol, 1997. 29(3): p. 157-66.
106. Henter, J.I., C. Tondini, and J. Pritchard, Histiocyte disorders. Crit Rev Oncol
Hematol, 2004. 50(2): p. 157-74.
107. Arico, M. and R.M. Egeler, Clinical aspects of Langerhans cell histiocytosis.
Hematol Oncol Clin North Am, 1998. 12(2): p. 247-58.
108. Annels, N.E., C.E. Da Costa, F.A. Prins, et al., Aberrant chemokine receptor
expression and chemokine production by Langerhans cells underlies the
pathogenesis of Langerhans cell histiocytosis. J Exp Med, 2003. 197(10): p.
1385-90.
109. Geissmann, F., Y. Lepelletier, S. Fraitag, et al., Differentiation of Langerhans
cells in Langerhans cell histiocytosis. Blood, 2001. 97(5): p. 1241-8.
102
110. Arceci, R.J., The histiocytoses: the fall of the Tower of Babel. Eur J Cancer,
1999. 35(5): p. 747-67; discussion 767-9.
111. Kannourakis, G. and A. Abbas, The role of cytokines in the pathogenesis of
Langerhans cell histiocytosis. Br J Cancer Suppl, 1994. 23: p. S37-40.
112. Egeler, R.M., N.E. Annels, and P.C. Hogendoorn, Langerhans cell histiocytosis:
a pathologic combination of oncogenesis and immune dysregulation. Pediatr
Blood Cancer, 2004. 42(5): p. 401-3.
113. Arico, M., R. Clementi, D. Caselli, et al., Histiocytic disorders. Hematol J, 2003.
4(3): p. 171-9.
114. Guyot-Goubin, A., J. Donadieu, M. Barkaoui, et al., Descriptive epidemiology
of childhood Langerhans cell histiocytosis in France, 2000-2004. Pediatr Blood
Cancer, 2008. 51(1): p. 71-5.
115. Salotti, J., Epidemiology of Langerhans cell histiocytosis: onwards and upwards!
Pediatr Blood Cancer, 2008. 51(1): p. 3-4.
116. Arico, M., M. Girschikofsky, T. Genereau, et al., Langerhans cell histiocytosis
in adults. Report from the International Registry of the Histiocyte Society. Eur J
Cancer, 2003. 39(16): p. 2341-8.
117. Imashuku, S., Y. Shioda, R. Kobayashi, et al., Neurodegenerative central
nervous system disease as late sequelae of Langerhans cell histiocytosis. Report
from the Japan LCH Study Group. Haematologica, 2008. 93(4): p. 615-8.
118. Kesik, V., C. Citak, E. Kismet, et al., Hematopoietic stem cell transplantation
in Langerhans cell histiocytosis: case report and review of the literature. Pediatr
103
Transplant, 2009. 13(3): p. 371-4.
119. Steiner, M., S. Matthes-Martin, A. Attarbaschi, et al., Improved outcome of
treatment-resistant high-risk Langerhans cell histiocytosis after allogeneic stem
cell transplantation with reduced-intensity conditioning. Bone Marrow
Transplant, 2005. 36(3): p. 215-25.
120. Egeler, R.M., R. Shapiro, B. Loechelt, et al., Characteristic immune
abnormalities in hemophagocytic lymphohistiocytosis. J Pediatr Hematol Oncol,
1996. 18(4): p. 340-5.
121. Henter, J.I., G. Elinder, O. Soder, et al., Hypercytokinemia in familial
hemophagocytic lymphohistiocytosis. Blood, 1991. 78(11): p. 2918-22.
122. Osugi, Y., J. Hara, S. Tagawa, et al., Cytokine production regulating Th1 and
Th2 cytokines in hemophagocytic lymphohistiocytosis. Blood, 1997. 89(11): p.
4100-3.
123. Stepp, S.E., R. Dufourcq-Lagelouse, F. Le Deist, et al., Perforin gene defects in
familial hemophagocytic lymphohistiocytosis. Science, 1999. 286(5446): p.
1957-9.
124. Henter, J.I., Biology and treatment of familial hemophagocytic
lymphohistiocytosis: importance of perforin in lymphocyte-mediated
cytotoxicity and triggering of apoptosis. Med Pediatr Oncol, 2002. 38(5): p.
305-9.
125. Feldmann, J., I. Callebaut, G. Raposo, et al., Munc13-4 is essential for cytolytic
granules fusion and is mutated in a form of familial hemophagocytic
104
lymphohistiocytosis (FHL3). Cell, 2003. 115(4): p. 461-73.
126. zur Stadt, U., S. Schmidt, B. Kasper, et al., Linkage of familial hemophagocytic
lymphohistiocytosis (FHL) type-4 to chromosome 6q24 and identification of
mutations in syntaxin 11. Hum Mol Genet, 2005. 14(6): p. 827-34.
127. Henter, J.I., G. Elinder, O. Soder, et al., Incidence in Sweden and clinical
features of familial hemophagocytic lymphohistiocytosis. Acta Paediatr Scand,
1991. 80(4): p. 428-35.
128. Henter, J.I., M. Arico, G. Elinder, et al., Familial hemophagocytic
lymphohistiocytosis. Primary hemophagocytic lymphohistiocytosis. Hematol
Oncol Clin North Am, 1998. 12(2): p. 417-33.
129. Allen, C.E. and K.L. McClain, Pathophysiology and epidemiology of
hemophagocytic lymphohistiocytosis. Hematology Am Soc Hematol Educ
Program, 2015. 2015: p. 177-82.
130. Meeths, M., A. Horne, M. Sabel, et al., Incidence and clinical presentation of
primary hemophagocytic lymphohistiocytosis in Sweden. Pediatr Blood Cancer,
2015. 62(2): p. 346-352.
131. Ishii, E., S. Ohga, M. Tanimura, et al., Clinical and epidemiologic studies of
familial hemophagocytic lymphohistiocytosis in Japan. Japan LCH Study
Group. Med Pediatr Oncol, 1998. 30(5): p. 276-83.
132. Henter, J.I., A. Samuelsson-Horne, M. Arico, et al., Treatment of
hemophagocytic lymphohistiocytosis with HLH-94 immunochemotherapy and
bone marrow transplantation. Blood, 2002. 100(7): p. 2367-73.
105
133. Henter, J.I., A. Horne, M. Arico, et al., HLH-2004: Diagnostic and therapeutic
guidelines for hemophagocytic lymphohistiocytosis. Pediatr Blood Cancer, 2007.
48(2): p. 124-31.
134. Alexiev, B.A., C.J. Sailey, S.A. McClure, et al., Primary histiocytic sarcoma
arising in the head and neck with predominant spindle cell component. Diagn
Pathol, 2007. 2: p. 7.
135. Kobayashi, S., F. Kimura, Y. Hama, et al., Histiocytic sarcoma of the spleen:
case report of asymptomatic onset of thrombocytopenia and complex imaging
features. Int J Hematol, 2008. 87(1): p. 83-7.
136. Vos, J.A., S.L. Abbondanzo, C.L. Barekman, et al., Histiocytic sarcoma: a study
of five cases including the histiocyte marker CD163. Mod Pathol, 2005. 18(5):
p. 693-704.
137. Machado, E.S., A.C. de Miranda, T. Escopelli, et al., Histiocytic sarcoma. Rev
Bras Hematol Hemoter, 2011. 33(2): p. 155-7.
138. Go, H., Y.K. Jeon, J. Huh, et al., Frequent detection of BRAF(V600E) mutations
in histiocytic and dendritic cell neoplasms. Histopathology, 2014. 65(2): p. 261-
72.
139. Idbaih, A., K. Mokhtari, J.F. Emile, et al., Dramatic response of a BRAF V600E-
mutated primary CNS histiocytic sarcoma to vemurafenib. Neurology, 2014.
83(16): p. 1478-80.
140. Zhao, J., X. Niu, Z. Wang, et al., Histiocytic sarcoma combined with acute
monocytic leukemia: a case report. Diagn Pathol, 2015. 10: p. 110.
106
141. Wang, E., J. Papalas, C.B. Hutchinson, et al., Sequential development of
histiocytic sarcoma and diffuse large b-cell lymphoma in a patient with a remote
history of follicular lymphoma with genotypic evidence of a clonal relationship:
a divergent (bilineal) neoplastic transformation of an indolent B-cell lymphoma
in a single individual. Am J Surg Pathol, 2011. 35(3): p. 457-63.
142. Shao, H., L. Xi, M. Raffeld, et al., Clonally related histiocytic/dendritic cell
sarcoma and chronic lymphocytic leukemia/small lymphocytic lymphoma: a
study of seven cases. Mod Pathol, 2011. 24(11): p. 1421-32.
143. Oka, K., H. Nakamine, K. Maeda, et al., Primary histiocytic sarcoma of the
spleen associated with hemophagocytosis. Int J Hematol, 2008. 87(4): p. 405-
409.
144. Brown, A.F., H. Fan, J.R. Floyd, et al., Primary Central Nervous System
Histiocytic Sarcoma Arising After Precursor B-Cell Acute Lymphoblastic
Leukemia. J Neuropathol Exp Neurol, 2015. 74(12): p. 1120-6.
145. Ansari, J., A.R. Naqash, R. Munker, et al., Histiocytic sarcoma as a secondary
malignancy: pathobiology, diagnosis, and treatment. Eur J Haematol, 2016.
97(1): p. 9-16.
146. Lee, D., Y.B. Kim, S.H. Chung, et al., Primary gastric histiocytic sarcoma
reminiscent of inflammatory pseudotumor: a case report with review of the
literature. Korean J Pathol, 2014. 48(3): p. 258-62.
147. Dobson, J., T. Hoather, T.J. McKinley, et al., Mortality in a cohort of flat-coated
retrievers in the UK. Vet Comp Oncol, 2009. 7(2): p. 115-21.
107
148. Constantino-Casas, F., D. Mayhew, T.M. Hoather, et al., The clinical
presentation and histopathologic-immunohistochemical classification of
histiocytic sarcomas in the Flat Coated Retriever. Vet Pathol, 2011. 48(3): p.
764-71.
149. Skorupski, K.A., C.A. Clifford, M.C. Paoloni, et al., CCNU for the treatment of
dogs with histiocytic sarcoma. J Vet Intern Med, 2007. 21(1): p. 121-6.
150. Klahn, S.L., B.E. Kitchell, and N.G. Dervisis, Evaluation and comparison of
outcomes in dogs with periarticular and nonperiarticular histiocytic sarcoma.
J Am Vet Med Assoc, 2011. 239(1): p. 90-6.
151. Fidel, J., I. Schiller, B. Hauser, et al., Histiocytic sarcomas in flat-coated
retrievers: a summary of 37 cases (November 1998-March 2005). Vet Comp
Oncol, 2006. 4(2): p. 63-74.
152. Affolter, V.K. and P.F. Moore, Localized and disseminated histiocytic sarcoma
of dendritic cell origin in dogs. Vet Pathol, 2002. 39(1): p. 74-83.
153. Nguyen, T.T., E.J. Schwartz, R.B. West, et al., Expression of CD163
(hemoglobin scavenger receptor) in normal tissues, lymphomas, carcinomas,
and sarcomas is largely restricted to the monocyte/macrophage lineage. Am J
Surg Pathol, 2005. 29(5): p. 617-24.
154. Mainardi, C., E.S. D'Amore, M. Pillon, et al., A case of resistant pediatric
histiocytic sarcoma successfully treated with chemo-radiotherapy and
autologous peripheral blood stem cell transplant. Leuk Lymphoma, 2011. 52(7):
p. 1367-71.
108
155. Toshkezi, G., F. Edalat, C. O'Hara, et al., Primary intramedullary histiocytic
sarcoma. World Neurosurg, 2010. 74(4-5): p. 523-7.
156. Dervisis, N.G., M. Kiupel, Q. Qin, et al., Clinical prognostic factors in canine
histiocytic sarcoma. Veterinary and Comparative Oncology, 2017. 15(4): p.
1171-1180.
157. Fulmer, A.K. and G.E. Mauldin, Canine histiocytic neoplasia: an overview. Can
Vet J, 2007. 48(10): p. 1041-3, 1046-50.
158. Skorupski, K.A., C.O. Rodriguez, E.L. Krick, et al., Long-term survival in dogs
with localized histiocytic sarcoma treated with CCNU as an adjuvant to local
therapy. Veterinary and Comparative Oncology, 2009. 7(2): p. 139-144.
159. Moore, P.F., A review of histiocytic diseases of dogs and cats. Vet Pathol, 2014.
51(1): p. 167-84.
160. De Vos, F.Y., M.N. Gerding, J.W. Arends, et al., Histiocytic sarcoma localised
in the thyroid: a case report. Ann Hematol, 2008. 87(8): p. 681-2.
161. Tsujimura, H., T. Miyaki, S. Yamada, et al., Successful treatment of histiocytic
sarcoma with induction chemotherapy consisting of dose-escalated CHOP plus
etoposide and upfront consolidation auto-transplantation. Int J Hematol, 2014.
100(5): p. 507-10.
162. Narita, K., R. Noro, M. Seike, et al., Successful treatment of histiocytic sarcoma
and concurrent HIV infection using a combination of CHOP and antiretroviral
therapy. Intern Med, 2013. 52(24): p. 2805-9.
163. Abu-Sanad, A., A. Warsi, R.P. Michel, et al., Long-term remission after
109
autologous stem-cell transplantation for relapsed histiocytic sarcoma. Curr
Oncol, 2012. 19(4): p. e289-91.
164. Shukla, N., R. Kobos, T. Renaud, et al., Successful treatment of refractory
metastatic histiocytic sarcoma with alemtuzumab. Cancer, 2012. 118(15): p.
3719-24.
165. Gergis, U., H. Dax, E. Ritchie, et al., Autologous Hematopoietic Stem-Cell
Transplantation in Combination With Thalidomide As Treatment for Histiocytic
Sarcoma: A Case Report and Review of the Literature. Journal of Clinical
Oncology, 2011. 29(10): p. E251-E253.
166. Zeidan, A., J. Bolanos-Meade, Y. Kasamon, et al., Human leukocyte antigen-
haploidentical hematopoietic stem cell transplant for a patient with histiocytic
sarcoma. Leuk Lymphoma, 2013. 54(3): p. 655-7.
167. Kommalapati, A., S.H. Tella, M. Durkin, et al., Histiocytic sarcoma: a
population-based analysis of incidence, demographic disparities, and long-
term outcomes. Blood, 2018. 131(2): p. 265-268.
168. Rassnick, K.M., A.S. Moore, D.S. Russell, et al., Phase II, open-label trial of
single-agent CCNU in dogs with previously untreated histiocytic sarcoma. J Vet
Intern Med, 2010. 24(6): p. 1528-31.
169. Cannon, C., A. Borgatti, M. Henson, et al., Evaluation of a combination
chemotherapy protocol including lomustine and doxorubicin in canine
histiocytic sarcoma. J Small Anim Pract, 2015. 56(7): p. 425-9.
170. Brazil, D.P. and B.A. Hemmings, Ten years of protein kinase B signalling: a
110
hard Akt to follow. Trends Biochem Sci, 2001. 26(11): p. 657-64.
171. Alessi, D.R., Discovery of PDK1, one of the missing links in insulin signal
transduction. Colworth Medal Lecture. Biochem Soc Trans, 2001. 29(Pt 2): p.
1-14.
172. Toker, A. and S. Marmiroli, Signaling specificity in the Akt pathway in biology
and disease. Adv Biol Regul, 2014. 55: p. 28-38.
173. Toker, A., Achieving specificity in Akt signaling in cancer. Adv Biol Regul, 2012.
52(1): p. 78-87.
174. Leevers, S.J., B. Vanhaesebroeck, and M.D. Waterfield, Signalling through
phosphoinositide 3-kinases: the lipids take centre stage. Current Opinion in Cell
Biology, 1999. 11(2): p. 219-225.
175. Yu, J., Y. Zhang, J. McIlroy, et al., Regulation of the p85/p110
phosphatidylinositol 3'-kinase: stabilization and inhibition of the p110alpha
catalytic subunit by the p85 regulatory subunit. Mol Cell Biol, 1998. 18(3): p.
1379-87.
176. Arencibia, J.M., D. Pastor-Flores, A.F. Bauer, et al., AGC protein kinases: from
structural mechanism of regulation to allosteric drug development for the
treatment of human diseases. Biochim Biophys Acta, 2013. 1834(7): p. 1302-
21.
177. Song, G., G. Ouyang, and S. Bao, The activation of Akt/PKB signaling pathway
and cell survival. J Cell Mol Med, 2005. 9(1): p. 59-71.
178. Johnson, A.L., J.T. Bridgham, and J.A. Swenson, Activation of the Akt/protein
111
kinase B signaling pathway is associated with granulosa cell survival. Biol
Reprod, 2001. 64(5): p. 1566-74.
179. Romer, M.U., L. Larsen, H. Offenberg, et al., Plasminogen activator inhibitor
1 protects fibrosarcoma cells from etoposide-induced apoptosis through
activation of the PI3K/Akt cell survival pathway. Neoplasia, 2008. 10(10): p.
1083-91.
180. Rong, R., Q. He, Y. Liu, et al., TC21 mediates transformation and cell survival
via activation of phosphatidylinositol 3-kinase/Akt and NF-kappaB signaling
pathway. Oncogene, 2002. 21(7): p. 1062-70.
181. Song, M.S., L. Salmena, and P.P. Pandolfi, The functions and regulation of the
PTEN tumour suppressor. Nat Rev Mol Cell Biol, 2012. 13(5): p. 283-96.
182. Sharrard, R.M. and N.J. Maitland, Regulation of protein kinase B activity by
PTEN and SHIP2 in human prostate-derived cell lines. Cell Signal, 2007. 19(1):
p. 129-38.
183. Gao, T.Y., F. Furnari, and A.C. Newton, PHLPP: A phosphatase that directly
dephosphorylates akt, promotes apoptosis, and suppresses tumor growth.
Molecular Cell, 2005. 18(1): p. 13-24.
184. Hers, I., E.E. Vincent, and J.M. Tavare, Akt signalling in health and disease.
Cell Signal, 2011. 23(10): p. 1515-27.
185. Lawlor, M.A. and D.R. Alessi, PKB/Akt: a key mediator of cell proliferation,
survival and insulin responses? J Cell Sci, 2001. 114(Pt 16): p. 2903-10.
186. Cappellini, A., G. Tabellini, M. Zweyer, et al., The phosphoinositide 3-
112
kinase/Akt pathway regulates cell cycle progression of HL60 human leukemia
cells through cytoplasmic relocalization of the cyclin-dependent kinase
inhibitor p27(Kip1) and control of cyclin D1 expression. Leukemia, 2003.
17(11): p. 2157-67.
187. Mayo, L.D. and D.B. Donner, The PTEN, Mdm2, p53 tumor suppressor-
oncoprotein network. Trends Biochem Sci, 2002. 27(9): p. 462-7.
188. Wee, K.B. and B.D. Aguda, Akt versus p53 in a network of oncogenes and tumor
suppressor genes regulating cell survival and death. Biophys J, 2006. 91(3): p.
857-65.
189. Niquet, J. and C.G. Wasterlain, Bim, Bad, and Bax: a deadly combination in
epileptic seizures. J Clin Invest, 2004. 113(7): p. 960-2.
190. Kazi, A., J. Sun, K. Doi, et al., The BH3 alpha-helical mimic BH3-M6 disrupts
Bcl-X(L), Bcl-2, and MCL-1 protein-protein interactions with Bax, Bak, Bad, or
Bim and induces apoptosis in a Bax- and Bim-dependent manner. J Biol Chem,
2011. 286(11): p. 9382-92.
191. Xin, M. and X. Deng, Nicotine inactivation of the proapoptotic function of Bax
through phosphorylation. J Biol Chem, 2005. 280(11): p. 10781-9.
192. Cardone, M.H., N. Roy, H.R. Stennicke, et al., Regulation of cell death protease
caspase-9 by phosphorylation. Science, 1998. 282(5392): p. 1318-21.
193. Campbell, R.A., P. Bhat-Nakshatri, N.M. Patel, et al., Phosphatidylinositol 3-
kinase/AKT-mediated activation of estrogen receptor alpha: a new model for
anti-estrogen resistance. J Biol Chem, 2001. 276(13): p. 9817-24.
113
194. Jeong, S.J., C.A. Pise-Masison, M.F. Radonovich, et al., Activated AKT
regulates NF-kappaB activation, p53 inhibition and cell survival in HTLV-1-
transformed cells. Oncogene, 2005. 24(44): p. 6719-28.
195. Hanson, K.D., M. Shichiri, M.R. Follansbee, et al., Effects of c-myc expression
on cell cycle progression. Mol Cell Biol, 1994. 14(9): p. 5748-55.
196. Ahmed, N.N., H.L. Grimes, A. Bellacosa, et al., Transduction of interleukin-2
antiapoptotic and proliferative signals via Akt protein kinase. Proc Natl Acad
Sci U S A, 1997. 94(8): p. 3627-32.
197. Zhou, B.P., Y. Liao, W. Xia, et al., Cytoplasmic localization of p21Cip1/WAF1
by Akt-induced phosphorylation in HER-2/neu-overexpressing cells. Nat Cell
Biol, 2001. 3(3): p. 245-52.
198. Medema, R.H., G.J. Kops, J.L. Bos, et al., AFX-like Forkhead transcription
factors mediate cell-cycle regulation by Ras and PKB through p27kip1. Nature,
2000. 404(6779): p. 782-7.
199. Nakamura, N., S. Ramaswamy, F. Vazquez, et al., Forkhead transcription
factors are critical effectors of cell death and cell cycle arrest downstream of
PTEN. Mol Cell Biol, 2000. 20(23): p. 8969-82.
200. Li, D.M. and H. Sun, PTEN/MMAC1/TEP1 suppresses the tumorigenicity and
induces G1 cell cycle arrest in human glioblastoma cells. Proc Natl Acad Sci U
S A, 1998. 95(26): p. 15406-11.
201. Graff, J.R., B.W. Konicek, A.M. McNulty, et al., Increased AKT activity
contributes to prostate cancer progression by dramatically accelerating
114
prostate tumor growth and diminishing p27Kip1 expression. J Biol Chem, 2000.
275(32): p. 24500-5.
202. Gao, N., D.C. Flynn, Z. Zhang, et al., G1 cell cycle progression and the
expression of G1 cyclins are regulated by PI3K/AKT/mTOR/p70S6K1 signaling
in human ovarian cancer cells. Am J Physiol Cell Physiol, 2004. 287(2): p.
C281-91.
203. Forstermann, U. and T. Munzel, Endothelial nitric oxide synthase in vascular
disease: from marvel to menace. Circulation, 2006. 113(13): p. 1708-14.
204. Kang, Z.C., W.L. Jiang, H.Y. Luan, et al., Cornin induces angiogenesis through
PI3K-Akt-eNOS-VEGF signaling pathway. Food and Chemical Toxicology,
2013. 58: p. 340-346.
205. Xing, Y., J.B. Lai, X.Y. Liu, et al., Netrin-1 restores cell injury and impaired
angiogenesis in vascular endothelial cells upon high glucose by PI3K/AKT-
eNOS. Journal of Molecular Endocrinology, 2017. 58(4): p. 167-177.
206. Qian, J. and D. Fulton, Post-translational regulation of endothelial nitric oxide
synthase in vascular endothelium. Front Physiol, 2013. 4: p. 347.
207. Boo, Y.C. and H. Jo, Flow-dependent regulation of endothelial nitric oxide
synthase: role of protein kinases. Am J Physiol Cell Physiol, 2003. 285(3): p.
C499-508.
208. Huang, C.Y., U. Batzorig, W.L. Cheng, et al., Glucose-regulated protein 94
mediates cancer progression via AKT and eNOS in hepatocellular carcinoma.
Tumour Biol, 2016. 37(4): p. 4295-304.
115
209. Mao, G., Y. Liu, X. Fang, et al., Tumor-derived microRNA-494 promotes
angiogenesis in non-small cell lung cancer. Angiogenesis, 2015. 18(3): p. 373-
82.
210. Dave, B., S. Granados-Principal, R. Zhu, et al., Targeting RPL39 and MLF2
reduces tumor initiation and metastasis in breast cancer by inhibiting nitric
oxide synthase signaling. Proc Natl Acad Sci U S A, 2014. 111(24): p. 8838-43.
211. Martins Filho, A., M.P. Jammal, C. Cobo Ede, et al., Correlation of cytokines
and inducible nitric oxide synthase expression with prognostic factors in
ovarian cancer. Immunol Lett, 2014. 158(1-2): p. 195-9.
212. Grimm, E.A., A.G. Sikora, and S. Ekmekcioglu, Molecular Pathways:
Inflammation-Associated Nitric-Oxide Production as a Cancer-Supporting
Redox Mechanism and a Potential Therapeutic Target. Clinical Cancer
Research, 2013. 19(20): p. 5557-5563.
213. Guru, S.K., A.S. Pathania, S. Kumar, et al., Secalonic Acid-D Represses
HIF1alpha/VEGF-Mediated Angiogenesis by Regulating the
Akt/mTOR/p70S6K Signaling Cascade. Cancer Res, 2015. 75(14): p. 2886-96.
214. Jiang, B.H. and L.Z. Liu, AKT signaling in regulating angiogenesis. Current
Cancer Drug Targets, 2008. 8(1): p. 19-26.
215. Qian, Y., L. Corum, Q. Meng, et al., PI3K induced actin filament remodeling
through Akt and p70S6K1: implication of essential role in cell migration. Am J
Physiol Cell Physiol, 2004. 286(1): p. C153-63.
216. Sanuphan, A., P. Chunhacha, V. Pongrakhananon, et al., Long-term nitric oxide
116
exposure enhances lung cancer cell migration. Biomed Res Int, 2013. 2013: p.
186972.
217. Kim, D., S. Kim, H. Koh, et al., Akt/PKB promotes cancer cell invasion via
increased motility and metalloproteinase production. FASEB J, 2001. 15(11): p.
1953-62.
218. Li, J., Z. Deng, Z. Wang, et al., Zipper-interacting protein kinase promotes
epithelial-mesenchymal transition, invasion and metastasis through AKT and
NF-kB signaling and is associated with metastasis and poor prognosis in gastric
cancer patients. Oncotarget, 2015. 6(10): p. 8323-38.
219. Lamouille, S., J. Xu, and R. Derynck, Molecular mechanisms of epithelial-
mesenchymal transition. Nat Rev Mol Cell Biol, 2014. 15(3): p. 178-96.
220. Grille, S.J., A. Bellacosa, J. Upson, et al., The protein kinase Akt induces
epithelial mesenchymal transition and promotes enhanced motility and
invasiveness of squamous cell carcinoma lines. Cancer Res, 2003. 63(9): p.
2172-8.
221. Carpenter, R.L., I. Paw, M.W. Dewhirst, et al., Akt phosphorylates and activates
HSF-1 independent of heat shock, leading to Slug overexpression and epithelial-
mesenchymal transition (EMT) of HER2-overexpressing breast cancer cells.
Oncogene, 2015. 34(5): p. 546-57.
222. Yang, J., G. Qin, M. Luo, et al., Reciprocal positive regulation between Cx26
and PI3K/Akt pathway confers acquired gefitinib resistance in NSCLC cells via
GJIC-independent induction of EMT. Cell Death & Disease, 2015. 6.
117
223. Tan, J., Y. You, T. Xu, et al., Par-4 downregulation confers cisplatin resistance
in pancreatic cancer cells via PI3K/Akt pathway-dependent EMT. Toxicol Lett,
2014. 224(1): p. 7-15.
224. Steck, P.A., M.A. Pershouse, S.A. Jasser, et al., Identification of a candidate
tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in
multiple advanced cancers. Nature Genetics, 1997. 15(4): p. 356-362.
225. Li, D.M. and H. Sun, TEP1, encoded by a candidate tumor suppressor locus, is
a novel protein tyrosine phosphatase regulated by transforming growth factor
beta. Cancer Research, 1997. 57(11): p. 2124-2129.
226. Chen, C.Y., J. Chen, L. He, et al., PTEN: Tumor Suppressor and Metabolic
Regulator. Front Endocrinol (Lausanne), 2018. 9: p. 338.
227. Carnero, A., C. Blanco-Aparicio, O. Renner, et al., The PTEN/PI3K/AKT
signalling pathway in cancer, therapeutic implications. Curr Cancer Drug
Targets, 2008. 8(3): p. 187-98.
228. Barbosa, M., M. Henrique, J. Pinto-Basto, et al., Prostate cancer in Cowden
syndrome: somatic loss and germline mutation of the PTEN gene. Cancer Genet,
2011. 204(4): p. 224-5.
229. Zhang, H.Y., F. Liang, Z.L. Jia, et al., PTEN mutation, methylation and
expression in breast cancer patients. Oncol Lett, 2013. 6(1): p. 161-168.
230. Kurose, K., X.P. Zhou, T. Araki, et al., Frequent loss of PTEN expression is
linked to elevated phosphorylated Akt levels, but not associated with p27 and
cyclin D1 expression, in primary epithelial ovarian carcinomas. Am J Pathol,
118
2001. 158(6): p. 2097-106.
231. Kato, H., M. Fujimura, T. Kumabe, et al., PTEN gene mutation and high MIB-
1 labeling index may contribute to dissemination in patients with glioblastoma.
J Clin Neurosci, 2004. 11(1): p. 37-41.
232. Wang, X., X. Cao, R. Sun, et al., Clinical Significance of PTEN Deletion,
Mutation, and Loss of PTEN Expression in De Novo Diffuse Large B-Cell
Lymphoma. Neoplasia, 2018. 20(6): p. 574-593.
233. Di Cristofano, A., P. Kotsi, Y.F. Peng, et al., Impaired Fas response and
autoimmunity in Pten+/- mice. Science, 1999. 285(5436): p. 2122-5.
234. Huang, H., J.C. Cheville, Y. Pan, et al., PTEN induces chemosensitivity in
PTEN-mutated prostate cancer cells by suppression of Bcl-2 expression. J Biol
Chem, 2001. 276(42): p. 38830-6.
235. Garcia-Cao, I., M.S. Song, R.M. Hobbs, et al., Systemic elevation of PTEN
induces a tumor-suppressive metabolic state. Cell, 2012. 149(1): p. 49-62.
236. Nagata, Y., K.H. Lan, X. Zhou, et al., PTEN activation contributes to tumor
inhibition by trastuzumab, and loss of PTEN predicts trastuzumab resistance in
patients. Cancer Cell, 2004. 6(2): p. 117-27.
237. Steelman, L.S., P.M. Navolanic, M.L. Sokolosky, et al., Suppression of PTEN
function increases breast cancer chemotherapeutic drug resistance while
conferring sensitivity to mTOR inhibitors. Oncogene, 2008. 27(29): p. 4086-95.
238. Zwick, E., J. Bange, and A. Ullrich, Receptor tyrosine kinase signalling as a
target for cancer intervention strategies. Endocrine-Related Cancer, 2001. 8(3):
119
p. 161-173.
239. Mitsudomi, T., S. Morita, Y. Yatabe, et al., Gefitinib versus cisplatin plus
docetaxel in patients with non-small-cell lung cancer harbouring mutations of
the epidermal growth factor receptor (WJTOG3405): an open label,
randomised phase 3 trial. Lancet Oncol, 2010. 11(2): p. 121-8.
240. Rosell, R., E. Carcereny, R. Gervais, et al., Erlotinib versus standard
chemotherapy as first-line treatment for European patients with advanced
EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre,
open-label, randomised phase 3 trial. Lancet Oncology, 2012. 13(3): p. 239-
246.
241. Hirsh, V., Next-Generation Covalent Irreversible Kinase Inhibitors in NSCLC:
Focus on Afatinib. BioDrugs, 2015. 29(3): p. 167-83.
242. Sakaguchi, K., K. Nakatsukasa, H. Koyama, et al., Phase II Clinical Trial of
First-line Eribulin Plus Trastuzumab for Advanced or Recurrent HER2-positive
Breast Cancer. Anticancer Res, 2018. 38(7): p. 4073-4081.
243. Mitsiades, C.S., N. Mitsiades, and M. Koutsilieris, The Akt pathway: molecular
targets for anti-cancer drug development. Curr Cancer Drug Targets, 2004. 4(3):
p. 235-56.
244. Wetzker, R. and C. Rommel, Phosphoinositide 3-kinases as targets for
therapeutic intervention. Curr Pharm Des, 2004. 10(16): p. 1915-22.
245. Finan, P.M. and M.J. Thomas, PI 3-kinase inhibition: a therapeutic target for
respiratory disease. Biochem Soc Trans, 2004. 32(Pt 2): p. 378-82.
120
246. Shintani, T. and D.J. Klionsky, Autophagy in health and disease: a double-
edged sword. Science, 2004. 306(5698): p. 990-5.
247. FDA approves first PI3K inhibitor. Nature Reviews Drug Discovery, 2014.
13(9): p. 644-645.
248. Feldman, R.I., J.M. Wu, M.A. Polokoff, et al., Novel small molecule inhibitors
of 3-phosphoinositide-dependent kinase-1. Journal of Biological Chemistry,
2005. 280(20): p. 19867-19874.
249. Sato, S., N. Fujita, and T. Tsuruo, Interference with PDK1-Akt survival signaling
pathway by UCN-01 (7-hydroxystaurosporine). Oncogene, 2002. 21(11): p.
1727-1738.
250. Welch, S., H.W. Hirte, M.S. Carey, et al., UCN-01 in combination with
topotecan in patients with advanced recurrent ovarian cancer: a study of the
Princess Margaret Hospital Phase II consortium. Gynecol Oncol, 2007. 106(2):
p. 305-10.
251. Senderowicz, A.M., Small-molecule cyclin-dependent kinase modulators.
Oncogene, 2003. 22(42): p. 6609-6620.
252. Kondapaka, S.B., S.S. Singh, G.P. Dasmahapatra, et al., Perifosine, a novel
alkylphospholipid, inhibits protein kinase B activation. Mol Cancer Ther, 2003.
2(11): p. 1093-103.
253. Hasegawa, K., M. Kagabu, M. Mizuno, et al., Phase II basket trial of perifosine
monotherapy for recurrent gynecologic cancer with or without PIK3CA
mutations. Invest New Drugs, 2017. 35(6): p. 800-812.
121
254. Altomare, D.A., L. Zhang, J. Deng, et al., GSK690693 delays tumor onset and
progression in genetically defined mouse models expressing activated Akt. Clin
Cancer Res, 2010. 16(2): p. 486-96.
255. Levy, D.S., J.A. Kahana, and R. Kumar, AKT inhibitor, GSK690693, induces
growth inhibition and apoptosis in acute lymphoblastic leukemia cell lines.
Blood, 2009. 113(8): p. 1723-9.
256. Yang, L., H.C. Dan, M. Sun, et al., Akt/protein kinase B signaling inhibitor-2, a
selective small molecule inhibitor of Akt signaling with antitumor activity in
cancer cells overexpressing Akt. Cancer Res, 2004. 64(13): p. 4394-9.
257. Atkins, M.B., M. Hidalgo, W.M. Stadler, et al., Randomized phase II study of
multiple dose levels of CCI-779, a novel mammalian target of rapamycin kinase
inhibitor, in patients with advanced refractory renal cell carcinoma. J Clin
Oncol, 2004. 22(5): p. 909-18.
258. Majumder, P.K., P.G. Febbo, R. Bikoff, et al., mTOR inhibition reverses Akt-
dependent prostate intraepithelial neoplasia through regulation of apoptotic
and HIF-1-dependent pathways. Nat Med, 2004. 10(6): p. 594-601.
259. Rao, R.D., J.C. Buckner, and J.N. Sarkaria, Mammalian target of rapamycin
(mTOR) inhibitors as anti-cancer agents. Curr Cancer Drug Targets, 2004. 4(8):
p. 621-35.
260. Helin, H.O., M.E. Lundin, M. Laakso, et al., Virtual microscopy in prostate
histopathology: simultaneous viewing of biopsies stained sequentially with
hematoxylin and eosin, and alpha-methylacyl-coenzyme A racemase/p63
122
immunohistochemistry. J Urol, 2006. 175(2): p. 495-9.
261. Jonsson, M., M. Engstrom, and J.I. Jonsson, FLT3 ligand regulates apoptosis
through AKT-dependent inactivation of transcription factor Fox03.
Biochemical and Biophysical Research Communications, 2004. 318(4): p. 899-
903.
262. Lee, H.M., H.S. Jin, J.W. Park, et al., IL-4 augments anisomycin-induced p38
activation via Akt pathway in a follicular dendritic cell (FDC)-like line. FEBS
Lett, 2003. 549(1-3): p. 110-4.
263. Mimura, N., T. Hideshima, T. Shimomura, et al., Selective and potent Akt
inhibition triggers anti-myeloma activities and enhances fatal endoplasmic
reticulum stress induced by proteasome inhibition. Cancer Res, 2014. 74(16): p.
4458-69.
264. Botham, R.C., H.S. Roth, A.P. Book, et al., Small-Molecule Procaspase-3
Activation Sensitizes Cancer to Treatment with Diverse Chemotherapeutics.
ACS Cent Sci, 2016. 2(8): p. 545-59.
265. Coutermarsh-Ott, S., A. Simmons, V. Capria, et al., NLRX1 suppresses
tumorigenesis and attenuates histiocytic sarcoma through the negative
regulation of NF-kappaB signaling. Oncotarget, 2016. 7(22): p. 33096-110.
266. Borge, K.S., S. Nord, P. Van Loo, et al., Canine Mammary Tumours Are Affected
by Frequent Copy Number Aberrations, including Amplification of MYC and
Loss of PTEN. PLoS One, 2015. 10(5): p. e0126371.
267. Manning, B.D. and L.C. Cantley, AKT/PKB signaling: navigating downstream.
123
Cell, 2007. 129(7): p. 1261-74.
268. Li, J., X.J. Wu, J.L. Gong, et al., Vascular endothelial growth factor induces
multidrug resistance-associated protein 1 overexpression through
phosphatidylinositol-3-kinase/protein kinase B signaling pathway and
transcription factor specificity protein 1 in BGC823 cell line. Acta Biochimica
Et Biophysica Sinica, 2013. 45(8): p. 656-663.