Evaluation of the Biofire FilmArray Biothreat E-test (v2. 5) for rapid ...

1

Evaluation of the Biofire FilmArray Biothreat E-test (v2.5) for rapid identification of Ebola virus 1

disease in heat-treated blood samples obtained in Sierra Leone and United Kingdom 2

Running Title: FilmArray E-test against Sierra Leone and UK Ebola samples 3

Simon A Weller1#, Daniel Bailey2, Steven Matthews3, Sarah Lumley2, Angela Sweed2, Derren Ready4, 4

Gary Eltringham5, Jade Richards6, Richard Vipond2 Roman Lukaszewski1, Phillippa M Payne1, Emma 5

Aarons2, Andrew J Simpson2, Emma J Hutley3, and Tim Brooks2 6

Affiliations 7

1Defence Science and Technology Laboratory, Ministry of Defence, Porton Down, Salisbury, UK 8 9 2Rare and Imported Pathogens Laboratory, Public Health England, Porton Down, Salisbury, UK 10 11 3Centre of Defence Pathology, Royal Centre of Defence Medicine, Vincent Drive, Edgbaston, 12 Birmingham, UK 13 14 4Public Health Laboratory London, 80 Newark Street, London, UK 15 16 5Newcastle Molecular Laboratory, Public Health England, Royal Victoria Infirmary, Newcastle Upon 17

Tyne, UK 18 19 6MEHT Microbiology, NHS Trust, Broomfield Hospital, Chelmsford, UK 20 21

#Corresponding author: Email [email protected]; Tel +44 (0) 1980 617404. 22

© Crown copyright (2015), Dstl. This material is licensed under the terms of the Open Government 23

Licence except where otherwise stated. To view this licence, visit 24

http://www.nationalarchives.gov.uk/doc/open-government-licence/version/3 or write to the 25

Information Policy Team, The National Archives, Kew, London TW9 4DU, or email: 26

[email protected]. 27

28

JCM Accepted Manuscript Posted Online 4 November 2015J. Clin. Microbiol. doi:10.1128/JCM.02287-15© Crown copyright 2015.

on April 14, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

2

Abstract 29

Rapid Ebola virus (EBOV) detection is crucial for appropriate patient management and care. The 30

performance of the FilmArray Biothreat E-test (v2.5), against whole blood samples, was evaluated 31

in Sierra Leone and the United Kingdom (UK), and compared with results generated by a real-time 32

Ebola Zaire PCR reference method. In diagnostic laboratories samples were tested on availability, 33

included successive samples from individual patients, and were heat treated to facilitate EBOV 34

inactivation prior to PCR. In Sierra Leone (n=60; 44 patients), the Biothreat E-test had a sensitivity of 35

84% (confidence interval, CI: 64-95%) and specificity of 89% (CI: 73-97%); and in the UK (n=108; 70 36

patients), a sensitivity of 75%, (CI: 19-99%) and specificity of 100% (CI: 97-100%), when compared 37

to the reference real-time PCR. Statistical analysis (Fisher’s Exact test) indicated there was no 38

significant difference between methods at the 99% confidence level in either country. In 9 39

discrepant results (5 real-time PCR positives and E-test negatives; 4 real-time PCR negatives and E-40

test positives), the majority (8) were obtained from samples with an observed, or probable, low 41

viral load. The FilmArray E-test (v2.5) therefore provides an attractive option for laboratories (either 42

in austere field settings or in countries with an advanced technological infrastructure), which do not 43

routinely offer an EBOV diagnostic capability. 44

45

46


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

3

Introduction 47

An Ebola virus (EBOV) outbreak has been ongoing in West Africa since December 2013 and was 48

declared as a Public Health Emergency of International Concern (PHEIC), by the World Health 49

Organisation (WHO) in August 2014 (1). Since the outbreak began the designated United Kingdom 50

(UK) EBOV testing laboratory, the Rare and Imported Pathogens Laboratory, Public Health England 51

(PHE) has been testing 10-15 samples per week for EBOV, an approximate 10 fold increase over the 52

normal testing frequency. These samples are primarily taken from UK citizens with a recent travel 53

history to West Africa and the vast majority are not infected with EBOV. 54

The preferred sample for detecting EBOV, an enveloped negative-sense single strand RNA virus, is 55

EDTA-blood, serum or plasma with the primary diagnostic technology being real-time PCR (2). EBOV 56

is designated in the UK by the Advisory Committee on Dangerous Pathogens (ACDP) as a Hazard 57

Group 4 (HG4) pathogen that must be handled under containment level (CL)-4 standards, (Biosafety 58

Level, or BSL-4 in other countries). As such stringent laboratory infrastructure and containment 59

procedures are required to handle viable EBOV material, and only a few laboratories in Europe and 60

elsewhere are equipped to do so (3), though UK guidelines do allow for primary clinical analyses of 61

samples from individuals with possible EBOV infection to be carried out under lower containment 62

(4). 63

The FilmArray PCR platform (Biofire Diagnostics, UT), integrates sample processing, nucleic acid 64

extraction and purification, and a multiple PCR analysis into a single-use, disposable pouch (5). The 65

FilmArray was developed to fulfil a low operative burden, Point-of-Care (PoC), diagnostic screening 66

capability within a healthcare setting. Results are available around an hour after crude sample is 67

added to the pouch. Evaluations of the FilmArray Biothreat Panel pouch (a multivalent pouch which 68


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

4

contains an EBOV assay), in Sierra Leone (6) and the US (7) have demonstrated its utility in the 69

identification and treatment of Ebola positive patients. 70

In 2014 a Biothreat E-test (v2.5) pouch (hereafter referred as the Biothreat E-test) was released (8). 71

This pouch detects EBOV only and has been optimised for detection of the current strain (Makona) 72

in clinical sample types. This pouch was awarded an Emergency Use Authorisation (EUA) by the U.S. 73

Food and Drug Administration (FDA) for the presumptive detection of EBOV in whole blood or urine 74

specimens (9), and a conditional, temporary, derogation from the medical devices regulations 2002: 75

regulation 39(2) by the UK regulatory body, Medicines and Healthcare Products Regulatory Agency, 76

permitting supply and use of a non-CE marked device. 77

In this study we evaluate the performance of the Biothreat E-test against whole blood samples from 78

patients presenting in both Sierra Leone and United Kingdom. In both countries a range of samples 79

(including successive samples from individual patients), were tested by each method to generate 80

data on the sensitivity (i.e. positives from varying stages of infection with high and low viral loads), 81

and specificity (i.e. negative samples), of the Biothreat E-test. Samples were also heat treated to 82

address concerns associated with handling and processing of specimens potentially containing a 83

HG4 pathogen at lower containment. Therefore the test conditions were outside of the parameters 84

stated by the manufacturer. The overall aim was to provide further confidence, over that supplied 85

by the manufacturers validation data and Emergency Use orders, that the Biothreat E-test could be 86

used to provide a safe, reliable, and sensitive diagnostic for EBOV detection in whole blood samples 87

by laboratories (both in austere field settings or in countries with an advanced technological 88

infrastructure), which do not routinely offer an EBOV diagnostic capability. 89

90


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

5

Materials and Methods 91

Sierra Leone and UK studies 92

This study was conducted at the PHE and UK Ministry of Defence (MOD) laboratory at the Kerry 93

Town Ebola Treatment Centre in the Western Urban Area of Sierra Leone, and PHE laboratories in 94

the UK. This evaluation was performed as a field evaluation in the context of an ongoing 95

emergency. Consequently operational and logistical requirements both in the UK and Sierra Leone 96

considerably limited the scope of comparative testing that could be employed during the evaluation 97

period. 98

Whole blood samples (taken by venepuncture and collected into EDTA tubes), submitted for Ebola 99

testing, were tested on receipt by a method (RNA extraction from plasma; real-time PCR), validated 100

for routine use in PHE laboratories in Sierra Leone and the UK and then stored at 4 oC as whole 101

bloods. These samples were then tested by Biothreat E-test within 0-6 days of the diagnostic real-102

time PCR. Samples were tested on availability rather than through the application of specific 103

selection criteria and included successive samples from the same patients. 104

The UK study was conducted under Royal College of Pathology guidelines (10) for the in service 105

development of diagnostic capability (i.e. performance assessment), and as such ethical approval 106

was not sought from individual organisational ethics committees. The Sierra Leone Ethics and 107

Scientific Review Committee was consulted but, after considering the parameters of the study and 108

the UK guidance, determined that they did not need to provide approval. 109

Conventional real-time PCR in Sierra Leone and the UK 110

In the Sierra Leone laboratory, and within a flexible film isolator, EDTA-blood samples were 111

centrifuged to produce plasma. In a fresh 2 mL screw cap microtube, 80 µL of plasma was mixed 112


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

6

with 320 µL of Buffer AVL (Qiagen), the tube surface was decontaminated by wiping with 5% 113

chlorine solution and the tube was left to stand for 10 mins. The tube was removed from the 114

isolator and the sample was heated to 60 oC for 15 mins, the required temperature to inactivate 115

EBOV in a blood sample mixed with Buffer AVL (11). RNA extraction was performed from the entire 116

heat-treated 400 µL plasma / Buffer AVL sample using the Qiagen EZ1 Virus Mini Kit v2.0 and 117

Qiagen EZ1 Advanced XL platform to generate a final eluted RNA extract volume of 60 µL. Whole 118

MS2 bacteriophage was incorporated during the extraction procedure as an internal and inhibition 119

control. 120

Real-time PCR comprised the Ebola Zaire-MGB PCR (12) multiplexed with a MS2 control PCR (13). A 121

total reaction volume of 25 µL comprised: 5 µL template; Ebola Zaire-MGB primers (0.9 µM F565 122

[TCTGACATGGATTACCACAAGATC] and 0.9 µM R6405 [GGATGACTCTTTGCCGAACAATC]); probe 123

(0.25 µM P597S [6FAM-AGGTCTGTCCGTTCAA- MGBNFQ]); MS2 PCR primers (0.08 µM MS2 F1 124

[TGGCACTACCCCTCTCCGTATTCACG]; 0.08 µM MS2 R1 [GTACGGGCGACCCCACGATGAC]); probe 125

(0.16 µM MS2 [VIC-CACATCGATAGATCAAGGTGCCTACAAGC-QSY]); 6.25 µL TaqMan Fast Virus 1-126

Step Master Mix (Thermo Fisher Scientific) and water. Controls (Positive; No template [H2O]; and 127

negative extraction) were performed with each run. Positive results were recorded as a Cq value, 128

the cycle during which fluorescence was first detected above threshold during the PCR. Tests 129

conducted in the UK were performed similarly though initial sample inactivation occurred under 130

BSL-3 standards. 131

FilmArray PCR in Sierra Leone and the UK 132

Within the isolator comparator whole blood samples (200 µL) were added to a 2 mL micro-tube 133

containing the contents of FilmArray Sample Buffer ampoule (800 µL) which had previously been 134

used to re-suspend the Protease vial also supplied with the Biothreat E-test pouch. The sample was 135


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

7

mixed and tube surface decontaminated by wiping with 5% chlorine solution and left to stand for 136

10 mins. The tube was removed from the isolator and heated to 60 oC for 15 mins. The sample was 137

then added to a hydrated Biothreat E-test as per the manufacturer instructions and run on a 138

benchtop FilmArray. Three hundred µL of the blood / buffer suspension is drawn into a FilmArray 139

pouch (5) indicating around 60 µL of blood was processed and tested by the Biothreat E-test. The 140

FilmArray presents results in a qualitative Positive / Negative interpretation. No Cq data is available, 141

although melt curve peaks are viewable by the operator. Internal control PCRs (RNA extraction and 142

PCR), monitor the success of the FilmArray process. To maintain a comparison between results in 143

both countries UK FilmArray testing also included the pre-PCR heat treatment, though all work 144

occurred under BSL-3 standards. Data from both methods and countries was analysed using the ‘R’ 145

language and environment for statistical computing and graphics (14). 146

147


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

8

Results 148

Sierra Leone study 149

PCR results from 60 samples, obtained from 44 patients, are summarised in Table 1. EBOV was 150

detected in 25 samples by conventional real-time PCR and 25 samples by Biothreat E-test. 151

Discrepant PCR results were returned from 8 samples: four real-time PCR positives and Biothreat E-152

test negatives; four real-time PCR negative and Biothreat E-test positives. In a further five samples 153

control PCRs in the Biothreat E-test pouch failed and each run was declared invalid by the FilmArray 154

software, including one which returned a EBOV real-time PCR positive. These five samples were 155

excluded from the statistical analysis. The respective distribution of Sierra Leone Biothreat E-test 156

PCR results against positive real-time Cq values are included in Table 2. 157

In Sierra Leone the Biothreat E-test had sensitivity of 84% (confidence interval, CI: 64-95%) and 158

specificity of 89% (CI: 73-97%) when compared to the reference real-time PCR method. Statistical 159

analysis (Fisher’s Exact test) indicated there was no significant difference between methods at the 160

99% confidence level. 161

United Kingdom study 162

PCR results from 108 samples, obtained from 70 patients, are summarised in Table 1. In total EBOV 163

was detected in four samples by either method with one discrepant result: real-time PCR positive 164

and Biothreat E-test negative. The respective distribution of UK Biothreat E-test PCR results against 165

positive real-time Cq values are included in Table 2. In the UK (n=108; 70 patients) the Biothreat E-166

test had a sensitivity of 75%, (CI: 19-99%) and specificity of 100% (CI: 97-100%) when compared to 167

the reference real-time PCR. Statistical analysis (Fisher’s Exact test) indicated there was no 168

significant difference between methods at the 99% confidence level. 169


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

9

Discussion 170

The West African Ebola outbreak has led the international community to deploy a number of Ebola 171

diagnostic laboratories into the countries mainly affected. There has also been pressure to increase 172

the number of laboratories in the UK able to provide an EBOV diagnostic capability (for suspect 173

patients with a recent travel history to West Africa), thereby improving test turnaround times 174

irrespective of where in the UK patients present for medical attention. 175

In West Africa it has been impossible to rapidly create a BSL-4 laboratory infrastructure and to 176

ensure operative safety laboratories have used methods which rapidly inactivate EBOV prior to 177

testing. A separate study (11) has indicated that a combination of Buffer AVL (containing a 178

chaotropic guanidine salt) and heat is required to inactivate EBOV in blood samples - with individual 179

Buffer AVL or heat treatments not inactivating EBOV in samples. In Sierra Leone the EZ1 RNA 180

extraction and SmartCycler PCR platforms were operated outside of biological containment. 181

Therefore, using a flexible film isolator, all plasma samples were prepared and inactivated with a 182

combination of Buffer AVL and heat prior to RNA extraction and real-time PCR. 183

This heat-treatment step was also included for whole blood samples mixed with FilmArray Sample 184

Buffer and is outside the parameters stated by the manufacturer and the FDA EUA. We have not 185

experimentally evaluated the EBOV viricidal efficacy of FilmArray Sample Buffer (which like Buffer 186

AVL also contains a guanidine salt), with or without an additional heat treatment. Without any 187

experimental evidence we included the heat treatment as the previous study (11) indicated that a 188

dual treatment (guanidine based buffer and heat), was required to ensure EBOV inactivation. This 189

provided confidence to allow operation of the Sierra Leone FilmArray outside of containment. 190


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

10

Overall there was good concordance between the results from Biothreat E-test and real-time EBOV 191

PCR assays, particularly when used against high load (low Cq) samples (Table 2). The Sierra Leone 192

sample set, with a range of positive samples, confirmed the diagnostic sensitivity of the Biothreat E-193

test assay whilst the UK sample set, with a large number of true negatives, helped confirm the 194

specificity of the Biothreat E-test assay. 195

In total nine samples provided discrepant results, all of which came from patients who were 196

confirmed to be infected with EBOV, based on real-time PCR results and clinical findings. The results 197

comprised 4 potential Biothreat E-test false-positives and 5 false-negatives when measuring the 198

performance of the FilmArray against the reference PCR method. Timeline patient sample data is 199

summarised in Figure 1 to provide contextual information for each discrepancy. 200

Of the potential false-positive results one was from a patient sample (SL Patient 6) where repeat, 201

and next-day, samples generated real-time PCR Cq values above 36. Another (SL Patient 5), was 202

returned two days after a previous sample generated a real-time Cq result of 31.5. Two other 203

samples (SL Patients 2 and 7), tested positive by Biothreat E-test 10 and 14 days, respectively, from 204

initial samples which provided strong EBOV real-time PCR positives. Although it cannot be 205

definitively proven that these last three results are not Biothreat E-test false positive reactions a 206

previous study (7), when testing patient samples, also generated real-time PCR negatives (from 207

plasmas) but FilmArray PCR positives (from whole bloods). These were subsequently confirmed to 208

be from patients whose viral load was waning (Cq > 36). Analytical sensitivity studies in the same 209

paper produced positive (Cq = 37) and negative real-time PCR results at the EBOV titre of 4 × 101 210

TCID50∙mL-1. Therefore the four, discrepant, Biothreat E-test positive results discussed above are 211

consistent with the presence of residual, low, EBOV concentrations in blood, as has also been 212

observed in the other study (7). 213


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

11

To support this hypothesis the four potential FilmArray false-negative results (from SL Patients 1 214

and 4, UK Patient 1), were generated from samples where corresponding real-time PCR values were 215

high (>36) again indicating these samples contained low amounts of target nucleic acid but in this 216

case a potential Biothreat E-test false negative occurred. Of note, the UK discrepant result (real-217

time Cq = 37.53), was generated in a sample where a repeat sample (taken at the same time but 218

into a different EDTA blood tube), tested positive by FilmArray PCR (comparator Cq = 36.7). 219

The remaining discrepant result (a potential Biothreat E-test false-negative), was returned from a 220

patient (SL Patient 3), with a higher viral load (Cq = 29.1), than the other discrepant samples. It is 221

unclear why the Filmarray failed to detect EBOV in this sample, though it is unlikely to be due to 222

variation in the Biothreat E-test target sequence as subsequent samples from the same patient 223

were positive. This is potentially an inhibition effect with whole blood, the FilmArray sample type, 224

containing more PCR inhibitors (15), than the plasma sample type tested by real-time PCR. Indeed 225

plasma generated from the same sample and tested by Biothreat E-test did provide an EBOV 226

positive (data not shown). Although FilmArray control PCRs on the discrepant sample passed, the 227

performance of these assays is measured by the system using only qualitative melt-curve data (5), 228

and therefore an increase in control PCR Cq value, which might indicate a general inhibition effect 229

and therefore explain the EBOV negative, would not be detected by the system. Individual PCRs are 230

known to be differentially affected by the same inhibitor (16), supporting the hypothesis of a 231

control PCR pass but EBOV PCR failure. 232

In general although other potential variables within our test protocol (storage of samples prior to 233

FilmArray testing; differential sample volumes processed by each method; differential viral loads in 234

blood and plasma; laboratory error), could have affected the number and nature of the discrepant 235

results, the majority appear to correlate with samples with observed, or probable, low 236


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

12

concentrations of EBOV. At low concentrations nucleic acids are distributed stochastically (17), and 237

stochastic effects occur commonly in PCR tests, including FilmArray studies (18), when the copy 238

load in the sample is low. This gives rise to apparent discrepancies, even when the same assay is 239

used in duplicate. This requires careful interpretation and explanation by the laboratory to 240

clinicians, in the context of each case and their likely phase in the evolution of the disease. 241

While not formally assessed, a number of operational considerations were noted during the 242

operation of the Biothreat E-test. We did not find evidence of cross contamination between runs, 243

even when high viral load positive and negative samples were run in succession. Several pouches 244

also failed to hydrate properly (both countries), though this event is readily noticed during set-up 245

(and does not result in the loss of sample), and the manufacturer has recently released a new 246

version of the pouch loading station in mitigation. In addition the FilmArray, designed as a low-247

throughput screening capability and only able to test one sample per run, may not be readily 248

suitable as the primary diagnostic in an Ebola outbreak situation where high numbers of samples 249

need to be rapidly tested. Integrated PCR platforms able to test multiple EBOV samples 250

concurrently (19), or other rapid diagnostic technologies already evaluated in West Africa (20), may 251

provide more appropriate EBOV diagnostics in this scenario. 252

This study has indicated the FilmArray Biothreat E-test v2.5 offers performance comparable with a 253

validated real-time PCR approach for Ebola diagnosis and therefore a positive result can be treated 254

as a presumptive diagnosis with confidence. Of equal importance is the confidence in a negative 255

result, as part of a screening process, as this will have considerable significance for both patient 256

care and wider public health response in both epidemic and non-epidemic countries. The slight 257

differences in results between both PCR methods likely reflect the stochastic differences at low 258


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

13

levels of pathogen during recovery and sampling stages, rather than performance differences 259

between the different assays. 260

In summary we show that the FilmArray Biothreat E-test (v2.5) is sensitive and specific and, when 261

also considering the low logistic and operative burdens and speed to result, provides an attractive 262

option for a low-throughput laboratory, without either BSL-4 trained staff or infrastructure, wishing 263

to provide an EBOV diagnosis capability. Such a laboratory could either have an existing 264

containment infrastructure and therefore reduce the workload on a centralised reference 265

laboratory or, if using a method to rapidly inactivate EBOV prior to PCR, be a field laboratory in an 266

austere or remote environment. 267

Acknowledgements 268

This study was funded by the UK Ministry of Defence and Public Health England. The Sierra Leone 269

evaluation was performed at the Kerry Town Ebola Treatment Centre funded by the UK Department 270

for International Development. 271

We acknowledge and thank the volunteer and MOD staff in the laboratory in Kerrytown, SL for their 272

contribution to the study execution. Similarly we thank the staff in the UK for their role in 273

diagnostic processing of patient specimens. 274

© Crown copyright (2015), Dstl. This material is licensed under the terms of the Open Government Licence 275

except where otherwise stated. To view this licence, visit http://www.nationalarchives.gov.uk/doc/open-276

government-licence/version/3 or write to the Information Policy Team, The National Archives, Kew, London 277

TW9 4DU, or email: [email protected]. 278

279


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

14

References 280

1. World Health Organisation. 2014. Statement on the 1st meeting of the IHR Emergency 281

Committee on the 2014 Ebola outbreak in West Africa. World Health Organisation. 282

http://www.who.int/mediacentre/news/statements/2014/ebola-20140808/en/ 283

2. Towner JS, Rollin PE, Bausch DG, Sanchez A, Crary SM, Vincent M, Lee WF, Spiropoulou CF, 284

Ksiazek TG, Lukwiya M, Kaducu F, Downing R, Nichol ST. 2004. Rapid diagnosis of Ebola 285

haemorrhagic fever by reverse transcription-PCR in an outbreak setting and assessment of 286

patient viral load as a predictor of outcome. J Virol 78: 4330-4341 287

3. Reusken C, Niedrig M, Pas S, Anda P, Baize S, Charrel R, Di Caro A, Drosten C, Fernandez-288

Garcia MD, Franco L, Gunther S, Leparc-Goffart I, Martina B, Pannetier D, Papa A, Sanchez-289

Seco MP, Vapalahti O, Koopmans M. 2014. Identification of essential outstanding questions for 290

an adequate European laboratory response to Ebolavirus Zaire West Africa 2014. J Clin Virol 62: 291

124-134. 292

4. Department of Health and Health and Safety Executive. Management of Hazard Group 4 viral 293

haemorrhagic fevers and similar human infectious diseases of high consequence. Accessed 294

online June 2015: 295

https://www.gov.uk/government/uploads/system/uploads/attachment_data/file/377143/VHF296

_guidance_document_updated_19112014.pdf 297

5. Poritz MA, Blaschke AJ, Byington CL, Meyers L, Nilsson K, Jones DE, Thatcher SA, Robbins T, 298

Lingenfelter B, Amiott E, Herbener A, Daly J, Dobrowolski SF, Teng DHF, Ririe KM. 2011. 299

FilmArray, an Automated Nested Multiplex PCR System for Multi-Pathogen Detection: 300

Development and Application to Respiratory Tract Infection. PLoS ONE 6: e26047. 301

doi:10.1371/journal.pone.0026047 302


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

15

6. Leski, TA, Ansumana R, Taitt CR, Lamin JM, Bangura U, Lahai J, Mbayo G, Kanneh MB, Bawo 303

B, Bockarie AS, Scullion M, Phillips CL, Horner CP, Jacobsen KH, Stenger DA. 2015. Use of 304

FilmArray system for detection of Zaire Ebolavirus in a small hospital, Bo, Sierra Leone. J Clin 305

Microbiol doi: 10.1128/JCM.00527-15. 306

7. Southern TR, Racsa LD, Albarino CG, Fey PD, Hinrichs SH, Murphy CN, Herrera VL, Sambol AR, 307

Hill CE, Ryan EL, Kraft CS, Campbell S, Sealy TK, Schuh A, Ritchie JC, Lyon GM, Mehta AK, 308

Varkey JB, Ribner BS, Brantly KP, Stroher U, Iwen PC, Burd EM. 2015. Comparison of the 309

FilmArray and qRT-PCR for the detection of Zaire ebolavirus from contrived and clinical 310

specimens. J Clin Microbiol Doi:10.1128/JCM.01317-15 311

8. Biofire Defense. 2014. Accessed Online June 2015. 312

http://biofiredefense.com/media/RFIT-PRT-0302-FA-BioThreat-E-Instructions-for-Use.pdf 313

9. Food and Drug Administration. Accessed Online June 2015: 314

http://www.fda.gov/downloads/EmergencyPreparedness/Counterterrorism/MedicalCounterm315

easures/MCMLegalRegulatoryandPolicyFramework/UCM420421.pdf 316

10. The Royal College of Pathologists, Accessed Online June 2015. 317

http://www.rcpath.org/Resources/RCPath/Migrated%20Resources/Documents/G/G035_Guida318

nceUseofClinicalSamples_Nov12.pdf 319

11. Smither SJ, Weller SA, Phelps A, Eastaugh L, Ngugi S, O’Brien LM, Steward J, Lonsdale SG, 320

Lever MS. 15 July 2015. Buffer AVL alone does not inactivate Ebola virus in a representative 321

clinical sample type. J Clin Microbiol doi:10.1128/JCM.01449-15 322

12. Trombley AR, Wachter L, Garrison J, Buckley-Beason VA, Jahrling J, Hensley LE, Schoepp RJ, 323

Norwood DA, Goba A, Fair JN, Kulesh DA. 2010. Comprehensive Panel of Real-Time TaqMan™ 324

Polymerase Chain Reaction Assays for Detection and Absolute Quantification of Filoviruses, 325

Arenaviruses, and New World Hantaviruses. Am J Trop Med Hyg 82:954–960. 326


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

16

13. Rolfe KJ, Parmar S, Mururi D, Wreghitt TG, Jalal H, Zhang H, Curran MD. 2007. An internally 327

controlled, one-step, real-time RT-PCR assay for norovirus detection and genogrouping. J Clin 328

Virol 39:318–21. 329

14. R Core Team. 2013. R: A language and environment for statistical computing. R 330

Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-07-0. Accessed 331

online June 2015: http://www.R-project.org/ 332

15. Al-Soud WA, Radstrom P. 2001. Purification and characterisation of PCR-inhibitory 333

components in blood cells. J Clin Microbiol 38:4463-4470. 334

16. Minogue TD, Rachwal PA Trombley-Hall A, Koehler JW, Weller SA. 2014. Cross institute 335

evaluations of inhibitor resistant PCR reagents for direct testing of aerosol and blood samples 336

containing biological warfare agent (BWA) DNA. Appl Environ Microbiol 80: 1322-1329. 337

17. Taberlet P, Griffin S, Goossens B, Questiau S, Manceau V, Escaravage N, Waits LP, & Bouvet J. 338

1996. Reliable genotyping of samples with very low DNA quantities using PCR. Nuc Acid Res 24, 339

3189-3194. 340

18. Weller SA, Cox V, Essex-Lopresti A, Hartley MG, Parsons TM, Rachwal PA, Stapleton HL, 341

Lukaszewski RA. 2012. Evaluation of two multiplex real-time PCR screening capabilities for the 342

detection of B. anthracis, F. tularensis, and Y. pestis in blood samples generated from murine 343

infection models. J Med Microbiol 61:1546-1555. 344

19. Food and Drug Administration. Accessed Online June 2015: 345

http://www.fda.gov/downloads/MedicalDevices/Safety/EmergencySituations/UCM439583.pdf 346

20. Walker NF, Brown CS, Youkee D, Baker P, Williams N, Kalawa A, Russell K, Samba AF, Bentley 347

N, Koroma F, King MB, Parker BE, Thompson M, Boyles T, Healey B, Kargbo B, Bash-Taqi D, 348

Simpson AJ, Kamara A, Kamara TB, Lado M, Johnson O, Brooks T. Evaluation of a point-of-care 349

blood test for identification of Ebola virus disease at Ebola holding units, Western Area, Sierra 350


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

17

Leone, January to February 2015. Euro Surveill 2015;20(12):pii=21073. Available online: 351

http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=21073 352

353


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

18

Table 1. Summary of EBOV real-time PCR and Biotheat E-test PCR results from patient samples tested 354

in this study 355

356 a Sensitivity and specificity of the E-test, measured against the reference real-time PCR method, 357 calculated using the R statistical language and environment (14). 95% confidence intervals in 358 parentheses. 359

360

361

362

EBOV PCR results from patient samples

Sierra Leone samples (n=60; 44 patients) UK samples (n=108; 70 patients)

real-time NP PCR real-time NP PCR

Positive Negative Positive Negative

E-test

Positive

21 4

E-test

Positive 3 0

Negative 4 31 Negative 1 104

E-test sensitivity 84% (64-95%)a 75% (19-99%)a

E-test specificity 89% (73-97%)a 100% (97-100%)a


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

19

Table 2. Distribution of FilmArray Biothreat E-test (v2.5) PCR results against Cq values generated by 363

Ebola Zaire MGB (NP target) PCR from samples tested in Sierra Leone and UK 364

Cq range of Ebola Zaire-MGB

(NP) PCR positive results

Biothreat E-test (v2.5) result

Positive Negative

15-20 6 0

20-25 2 0

25-30 3 1

30-35 10 0

>35 3 3

n = 24 4

365

366 on April 14, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

20

Figure 1. Representation of nine patient samples in Sierra Leone (SL) and the United Kingdom (UK) 367

with discrepant Ebola Zaire-MGB and Biothreat E-test PCR results, with preceding and subsequent 368

test results. 369

370

371

a Cq = PCR cycle number during which fluorescence first detected in 40 cycle PCR; POS = Biothreat 372

E-test positive; NEG = Biothreat E-test negative; NT = not tested. Shading indicates sampling and 373

testing points by each method, Arrows indicate discrepant results. 374

b A subsequent real-time PCR test on the same sample was positive (Cq = 36.3) 375

c Two samples taken at the same time on day 8 (into different EDTA blood tubes). 376

377


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

Evaluation of the Biofire FilmArray Biothreat E-test (v2. 5) for rapid ...

Documents

Transcript of Evaluation of the Biofire FilmArray Biothreat E-test (v2. 5) for rapid ...