Vol. 147, No. 3JOURNAL OF BACTERIOLOGY, Sept. 1981, p. 87548870021-9193/81/090875-13$02.00/0

Escherichia coli gal Operon Proteins Made After ProphageLambda Induction

CARL R. MERRIL,`* MAX E. GOTTESMAN,' AND SANKAR L. ADHYA2Laboratory of General and Comparative Biochemistry, National Institute ofMental Health,' and

Laboratory ofMolecular Biology, National Cancer Institute,' Bethesda, Maryland 20205

Received 19 February 1981/Accepted 2 June 1981

Expression of the Escherichia coligal operon under the control of the prophagelambda promoter pL leads to gross discoordinacy ofgal expression. Expression ofthe most promoter-distal cistron galK is much greater than expression of thepromoter-proximal cistron galE. We had previously shown that transcription ofthe gal operon is coordinate after prophage induction. A survey of proteinsynthesized after prophage induction indicated that lack of expression of galE isdue to a failure of translation of the galE sequence in the pL-gal transcript. Thisfailure oftranslation ofthegalE sequence may be due to extensive dyad symmetrypresent in the vicinity of the gal promoter region of the pL-gal transcript. Thissymmetry could result in a ribonucleic acid stem-loop structure, blocking theattachment of ribosomes at the Shine-Dalgarno sequence of galE. To test thismodel, strains bearing the ISI or IS2 insertion, deletion, or new promotermutation within the symmetrical region were constructed. The restoration ofsome galE expression after such disruptions of the symmetrical region indicatedthat the ribonucleic acid stem-loop structure did play a role in the discoordinateexpression ofgal from pL. However, failure to obtain galE expression coordinatedwith high levels of galK expression suggested that other components wereinvolved, perhaps other symmetries between galE and the pL transcript.

The induction of lambdoid prophages resultsin the phage-controlled expression of neighbor-ing bacterial genes (2, 10, 14). Under conditionsin which prophage replication is blocked, this"escape synthesis" is due exclusively to tran-scription initiating at phage promoters and ex-tending into the bacterial chromosome. Thelambda N gene product, or its analog in relatedphages, permits phage-initiated transcription toproceed through transcription termination siteson the phage or bacterial DNA. Aside from geneN and a site on the prophage chromosome, nutL,which is necessary for the action of the N prod-uct, no other phage gene is required for N-me-diated escape synthesis (2, 8, 9, 26).We have studied extensively the expression of

the Escherichia coli gal operon under the con-trol of the prophage lambda promoter pL. Wereported previously that phage-controlledexpression of the enzymes of the gal operon isabnormal (18). Induction of the gal operon byD-galactose or D-fucose results in the coordinatesynthesis of the gal enzymes uridine diphos-phate galactose 4-epimerase (epimerase), galac-tose 1-phosphate uridyltransferase (transferase),and galactokinase (kinase), the products of thegalE, galT, and galK cistrons, respectively (5).

Induction of prophage lambda, however, leadsto gross discoordinacy of gal expression, withextensive synthesis of kinase and little or nosynthesis ofepimerase (18). Thus, the expressionofthe most promoter-distal cistrongalK is muchgreater than the expression of the promoter-proximal cistron galE. Since the rate of tran-scription of the cistrons is coordinate after pro-phage induction, the discoordinacy must resultfrom a failure to translate properly the galEsequences in the pL-gal transcript (18). It ispossible that the galE sequences are not trans-lated at all. Alternatively, the sequences may betranslated incorrectly, with the synthesis of anabnormal, inactive polypeptide. For example,translation may initiate upstream ofgalE on thepL-gal transcript; two unutilized AUG codonsare present in frame and immediately upstreamfrom galE (22, 27).We have attempted to distinguish between

these possibilities by examining by two-dimen-sional gel electrophoresis the proteins synthe-sized after lambda induction. Our results areconsistent with the first model, viz., that trans-lation of galE does not take place from the pL-gal transcript. Analysis of insertion and deletionmutants which partially restore epimerase syn-

875

876 MERRIL ET AL.

thesis after prophage induction suggests that aregion of symmetry in the pL-gal transcript mayocclude the ribosome attachment site for galE.

MATERIALS AND METHODSRadioisotope '4C (as mixed 4C-amino acids with

specific activities ranging from 175 to 516 Ci/mol) wasobtained from New England Nuclear Corp., Boston,Mass.

Materials for electrophoresis. Ampholytes forisoelectric focusing (pH range, 3 to 10) were obtainedfrom Bio-Rad Laboratories, Richmond, Calif. Sodiumdodecyl sulfate was from BOH Biochemicals Ltd.,Poole, England. Urea (ultrapure) was from Schwarz/Mann, Orangeburg, N.Y., and protein molecularweight markers were from Pharmacia Fine Chemicals,Inc., Piscataway, N.J.

In vivo labeling. E. coli cells were grown in M56minimal medium supplemented with 0.5 ml of 1%histidine, 0.47 ml of 1% valine, 0.047 ml of 1% biotin,and 0.5 ml of 40% glucose per 100 ml of medium. Thecells were grown to a density of 1 x 108 to 3 x 10/ml.Induction of the gal operon was performed for 15 minwith 0.3% D-fucose or D-galactose or, in the case ofescape synthesis with A cI857 lysogens, a temperatureshift from 34 to 41°C. After induction, 25 ,iCi of amixture of '4C-amino acids (New England Nuclear;NEC-445) was added to 2 ml of each culture. Inexperiments in which the position of kinase was deter-mined by antibody precipitation, E. coli proteins werelabeled with 25 ,uCi of [3S]methionine (New EnglandNuclear, NEG-009'). At the end of a 5-min labelingperiod, 0.2 ml of 10% Casamino Acids and 20 pl of 2 Msodium azide were added, and the culture was chilledin an ice bath. The culture was centrifuged for 2 minin an Eppendorf centrifuge (1.5-ml tubes) at 12,500 xg. The supernatant was discarded, and the pellet wassuspended in an equal volume of two-dimensional lysisbuffer (20) and heated to 950 for 5 min. The tubeswere then chilled in ice and again centrifuged at 12,500x g for 2 min. The supernatant extract was saved andstored at -70°C until use. Antibody precipitation wasperformed by a double-antibody technique describedpreviously (19). Antikinase antibody was a gift ofDavid Wilson. The precipitation was performed with50 td of E. coli cell extract prepared as described abovebut with an additional 20-min period of centrifugationat 90,000 x g (Airfuge; Beckman Instruments, Inc.,Fullerton, Calif.). Kinase specific antibody (1.5 pl; giftof D. Wilson) was added with 20 pl of a 10% solutionof Nonidet P-40 (BRL, Gaithersburg, Md.) and 180 plof a solution containing 20 mM Tris-hydrochloride(pH 7.8), 20 mM KCI, 0.5 mM dithiothreitol, 6 mMMgCl2, and 0.1 mM EDTA. The mixture was incu-bated ovemight at 4°C. The following day, 15 pl ofantigoat rabbit antibody (code no. 65-006; Miles-Yeda,Ltd.) was added, and incubation was continued for anadditional 12 h. The mixture was then centrifuged at12,500 x g for 2 min, and the pellet was washed withphosphate-buffered saline containing 1% Nonidet P-40. It was then suspended in 30 ml of a solutioncontaining 2% sodium dodecyl sulfate, 5% mercapto-ethanol, 20% glycerol, and 2% Nonidet P-40 (BRL).This suspension was heated at 95°C for 5 min and

then cooled to room temperature. Nonradioactive E.coli cell extract proteins were then added (15 ,ul), andthe solution was made 9 M with urea. Two-dimen-sional electrophoresis was then performed.Two-dimensional gel analysis. Two-dimensional

electrophoresis was performed by the method ofO'Farrell (24), with 3/10 Biolyte in the first dimensionand a 10% acrylamide uniform gel in the second di-mension. Isoelectric focusing was at 500 V for 20 h;slab gels were run at 20 mA/gel. The methods for gelstaining and autoradiography have been describedpreviously (20).Enzyme assays. Kinase and epimerase were as-

sayed as described before (18).Strain constructions. Constructions are indicated

in Table 1.

RESULTSIdentification of kinase, transferase, and

epimerase by two-dimensional gel electro-phoresis. The location of the gal enzymes wasdetermined by comparing the gel patterns of the14C-labeled polypeptides of two strains, N5408and N5409. N5408 carries plasmid pBR313;N5409 bears pSB101, a pBR313 derivative intowhich the gal operon was cloned (see Materialsand Methods). After being labeled with 14C-amino acids, cultures of the two strains werelysed, and the polypeptides were denatured andsubjected to two-dimensional gel electrophore-ses (24). Separation in the first dimension wasbased on isoelectric focusing; separation in thesecond was based on molecular weight. The gelswere then dried and autoradiographed for 24 to48 h. The resultant pattern of polypeptides isdisplayed in Fig. 1A and B. Three very densespots with approximately equal intensities ap-peared in the gels derived from N5409 (panel A)which were missing from parental strain N5408(panel B). The spots appeared, although insmaller amounts, after D-galactose induction ofa gal' strain, N4903, not carrying a plasmid(panel C). The gal-deleted strain S165, grown inthe presence of D-galactose (panel D), or N4903,grown in the absence of D-galactose (panel E),did not synthesize these polypeptides.These results indicate that the three labeled

polypeptides were derived from the gal operon.The molecular weights of the SB101 specificpolypeptides seen in Fig. 1 were 40,000, 38,000,and 34,000. These molecular weights are con-sistent with the apparent subunit molecularweights of the three gal enzymes, viz., kinase(40,000), transferase (39,000), and epimerase(32,000), as determined by sodium dodecyl sul-fate-gel electrophoresis (D. Wilson, personalcommunication). On the basis of their molecularweights, we indicated the location of the kinasetransferase and epimerase subunits on our two-dimensional gels (Fig. 1A).

J. BACTERIOL.

E. COLI gal OPERON PROTEINS 877

TABLE 1. Strain construction8Selection andStrain Structure Parent, source, or reference Seening'' 8~~~~~~creerling

F- Su- his rps-L relAl l(gal K-E)(chlD-blu) A8 (A [cro-uvrB] A41)48 (A [int-ral] ABAM 4111)A8 (A ABAM N7, 53 AH1)rho-15 A8 (A ABAM N7,53 AHi)rho-15 48 (A 4BAM A11)48 galEl I(Oc) galEop490 (A ABAM A41)4848 galEop490 (A ABAM 4111)48 (A ABAM 4111)48 galEop490-Oc (A ABAM AH1)48 (A ABAM A11; i2'ats gal 313 Eam5748 (A 4BAM A1; i2'cts gal 313 Tam151)A8 gal E57(Am) (A ABAM A41)48galT151(Am) (A 4BAMA1)48 (A ABAM 41; i21Cts gal 313 Kam150)A8 galK150(Am) (A ABAM A41)48 galE57(Am) (A ABAM A1; A bio7-20 nutLr32)

A8 galE57(Am) (A ABAM nut&4A11)(galT-AcIII) 4482 (A A41)48 (A ABAM A1; i4CtS gal482)A8 (A 4111; A bio7-20 AS-Xh)48 (A bio7-20 AS-X 4111)S165(pBR313)S165(pSB101)48 (A BAM A1; i4cts gal1313op128)A8 galEopt28 (A 4BAM 4111)48 galEopl28 (A 4BAM A1; A bio7-20)48 galEopl28 (A bio7-20 A41)488galEop128 (A(galop-kil] 4A111)48 (A bio7-20 4S-X AH1; A xisl intc 548h)A8 (A bio7-20 4S-X A41; A xisl intc 57)A8 (A xi81 inte 548 AS-X A41)48 (A xisl intc 57 4S-X AH1)A8 (A A41)48 (A AH1; i21cts AS-X)A8 galTN102 (A ABAM 4111)

N.I.H.' collection(11)

(11)

(11)

(11)

(11)

(11)

(11)

4893

4927

4927

4830 ji2'cts gal313 Eam52N4830 + i2l gal313 Tam1515139N51404830 + i2lCts gall313 Kam150N51505141 + Abio7-20 nutu r32

51785378N4830 + i4cts gal4824741 + A bio7-20 AS-/h5385 + 121 gal8S. BusbyS. Busby4830 + i4cts gal313op12855025503 + A bio7-205567 + i2Icts Ab2 Anin5 Daml5N55725387 + A xisl int' 548h5387 + A xisl intc 547h5673567457044741 + i2'cts AS-XN. Grindley

Gal+, 400CGal+, 320CGal+, 320C21 immunity21 immunitytR

tR, Gal-21 immunitytrDTB+

tr galrGal-434 immunityDTBtr

434 immunitytrDTB+DTB- t

tr

A yielderA yieldertrtrtr21 immunity

a Phage referred to as "A" carry the thermoinducible repressor mutation c1857. Other than S165 and its derivative, all strainscarry an ilvA mutation. Where indicated, rho-15 was introduced by P1 cotransduction with ilvA+. N4893 bears the galElI(Oc)mutation (R. Musso, personal communication). A 4S-X was a gift of Steve Rogers and is deleted from the 67.7% A sal site in redto the 69.0% A xho site in clII. The bio7-20 derivative was obtained by standard genetic crosses. A xisl int' 57h and A xisl int'548h were gifts of L. Enquist; both bear IS2 insertions in xis. A i21cts 4b2 Anin5 Daml5 was obtained from N. Sternberg. A i2lCtsgall313 Kaml50 was derived from a lysogen carrying 313, a deletion with endpoints in chID and int. pSB101, constructed bySteve Busby, carries the gal RI-sma fragment from Agal8 cloned between the RI and hpaI sites of pBR313. A bio7-20 nutLa r32was obtained from J. Salstrom. DTB+, Ability to grow on minimal plates supplemented with desthiobiotin; t, temperatureresistance; t, temperature sensitivity. The two phage deletions are shown below.

KTE0 V9___m __st

KT chI At Mt AV red Id cR N_n im r

PogN.I.H., National Institute of Health.

The identification of the kinase subunit wassupported by the following analysis. '4C-labeledcellular proteins were immunoprecipitated withpurified antibody to kinase. The precipitate wasthen washed and subjected to two-dimensionalgel electrophoresis. An autoradiograph of sucha gel showed a single radioactive spot against a

background of total E. coli proteins stained with

-x-L PR

Coomassie blue (Fig. 2). Additional evidence forthe identification of the transferase and epimer-ase subunits is presented below.Polypeptides synthesized after prophage

lambda induction. We next examined the poly-peptides made after induction of a lambda ly-sogenic strain, N4830. N4830 carries a prophage,X cI857 ABAM AH1, which is deleted for all

S165N4741N4830N4831N4837N4845N4893N4903N4927N4927-1N4927-12N5139N5140N5141N5142N5150N5151N5178

N5179N5383N5378N5385N5387N5408N5409N5502N5503N5567N5572N5575N5673N5674N5678N5679N5705N5704NG315

VOL. 147, 1981

878 MERRIL ET AL.R.. ;

I .L

0._

-a...

*~~~~~~~~. Iqv 0

-.90

a *e

*4;

*_1'* RNbaa _ 4

&_@0*as S P ..SF-SF!,

ci_r

00d,l

14 Stb' K.p*

D

-d40*,'

_-- - E f-. vs_ ...- _w

.._

40

10

-will. .Wsmm.m.W.,,iqiiipiw .w

4m -

.-Ab.

t.

w .

*0

FIG. 1. Identification ofkinase, transferase, and epimerase by two-dimensional gel electrophoresis. PanelsA through E represent extracts from strains N5409 (PSB 101 induced), N5408 (PBR 313 induced), N4903 (gal'induced), S165 (Agal induced), and N4903 (gal' uninduced), respectively. Induction with D-galactose was

performed as indicated in the text.

known phage cistrons except N, rex, and cI (Arepressor). The cI857 repressor is thermolabile;prophage is induced by shifting a culture oflysogenic cells from 32 to 410C. The patterns ofpolypeptides synthesized after induction ofstrains N4830, N4831 (an N- control), andN5179 (an N' nut3 derivative of N4830) are

displayed in Fig. 3. Three labeled polypeptidesappeared after induction of the N+ strain N4830which were absent from the control strainsN4831 (N-) and N5179 (N' nutu) (Fig. 3).These were transferase, kinase, and an uniden-tified spot, referred to here as "X." No spotappeared in the location of epimerase.

A

#- e 4

lb

L

B

:..

:._r

T --**~:E --_s

>nuf....A

a

'.a4

_e

'1...11-4 .. o .aw- ~ t

aWI4

W1-1-1-1-m.-

1-1 -- l--lll.--:,-.--.-..-...,

r. ......- r- .

J. BACTERIOL.

.im ow

I'ii

I

r..-.;ZM4

-

_. .:: .

.w

40:.,N& 40 0

4

Im -!,

11

E. COLI gal OPERON PROTEINS 879

MW

X 10 3

43 - ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~..... ... .. ....... ... _...- ---

......35S protein3 0 - ----- ~-------- ------ w..

FIG. 2. Antikinase antibody precipitate of 3"S-labeled E. coli polypeptides from strain N5141. A photo-graph of Coomassie blue-stained nonradioactive E. coli polypeptides indicatd by the less dense spots issuperimposed with the 35S-labeled proteins. The 3S spot in the position presumed to be kinase in otherexperiments was the only major autoradiographic spot. MW, Molecular weight.

Kinase, transferase, and X must have beensynthesized from the A PL transcript since theywere absent in induced cultures of N5179. Recallthat the nutLa mutation prevents the extensionof transcription from PL beyond transcriptiontermination signals, but does not inhibit theexpression of the N gene. We assume that X, likekinase and transferase, is encoded by bacterialDNA to the left of the A attachment site.The absence of phage-induced polypeptides in

extracts of N5179 indicated that the synthesis ofno major polypeptides was stimulated in transby the N product. The observation that theexpression of the sigma subunit of RNA polym-erase is enhanced by the N product (23) couldnot be confirmed or eliminated by these data;sigma is a relatively minor polypeptide whichwe were not able to locate unambiguously onour gels.The polypeptide product of gene N was not

visible under our conditions; the N protein is oflow molecular weight (14,000) and is extremelyunstable, with a half-life of 5 min (12, 13, 16).We next asked whether X was encoded by

sequences within the gal operon. The X poly-peptide did not appear in gels of extracts from astrain carrying pSB101 or in gal' strains afterD-fucose induction (Fig. 1); it was, therefore, notexpressed from the gal promoter. X also ap-peared in extracts of induced lysogens with mu-tations in galT and galE (Fig. 4). The X poly-peptide was seen after prophage induction ofNG315, which carries N102, an ISJ insertion ingalT (15). N5383 bears the 482 deletion, whichremoves a portion of galT, all of galE, and the

bacterial DNA between galT and gene N. It alsoexpresses X after prophage induction. X cannot,therefore, be encoded by galE sequences. Ourresults are best explained if X were encoded bybacterial DNA to the left of the gal operon.

In Fig. 5 we present the gel analysis of poly-peptides synthesized after D-fucose or prophageinduction in strains bearing amber mutations ingalE or galK (4). D-Fucose induction of N5141[galE57(Am)] yielded no gal-specific polypep-tides; the E57(Am) mutation was polar on galTand galK. The appearance of epimerase andtransferase after D-fucose induction of N5151[galK150(Am)] can be seen clearly. Neither ex-tract contained the X polypeptide.Prophage induction of N5141 resulted in the

appearance of transferase, kinase, and X; thepolarity of the galE57(Am) mutation was sup-pressed by the N function. N5151, when ther-mally induced, synthesized transferase and X.These data are consistent with those presentedabove: (i) expression of galE did not occur afterprophage induction; (ii) galE operon nonsensemutations did not eliminate the synthesis of theX polypeptide.gal discoordinacy is not caused by the N

gene product. The formation of the pL-galtranscript normally requires the antiterminationactivity of the prophage N gene product. It hasbeen suggested that the N product may act atthe ribosomal level and, thus, might influencethe translation of specific proteins (1, 3; D. I.Friedman, A. T. Schauer, M. R. Baumann, L. S.Baron, and S. L. Adhya, Proc. Natl. Acad. Sci.U.S.A., in press). To determine whether pN

VOL. 147, 1981

880 MERRIL ET AL.

Al

4

B

C;

- i

I 1.FIG. 3. Polypeptides synthesized after prophage lambda induction. "C-labeled polypeptides from strains

(A) N4830, (B) N4831, and (C) N5179 separated by two-dimensional electrophoresis. MW, Molecular weight.

interfered with the translation of galE, we con-structed a rho-15 (7) derivative of N4831, N4837.gal escape synthesis occurs in N4837, despite

the fact that it is mutant for N, because thetermination signals between pL and gal in thisstrain are Rho dependent (12).

J. BACTERIOL.

, ,r

E. COLI gal OPERON PROTEINS 881

4 AIF Al4 it I-,

a'

T-*'1'_ m

_ 1.1 f

4w I --.tiA _- .

'C

__

e

gal TN 02

a

EU-l* E t~~~~~E1.'_tK

4W-7. ---7w-.-------

:S ~ M

.w.~ ~ ~ ;

VPe

0~

FIG. 4. Lambda-induced gal polypeptides in gal mutant strains. "C-labeled polypeptides from strains (A)N4830, (B) NG315, and (C) N5383.

gal (TIE) . C

40~~*-

.*

r%L

VOL. 147, 1981

;D

W.

882 MERRIL ET AL.

~ 0

SiF4 _ ,

* ~4| > .i.<_.Fm, _ _ - |~.;

.!--4, _ 4,

i~~~~ ~ ~ ~ ~ ~ ~~~~~~4k

Amw~ ~ ~

FIG. 5. "4C-labeled polypeptides synthesized in gal Kaml50 or gal Eam57 lysogens. N5151 (gal Kaml50) orN5141 (gal Eam57) was grown at 32°C with D -fucose (right-hand panels) or at 410C (left-hand panels).

We observed the same discoordinacy with theN- strain as with an N+ lysogen; there was anextensive synthesis of kinase without a corre-

sponding increase in epimerase (Table 2). Therelatively high levels of epimerase in rho-15strains at 42°C is due to constitutive expressionof the gal promoter in Rho-defective cells (7).We concluded that the failure to translate galEfrom the pL-gal transcript was a property of thetranscript itself and not the result of the actionof pN.Dyad symmetry in the gal control region

affects discoordinacy. A distinctive feature ofthe gal operon is extensive DNA symmetry inthe operator-promotor region (27). This sym-metry is not normally included in gal mRNA,since the transcription start site lies within thesymmetrical region (Fig. 6). The expression ofgal from PL, however, does yield a transcriptwhich includes the symmetry and has the poten-tial of forming the duplex structure shown inFig. 6. The stem of this structure contains 20base pairs and is stable, with a calculated freeenergy loss of -86.7 J/mol (28). The ribosome-binding site of galE mRNA is included in thisstem and would presumably be inaccessible fortranslation.To assess the contribution of this symmetry

to the discoordinate expression of gal, we con-

structed a series of mutants with alterations inthe symmetrical region.

(i) Mutation gal-128 was an 800-base pair IS1insertion in gal DNA between positions +3 and+4, corresponding to the gal mRNA start site(15, 17). This insertion interfered with stem for-

TABLE 2. Discoordinate gal expression in lambdaN- lysogensa

Pro-Epne-KnsStrain moter N rho Epimer- KnU) EK

inducedas(U () EK

N4830 Pgal + + 29.8 11 2.7N4845 Pgal - rho-15 28.7 12 2.4N4830 PL + + 5.9 81 0.07N4831 PL - + 4.1 2N4845 PL + rho-15 8.8 84 0.10N4837 PL - rho-15 6.3 51 0.12

a gal' strains lysogenic for A cI857 ABAM H1 wereinduced for 50 min in Luria broth with 0.3% D-galac-tose at 32°C or at 41°C in the absence of D-galactose.At 32°C without D-galactose, epimerase and kinasebasal levels were 3 and 2 U, respectively. Units (U) ofkinase are nanomoles of [14C]galactose-l-phosphateformed per minute by 109 cells. Units (U) of epimeraseare nanomoles of UDP-galactose converted to UDP-glucose per minute by 109 cells.

mation and, thus, exposed the occluded galEmRNA ribosome-binding site.The kinase and epimerase values for strains

N4830 and N5503, a gal-128 derivative of N4830,are given in Table 3. Both strains showed highkinase levels after prophage induction. StrainN5503, in contrast to N4830, also displayed sig-nificant synthesis of epimerase at 42°C. Therelief of discoordinacy by the IS1 insertion wasonly partial. The ratio of epimerase activity tokinase activity (EIK) after D-galactose induc-tion was about 2.4. The EIK ratio for 5503 wasabout 0.1. If discoordinacy were entirely elimi-nated, we would observe in induced cultures of

J. BACTERIOL.

E. COLI gal OPERON PROTEINS 883

S

3' ...GAAAAGCGTAGAAACAATACTATACCAAAAAGTATGGTATTCGGATTACCTCGCTTAATAC 5111CTTCCTCTGTA1AAGG1TTA1111111111ACCATAAGCCTAATGGA GCGAATTAT G..11 3

5' .C TTTTCGCAT CTTTGTTATGA TA TGGT T TTITCATACCATAAGCCTAATGGA GCGAATTAT G. . 3

TRANSCRIPTION FROM GALACTOSE OPERON PROMOTER

5 AA 16S RNAAc 3'HO 6iACCA AU

mRNAUAA UCCUCCAUAG 5'

GcA rRNA binding regionUGGAGCGAAUUAUG .3'

fMe/

3' ...GAAAAGCGTAGAAACAATAC T1ATACCAATAAAGTATGGTATTCGGATTACCTCGCTTAATA C 51111111 II 1111111111 1111111111111111111111 111111111 1

5' C TTTTCGCATCTTTGTTATGATATGGT TATTTCATACCATAAGCCTAATGGAGCGAATTAT G. ..3

TRANSCRIPTION FROM A QL PROMOTER

mRNArRNA binding region

5' .CUUUUCGCAUCUUUGUUAUGAUAUGGUUAUUUCAUA CCAUAAGCCUAAUGGACGAAUUAUG .. .3f W

3' ...GAAAAGCGTAGAAACAATAC T1ATACCAAITAAAGTATGGTATTCGGATTACCTCGCTTAATAC 5

5' ...C TTTTCGCATCTTTGTTATGATA2TGGTIT|ATTTCATACCATAAGCCTAATGGA GCGAATTAT G. .3'

is490 IS 128

; rRNA binding site UU AUG.. .3A YA A C fMetC UA C-CC-A-U-AG -C U-A-A-U-G -G-A-G-C-G-A-A

U A ,U-G-G-U-A-U-C-G A-U-U-G-U-U-U C-G-C-U-U%U-A-lu- u ~~~~UA UUC. -.5'FIG. 6. DNA sequence of the gal operon and of the gal mRNA initiated at the gal or lambda PL promoter.

The stem-loop structure of the pL-gal transcript proposed by Steitz (28) is shown at the bottom.

N5503 about 700 U of epimerase instead of 30U.Because the dyad symmetry remained in

N5503, albeit displaced by 800 base pairs, thepossibility of RNA duplex formation was noteliminated. To prevent definitively the forma-tion of a gal operator-promoter duplex, we con-structed stains N5575-1 and N5575-3, whichwere deleted for one arm of the symmetricalsequence. These strains were derived fromN5572, a gal-128 lysogen of A cI857 AH1. Ther-mal induction of N5572 led to cell death owingto the expression of the prophage kil gene. Sur-

viving cells were likely to carry a continuousdeletion from the prophage-proximal end of theIS1 insertion, through an arm of the stem struc-ture, the gal promoter, and into or beyond kil.Strains N5575-1 and N5575-3 represented twosurvivors of thermal induction of N5572 whichdid not revert to gal' and were, therefore, de-leted for the gal promotor (Table 2). The pres-ence of a continuous deletion in N5575-1 wasverified by crossing the mutation into X pgal andanalyzing the DNA of the mutant by restrictionanalysis (data not shown).The kinase and epimerase values of induced

VOL. 147, 1981

TABLE 3. gal operon expression in IS1 mutant strainsa

Strain Structure Temp (00) Epimerase Kinase (U) EIK(U)

N4830 gal' (ABAMPL A) 32 3 232 + D-galactose 31 13 2.4

41 3 311N5503 gal IS1 (ABAMPL A) 32 1 1

41 30 333 0.09N5572 gal IS1 (pLA) kil+ 41 25 177 0.14N5575-1 gal IS1 (AlPLA) 41 52 346 0.15N5575-3 gal IS1 (A3PLA) 41 66 406 0.16

aLysogenic stains were induced with D-galactose or by thermal shift as indicated in Table 2, footnote a.

N5572 KTE I°v ioAB red kil c1 N immA

N55751, N5575-3Pg

~J~~J~\P Pg

Genetic map of the gal-A region showing the extent of the IS1-generated deletions.

cultures of these strains are shown in Table 2,lines 6 to 8. N5572, like the IS1 insertion strainN5503, displayed partial discoordinacy. Therewas little or no further increase in epimeraselevels when one arm of the symmetry was de-leted, as in N5575-1 or N5575-3. Since thesestrains still displayed gross discoordinacy, wemust conclude that additional factors play a rolein the efficiency of translation of the galE se-quence in the pL transcript.

(ii) Analysis of strains carrying IS2 insertionsin gal also suggested that the gal discoordinacycould only be partially accounted for by sym-metry in the gal operator-promoter region (Ta-ble 4). Strain N4927 carried galEop490, a 1,400-base pair IS2 insertion between nucleotides -1and +1 of gal (R. Musso, personal communica-tion). The 490 insertion, which lay within thegal symmetry, was expected to interfere withmRNA duplex formation. In contrast to its gal+parent, N4830, prophage induction in N4927 ledto significant accumulation of epimerase and anEIK of 0.53. After prophage induction, the EIKratio of4830was 0.07; D-galactose induction gavean EIK of 2.7. Thus, the IS2 insertion, like ISJ,gave incomplete suppression of discoordinacy.Also shown in Table 4 are two control strains,

N5678 and N5679, as well as their parent, N5705.The former carry an IS2 insertion, intc, in the Xprophage, approximately 2,000 base pairs up-stream from galE. N5705 is int+. Thermal in-duction of the three strains revealed no signifi-cant synthesis of epimerase. This demonstratedthat, whereas an IS2 insertion in the gal sym-metrical region partially alleviates discoordi-nacy, IS2 insertions located elsewhere in the PLtranscript do not.To eliminate any possibility of RNA duplex

formation in the gal operator-promoter region,

we studied two gal' revertants of N4927 (Table5). N4927-1 was a true revertant, with completeloss of the IS2 element. It showed full discoor-dinacy after prophage induction. A second re-vertant, N4927-12, was constitutively gal' andreverted frequently to gal-. Pseudorevertants ofthis type have been demonstrated to carry newpromoters within the IS2 insertion (A. Ahmed,K. Bidwell, and R. Musso, Cold Spring HarborSymp. Quant. Biol., in press). Transcripts initi-ating at the IS2 promoter will not contain thegal symmetry. gal expression in N4927-12 wasstill partially discoordinate. Thus, in every casestudied, the translation ofgalE from a transcriptinitiated upstream from the gal promoter,whether or not it contained the symmetricalregion, was always reduced.

DISCUSSION

We have extended our observation that theexpression ofa bacterial cistron can depend uponthe promoter from which it is transcribed. In theE. coli gal operon, expression of galE (epimer-ase) did not occur when the cistron was tran-scribed from the prophage lambda PL promoterlocated upstream from the gal promoter.Expression of the promoter-distal cistrons, galT(transferase) and galK (kinase), can be directedefficiently from A PL (18). After surveying theproteins synthesized after lambda induction bytwo-dimensional gel electrophoresis, we havecome to the conclusion that the absence ofepimerase activity results from failure to trans-late the galE sequences in the pL-gal transcript.Thegalpromoter region contains an extensive

dyad symmetry which flanks the normal tran-scription start site. A transcript originating atpLwould include this symmetry. An RNA stem-

884 MERRIL ET AL. J. BACTERIOL.

P L~P

E. COLI gal OPERON PROTEINS 885

TABLE 4. Effect ofgal IS2 mutations on discoordinaeyaExpt Strain Genotype structure Epimerase (U) Kinase (U) EIKA N4830 gal+ 4.4 65 0.07

N4927 gal IS2 34.6 66 0.53

B N4830 gar 6.7 184 0.04N5705 gal+ xis+ 5.5 277 0.02N5678 gal+ xis IS2 6.0 174 0.03N5679 gal+ xis IS2 5.2 158 0.03

a Induction was at 42°C for 50 min. Uninduced levels of kinase were 1 to 2 U; uninduced levels of epimerasewere 2.5 to 3.2 U. In experiment A, D-galactose induction of strain 4830 at 32°C gave 11 U of kinase and 29.8 Uof epimerase (EIK = 2.7), as shown in Table 3.

N4830

N4927.rXr Pg

'7BM N imm A

-K\Jf t,P1

N5705 K T E 7- V8 at mnt xis red o vySX N /m7m A~\ii\\,P8 IONxf\-i p

N5678, N5679 snt X)iS-s redo

Genetic map of the gal-A region showing the positions of the IS2 insertions.

TABLE 5. gal operon expression from an IS2promotora320C 32°C + D-galactose 410C

Strain EpimeraseKinase (U) Epimerase (U) Kinase (U) (U) Kinase (U) Epimerase (U)

N4927-1 2 5 9 47 57 8N4927-12 84 104 65 96 81 111

a N4927-1 is a true revertant of the IS2 strain N4927; N4927-12 is a pseudorevertant with the structureindicated below. Induction time was for 50 min.

KTE 1S2 '7 aftt A N imAN4927 _ V V&4M immAPg

N4927-1

N4927-12

FRIF S2

E \I\/X,P-1IS2

Genetic map of the true (N4927-1) and the pseudorevertant (N4927-12) of the gal IS2 strain (N4927).

loop structure with considerable stability (-86.7J/mol) could form within the pL-gal transcript,blocking the attachment of ribosomes to thetranslation initiation region galE (28) (Fig. 6).Inhibition of ribosome attachment owing toRNA secondary structure has previously beendemonstrated for phage f2 (28). To assess thecontribution of this symmetry to the failure ofgalE expression, we constructed a variety ofPL-gal fusion strains in which the formation of thestem-loop structure should have been impairedor prevented. These strains included those bear-

ing an IS1 or IS2 insertion, deletion, or newpromoter within the symmetrical region. In eachof these cases, some expression of galE wasobserved after prophage induction, although inno case was the level of epimerase as high aswhen galE was expressed from its cognate pro-moter.These data suggest that the stem-loop struc-

ture of Fig. 6 does play a role in the discoordinateexpression of gal from PL, but that other com-ponents are also involved, perhaps other sym-metries between galE and the PL transcript. In

VOL. 147, 1981

886 MERRIL ET AL.

the case of lambda cro-lac fusions, the efficiencyof lac translation is influenced, in an apparentlyunpredictable way, by the sequences upstreamfrom the lacZ translation initiation region (25).We cannot exclude alternative possibilities: (i)that ribosomes attached to sequences precedinggalE might occlude the translation initiationregion ofgalE; (ii) that the galE sequence of thePL transcript might be uniquely unstable (6).The induced prophage in these experiments

was A cI857 ABAM AH1, which carries only N,rex, and a thermosensitive (cI857) derivative ofthe repressor gene. When the polypeptides madeafter induction were analyzed by two-dimen-sional gel electrophoresis, we found that thesynthesis of only three was stimulated. Thesewere kinase, transferase, and a third polypep-tide, X, not yet identified, but which was not aproduct of the gal operon. All three were trans-lated from the PL transcript, since the introduc-tion of the nUtL3 mutation into the prophageblocked their expression; nUtL3 caused the pLtranscript to terminate within the prophage (26).

It has been reported that the synthesis of thesigma subunit ofRNA polymerase is stimulated,in trans, by the N gene product. Our resultsneither confir nor contradict this finding, sincewe have not been able to locate unequivocallysigma, a relatively minor polypeptide, on ourgels.The identification of kinase and transferase

was aided immeasurably by the analysis of astrain carrying a high-copy-number plasmid intowhich the gal operon had been cloned. Thethree products of the gal operon were readilyapparent in two-dimensional gels of labeled ex-tracts made from this strain, without D-galactoseinduction or prior purification. This approach,using cloned genomic fragments, should provegenerally useful in identifying gene products.These experiments also indicate that the dis-

coordinate expression of gal is not dependentupon the N gene function. Expression of galfrom pL in the absence of the N product occursin rho mutant strains. Under these conditions,the characteristic high levels of kinase and lowlevels of epimerase are observed.The finding that galK can be expressed when

galE is not also shows that the translation of apromoter-distal cistron does not depend uponthe translation of the promoter-proximal cistronin thepL transcript. This notion is different fromthe conclusion derived from the study of bacte-rial promoters that showed equimolar transla-tion of each cistron in an operon (21, 29).

UITERATURE CITED

1. Adhya, S., and M. Gottesman. 1978. Control of tran-scription termination. Annu. Rev. Biochem. 47:967-

996.2. Adhya, S., M. Gottesman, and B. de Crombrugghe.

1974. Release of polarity in Escherichia coli by N geneof phage A: termination and antitermination of tran-scription. Proc. Natl. Acad. Sci. U.S.A. 71:2534-2538.

3. Adhya, S., M. Gottesman, B. de Crombrugghe, andD. Court. 1976. Transcription termination regulatesgene expression, p. 719-730. In R. Losick and M. Cham-berlin (ed.), RNA polymerase. Cold Spring Harbor Lab-oratory, Cold Spring Harbor, N.Y.

4. Adhya, S. L., and J. A. Shapiro. 1969. The galactoseoperon of E. coli K-12. I. Structural and pleiotropicmutations of the operon. Genetics 62:231-247.

5. Buttin, G. 1963. Mecanismes regulateurs dans la bio-synthese des enzymes du metabolisme du galactose chezEscherichia coli K-12. I. La biosynthese induite de lagalactokinase et l'induction simultanee de la sequenceenzymatique. J. Mol. Biol. 7:164-182.

6. Cannistraro, V. J., and D. Kennell. 1979. Escherichiacoli lac operator mRNA affects translation initiation of,8-galactosidase mRNA. Nature (London) 277:407-409.

7. Das, A., D. Court, and S. Adhya. 1976. Isolation andcharacterization of E. coli defective in transcriptiontermination factor rho. Proc. Natl. Acad. Sci. U.S.A.73:1959-1963.

8. de Crombrugghe, B., M. Mudryj, R. Di Lauro, and M.Gottesman. 1979. Specificity of the bacteriophagelambda N gene product (pN): nut sequences are neces-sary and sufficient for antitermination by pN. Cell 18:1145-1151.

9. Friedman, D. I., G. S. Wilgus, and R. J. Mural. 1973.Gene N regulator function of phage Aimm2l: evidencethat a site of N action differs from a site of N recogni-tion. J. Mol. Biol. 81:505-516.

10. Fukasawa, T., K. Hirai, T. Segawa, and K. Obonai.1978. Regional replication of the bacterial chromosomeinduced by derepression of prophage lambda. IV. Es-cape synthesis of gal operon by phage 82. Mol. Gen.Genet. 167:83-93.

11. Gottesman, M., S. Adhya, and A. Das. 1980. Transcrip-tion antitermination by bacteriophage lambda N geneproduct. J. Mol. Biol. 140:57-75.

12. Gottesman, S., M. Gottesman, J. Shaw, and M. Pear-son. 1981. Protein degradation in Escherichia coli: theIon mutation and bacteriophage lambda N and cIIprotein stability. Cell 24:225-233.

13. Greenblatt, J., P. Malnoe, and J. iU. 1980. Purificationof the gene N transcription anti-termination protein ofbacteriophage A. J. Biol. Chem. 255:1465-1470.

14. Hilliker, S., M. Gottesman, and S. Adhya. 1978. Theactivity of Salmonella phage P22 gene 24 product inEscherichia coli. Virology 86:37-47.

15. Hirsch, H.-J., P. Starlinger, and P. Brachet. 1972.Two kinds of insertions in bacterial genes. Mol. Gen.Genet. 119:191-206.

16. Ishii, S., K. Kuroki, Y. Sugino, and Imamoto, F. 1980.Purification and characterization of the N gene productof bacteriophage lambda. Gene 10:291-300.

17. Kuhn, S., H.-J. Fritz, and P. Starlinger. 1979. Closevicinity of IS1 integration sites in the leader sequenceof the gal operon of E. coli. Mol. Gen. Genet. 167:235-241.

18. Merril, C., M. Gottesman, D. Court, and S. Adhya.1978. Disco-ordinate expression of the Escherichia coligal operon after prophage lambda induction. J. Mol.Biol. 118:241-245.

19. Merril, C. R., J. Leavitt, M. L Van Keuren, M. H.Ebert, and E. D. Caine. 1979. Hypoxanthine guaninephosphoribosyl transferase (HGPRT) in Gilles de laTourette syndrome. Neurology 29:131-134.

20. Merril, C. R., R. C. Switzer, and M. L. Van Keuren.1979. Trace polypeptides in cellular extracts and humanbody fluids detected by two-dimensional electrophore-sis and a highly sensitive silver stain. Proc. Natl. Acad.

J. BACTERIOL.

VOL. 147, 1981

Sci. U.S.A. 76:4335-4339.21. Morse, D. E., R. F. Baker, and C. Yanofsky. 1968.

Translation of the tryptophane messenger RNA ofEscherichia coli. Proc. Natl. Acad. Sci. U.S.A. 60:1428-1435.

22. Musso, R., B. de Crombrugghe, I. Pastan, J. Sklar,P. Yot, and S. Weissman. 1974. The 5'-terminal nu-cleotide sequence of galactose messenger RNA of Esch-erichia coli. Proc. Natl. Acad. Sci. U.S.A. 71:4940-4944.

23. Nakamura, Y., and T. Yura. 1976. Induction of sigmafactor synthesis in Escherichia coli by the N geneproduct of bacteriophage lambda. Proc. Natl. Acad. Sci.U.S.A. 73:4405-4409.

24. O'Farrell, P. H. 1975. High resolution two-dimensionalelectrophoresis of proteins. J. Biol. Chem. 250:4007-4021.

25. Roberts, T. M., R. Kacich, and M. Ptashne. 1979. Ageneral method for maximizing the expression of a

E. COLI gal OPERON PROTEINS 887

cloned gene. Proc. Natl. Acad. Sci. U.S.A. 76:760-764.26. Salstrom, J. S., and W. Szybalski. 1978. Coliphage

)nutL: a unique class of mutants defective in the site ofgene N product utilization for anti-termination of left-ward transcription. J. Mol. Biol. 124:195-221.

27. Sklar, J., S. Weissman, R. Musso, R. DiLauro, and B.de Crombrugghe. 1977. Determination of the nucleo-tide sequence of part of the regulatory region for thegalactose operon from Escherichia coli. J. Biol. Chem.252:3538-3547.

28. Steitz, J. A. 1979. RNA:RNA interactions in polypeptidechain initiations, p. 479-495, In G. Chambliss, G. Cra-ven, J. Davies, K. Davis, L. Kahan, and M. Nomura(ed.), Ribosomes: structure, function and genetics. Uni-versity Park Press, Baltimore.

29. Wilson, D. B., and D. S. Hogness. 1969. The enzymesof the galactose operon in Escherichia coli. J. Biol.Chem. 244:2143-2148.