Contents lists available at ScienceDirect

Enzyme and Microbial Technology

journal homepage: www.elsevier.com/locate/enzmictec

Thermal characteristics and cadmium binding behavior of EC-ELP fusionpolypeptides

Heelak Choi, Sung-Jin Han, Jong-In Won*Department of Chemical Engineering, Hongik University, Seoul, South Korea

A R T I C L E I N F O

Keywords:Elastin-like polypeptide (ELP)Synthetic phytochelatin (EC)Cadmium adsorptionEC–ELP

A B S T R A C T

Elastin-like polypeptides (ELPs) are stimulus–responsive protein-based biopolymers that exhibit phase transitionbehavior. By joining them to synthetic phytochelatin (EC), EC–ELP fusion proteins with temperature sensitivityand metal-binding functionality were generated to remove heavy metal ions biologically. Three different ECdomains (EC10, EC20, EC30) were incorporated into the ELP, and the EC–ELP fusion proteins were expressed in E.coli. Their thermal properties and metal binding abilities were then investigated according to the EC length. Inaddition, the feasibility of reusing EC–ELPs and the cadmium ion binding affinity of reused EC–ELPs were ex-plored.

1. Introduction

Among the causes of water pollution, contamination of heavy metalions in industrial discharged wastewater has emerged as a major en-vironmental problem [1]. Unlike other organic pollutants, heavy metalpollution is considered to be an intractable problem, because of itstoxicity, and its ability to accumulate in the body, but not to decom-pose. For example, cadmium is known to be a carcinogen, and to causeneurological diseases, such as itai-itai disease [2]. Acute mercury ex-posure can cause lung or kidney damage [3], and manganese damagesthe nervous and respiratory systems [4]. In addition, cobalt is a metalliccomponent of vitamin B12, which plays a biologically important role,but it has been reported that excessive exposure causes various sideeffects [5]. Therefore, diverse approaches for removing heavy metalions from soil and groundwater have been explored, including chemicalprecipitation, membrane separation, and polymer adsorbents [2,3,6].

Recently, several research efforts have been reported regardingmetal-binding proteins for the purpose of bioremediation or metalpollution indicators. Thiol-rich proteins such as metallothioneins (MTs)and phytochelatins (PCs) [7–9], MerA protein [10], and Ars protein[11] have been studied as metal-binding proteins for detecting (or re-moving) Cd2+, Hg2+, and As2+, respectively. Among them, PCs are afamily of heavy metal-inducible peptides, and are found in plants [12],or some microorganisms [13,14]. This protein acts as a chelator, and isknown to have a heavy metal detoxifying action that transfers heavymetal ions to vacuoles in plants. The repeating γGlu-Cys units in PCsenable the incorporation of inorganic sulfide, which results in an

increase in the Cd2+ binding efficiency of these peptides [15,16].However, producing PCs in bacteria is almost impossible, because theformation of γ-peptide bond in bacteria and the control of PC chainlength are difficult and time-consuming [17,18], although Singh andcoworkers demonstrated that PC could be produced in E. coli [19].Synthetic phytochelatins (ECs) are artificially synthesized polypeptidesbased on the structure of PC. Unlike PCs, ECs have αGlu-Cys repeatingunits. The difference of peptide bond manner enables not only theproduction of ECs with any chain length of interest in bacteria, but alsothe binding of metal ions with similar efficiency [20,21].

Elastin-like polypeptides (ELPs) are artificial biopolymers based onthe amino acid sequence of natural elastin composed of oligomericrepeats of pentapeptide (Val-Pro-Gly-Xaa-Gly, where the Xaa is anyamino, except proline). Due to their thermally responsive properties,ELPs are soluble below a certain transition temperature (Tt), and in-soluble above Tt [22]. The ability of ELPs to self-assemble in response totemperature has been exploited in polypeptide purification (inversetransition cycling (ITC)) [23]. Furthermore, due to their ease of pro-duction and selective tailoring of the metal binding domain toward anytarget metal of interest, ELP-metal binding domain fusion proteins canbe utilized as an effective absorbent for heavy metal removal or de-tection [21,24,25].

The purpose of this study was to investigate the utility of EC–ELPfusion proteins with metal-binding functionality as an alternativemethod for detecting (or removing) cadmium. First, the cadmiumbinding affinity of EC–ELP fusion protein was examined by comparingthe turbidity profiles of EC–ELP in response to three other heavy metal

https://doi.org/10.1016/j.enzmictec.2020.109628Received 14 February 2020; Received in revised form 17 June 2020; Accepted 25 June 2020

⁎ Corresponding author at: Department of Chemical Engineering, Hongik University, Sangsu-dong, Mapo-gu, Seoul 04066, South Korea.E-mail address: jiwon@hongik.ac.kr (J.-I. Won).

Enzyme and Microbial Technology 140 (2020) 109628

Available online 26 June 20200141-0229/ © 2020 Elsevier Inc. All rights reserved.

T

ions (Co2+, Hg2+, and Mn2+). Secondly, the amount of Cd2+ adsorbedto the EC–ELP fusion proteins and the resulting Tt changes were ex-plored according to the number of EC repeating units. Finally, we ob-served whether our EC–ELP fusion proteins could be reused, after re-moving the adsorbed cadmium ions.

2. Materials and methods

2.1. Materials

E. coli strains of both DH5α and BL21(DE3), and a pET32a plasmidwere purchased from Novagen (Madison, WI, USA). EcoRI, BamHI, BsaI,and NcoI restriction endonucleases were purchased from Enzynomics(Daejeon, Korea). A pUC19, T4 DNA ligase, and calf intestinal alkalinephosphatase (CIP) were purchased from New England Biolabs (Beverly,MA, USA). AarI, BpiI restriction endonucleases, and dialysis cassetteswere purchased from Thermo Fisher Scientific (Waltham, MA, USA).Plasmid DNAs were purified using Spin Miniprep and Gel extraction kitsfrom Bioneer (Daejeon, Korea). Cyanogen bromide (CNBr), CdSO4, andformic acid were purchased from Sigma–Aldrich, Inc. (St. Louis, MO,USA). DTT (dithiothreitol) was purchased from Glentham Life Sciences(Corsham, UK). MnSO4·5H2O, CoCl2·6H2O, and HgCl2 were purchasedfrom Kanto Chemical Co. (Tokyo, Japan), Junsei (Tokyo, Japan), andSamchun (Seoul, Korea), respectively.

2.2. Cloning and expression of EC–ELP genes

The EC monomer (EC10) gene was designed to encode (Glu-Cys)10-Gly, based on our previous report [21]. After polymerase chain reaction(PCR) was performed with two oligonucleotide primers, EC–F [5′TTTGAATTCGAAGACTAGAGTGCGAATGCGAATGCGAATGTGAA-TGTGAATGTGAGTGC 3′] and EC–R [5′TTTAAGCTTCACCTGCCCACACTCGCATT-CGCATTCGCATTCGCACTCACATTCACATTCACA 3′], the PCRproduct was inserted into the pUC19 cloning vector through EcoRI andHindIII treatment. In order to obtain EC20 and EC30 genes, the EC10 genewas multimerized by the “recursive directional ligation by plasmid re-construction” (PRe-RDL) method [26], using two sets of restrictionenzymes (BsaI/AarI and BsaI /BpiI). For cloning EC genes into proteinexpression vector, EC adaptor gene was generated via PCR with twoprimers, EC–AD F [5′TTTCCATGGTACGGGTCTCAGAGTGT-GAGTGTGAGTGTGAGTGTGAATGCGAATGCGAATGCGAATGC 3′] and EC–AD R[5′AAAGGATCCCACCTGCCCACGGACCCCACACTCACACTCGCATTCGCATTCGC-ATTCGCATTC 3′], and the amplified EC adapter gene wasinserted into pET32a expression vector using NcoI and BamHI. The ELPgene (V64), which was 64 tandem repeats of encoding VPGVG, wasprepared [27], and the isolated ELP gene was inserted into the pET32avector containing EC adapter gene by AarI, EcoRI treatment. Finally, theprepared EC genes, which were liberated from the pUC19 vector by BpiIand AarI, were ligated with the linearized pET32a expression vectorwith ELP gene using BsaI treatment. The ligation mixture was trans-formed into the expression strain BL21(DE3), and positive transfor-mants were isolated via 1.5 % agarose gel electrophoresis. DNA se-quencing analyses of these genes were performed to verify the correctsequence. Protein expression and purification were performed using thesame procedure described previously [28].

2.3. Thermal characterization of EC–ELPs with metal binding affinity

The thermal properties of EC–ELPs were characterized by spectro-photometry by measuring the OD350 of ELP solutions. After lyophilizedpolypeptides were dissolved in 50mM Tris-HCl buffer at pH 6.8, Cd2+,Mn2+, Co2+, or Hg2+ were subsequently added to the solution, andincubated for 2 h at room temperature. The final EC–ELPs and metal ionconcentrations were adjusted to be 10 μM and 2mM, respectively. Tomonitor the transition temperature, EC–ELP solutions were analyzed byCary Bio 100 UV–vis spectrophotometry (Agilent Technologies,

Loveland, CO, USA) with temperature scanning function. The heatingrate was 1 °Cmin−1. Data were collected at 1 °C intervals from (10–90)°C. The hydrodynamic radius of EC-ELP was measured by dynamic lightscattering (DLS; Zetasizer Nano S90; Malvern Instruments, Malvern,UK) according to the instructions provided by manufacturer. Aftersamples were equilibrated at designated temperature for 5min, thehydrodynamic radius of EC-ELP was measured at this temperature byDLS.

The metal-bound EC–ELPs were precipitated by heating above Tt,followed by a 10min centrifugation at 12,000× g. The resulting pelletswere redissolved in 50mM Tris-HCl buffer at pH 6.8. The amounts ofmetal ions in the pellets were analyzed by ICP-MS (Inductive CoupledPlasma Mass Spectrometry; NexION300, PerkinElmer, Waltham, MA,USA). These processes were repeated three times in the same manner toconfirm the reproducibility.

2.4. Regeneration of the EC–ELP

To determine the availability of recycled EC–ELP, EC–ELP was re-acted with cadmium ion for 2 h, and then precipitated by heating aboveTt, followed by a 10min centrifugation at 12,000× g. The resultingpellet was redissolved in 50mM EDTA buffer and left for overnight. Thechelate bond between cadmium ion and thiol group of EC was cleavedby EDTA. After centrifugation, the pellet was then washed with 50mMTris-HCl buffer twice. Finally, target protein was dialyzed againstdeionized water by a Slide-A-Lyzer Dialysis Cassette (7,000 MWCO) fortwo days and lyophilized to a dry powder.

3. Results and discussion

3.1. Cloning and expression of the EC–ELPs

Three different EC–ELP genes (EC10–ELP, EC20–ELP, and EC30–ELP)cloned into the pET32a vector were identified by agarose gel electro-phoresis (Fig. 1A). Each size of the EC–ELP genes was consistent withthe calculated values. These recombinant plasmids were then trans-formed into E. coli stain BL21(DE3). Because the pET32a expressionvector encoded thioredoxin (Trx) gene, the expressed products wouldbe obtained as Trx–EC–ELP fusion proteins. After the expressed fusionproteins were purified by inverse transition cycling (ITC) method [23],the size and purity of fusion proteins were observed by SDS-PAGEanalysis. SDS-PAGE analysis at 12 % indicated that the expressed targetproteins were successfully purified, and their sizes were confirmed to beconsistent with the calculated values of (44.84, 47.16, 49.48, and51.80) kDa, respectively (Fig. 1B). Trx moiety from the fusion proteinswere then chemically removed by CNBr treatment, to specifically cleavepeptide bonds at the C-terminal of methionine. The ITC purification wasperformed again to isolate the EC–ELP fusion proteins from the reactionmixture. Since disulfide bonds could be naturally formed between theEC residues of the EC–ELP proteins, disulfide bond formation wasprohibited by 25mM DTT treatment. Finally, pure protein powderswere obtained by dialysis and lyophilization.

3.2. Metal binding affinity of EC10–ELP

ECs not only have high binding affinity for Cd2+ [20], but alsobinding affinity for other heavy metal ions with divalent cations [16].To compare the metal-binding affinity of ECs, four different metal ions(Cd2+, Co2+, Hg2+, or Mn2+) were added to the EC10–ELP solution(metal ion concentration was adjusted to be 2mM), and the resultingthermal behavior was observed (Fig. 2A). Compared to the control(metal ion was not added), transition temperatures were shifted tolower values, and when metal ions were added, the graph increasedsteeply. Since Tt shifts are correlated with conformational changes inEC–ELP-metal ion complexes, bound metal ions increase the overallhydrophobicity of the complexes, and consequently the Tt shifted to

H. Choi, et al. Enzyme and Microbial Technology 140 (2020) 109628

2

lower value [21]. Note that when Cd2+ was added, Tt of the EC–ELPshifted the most. This implies that among the four metal ions, Cd2+

may bind the EC–ELP the most tightly.To analyze the metal binding affinity via spectrometry, the Cd2+

bound EC10–ELP solution was heated above Tt, followed by a 10mincentrifugation at 12,000× g. The resulting pellet was redissolved in50mM Tris-HCl buffer. Subsequently, Co2+ was added to the solution,and reacted for 2 h. The phase transition behavior of the resultingpolypeptide indicated that the curve shape exhibited a similar patternwhen Co2+ was added to the pure EC10–ELP solution by comparing thegraphs with vacant square and triangle, except that Tt was shifted to alow value of (2 or 3) °C (Fig. 2B). This means that the adsorbed Cd2+ onthe EC10–ELP was not completely replaced by the Co2+. On the other

hand, when Cd2+ was added to the Co2+ bound EC10–ELP solution, itwas revealed that almost all of the adsorbed Co2+ on the EC10–ELP wasreplaced with the Cd2+, from the results that when the filled square andtriangle were compared, the transition temperatures coincided(Fig. 2B). Using the same method, Hg2+ and Mn2+ replacements wereperformed with Cd2+ bound EC10–ELP (Fig. 2C and D, respectively).These data illustrate that EC–ELP bound Cd2+ more tightly than othercompeting metal ions, substantiating the previous results that ECmoiety affords higher Cd2+ selectivity than other metal ions [25].

Fig. 1. (A) Identification of ELP and EC–ELPgenes by agarose gel electrophoresis. Lane 1,ELP (V64) gene; lane 2, EC10–ELP gene; lane 3,EC20–ELP gene; lane 4, EC30–ELP gene. (B)Confirmations of expressed ELP and EC–ELPsby SDS-PAGE. Lane 1, Trx–ELP (V64); lane 2,Trx–EC10–ELP; lane 3, Trx–EC20–ELP; lane 4,Trx–EC30–ELP.

Fig. 2. Turbidity profiles of EC10–ELP and EC10–ELP-metal ion complexes. (A) Comparison of turbidity profiles of EC10–ELP according to the addition of four differentmetal ions. (B) Comparison of turbidity profiles of EC10–ELP according to the order of Cd2+ and Co2+ addition. (C) Comparison of turbidity profiles of EC10–ELPaccording to the order of Cd2+ and Hg2+ addition. (D) Comparison of turbidity profiles of EC10–ELP according to the order of Cd2+ and Mn2+ addition. Themeasurements were performed in triplicate, and the error bars represent standard deviations.

H. Choi, et al. Enzyme and Microbial Technology 140 (2020) 109628

3

3.3. Thermal behavior and adsorbed Cd2+ amounts of EC–ELPs accordingto the EC length

The thermal behavior of four different ELPs (simple ELP, EC10–ELP,EC20–ELP, and EC30–ELP) was investigated according to the EC length.In the case of simple ELP [V64], the transition behavior was similarregardless of the Cd2+ addition, with the absorbance increasing steeplyat 45 °C (Fig. 3A). Although some of the added cadmium ions werebound to the simple ELP in an unspecific manner (Fig. 3F), the amountof the adsorbed Cd2+ was relatively small, and consequently, the phasetransition behavior was comparable. On the other hand, the thermalbehavior of the EC–ELPs was quite different from that of the simpleELP, in that when Cd2+ was not added, the absorbance increased gra-dually, while when Cd2+ was bound to EC–ELPs, the Tt shifted to about32 °C (Fig. 3B, C, and D). Since both glutamic acid and cysteine arehydrophilic amino acids, no distinct phase transition curves of EC–ELPswere observed, due to the increment of hydrophilicity of the EC–ELPs,and the unintentional disulfide bond formation between EC domainswhen Cd2+ was not added. However, in the case of adding Cd2+, theadsorbed Cd2+ increased the overall hydrophobicity of the EC–ELP-

Cd2+ complexes, and consequently the transition temperature shiftedto lower values, which were almost the same, regardless of the EC sizein EC–ELPs (Fig. 3E). Hydrodynamic radius (Rh) determined by DLSanalysis confirmed the transition temperatures of four different ELPs(data not shown).

The amounts of Cd2+ adsorbed on the EC–ELPs according the EClength were quantitatively analyzed by ICP-MS. Significantly increasedbinding affinity was observed in EC–ELPs, compared to that of thesimple ELP. The measured amounts of the adsorbed Cd2+ were (0.63,3.24, 7.59, and 8.15) μg/mL for simple ELP, EC10–ELP, EC20–ELP, andEC30–ELP, respectively (Fig. 3F). Because most of the cadmium ionswere intensively adsorbed on the EC domain, as the EC length in-creased, the amount of Cd2+ adsorbed on the EC–ELPs increased sig-nificantly.

3.4. Regeneration of EC10–ELP and its Cd2+ binding affinity

The feasibility of reusing EC–ELPs and the Cd2+ binding affinity ofthe reused EC–ELPs were investigated. After regeneration of EC10–ELPaccording to the procedure described in the Materials and Methods, the

Fig. 3. Turbidity profiles and adsorbed Cd2+ amounts of EC–ELPs according to the EC length. (A) Turbidity profiles of simple ELP caused by Cd2+ adsorption. (B)Turbidity profiles of EC10–ELP caused by Cd2+ adsorption. (C) Turbidity profiles of EC20–ELP caused by Cd2+ adsorption. (D) Turbidity profiles of EC30–ELP causedby Cd2+ adsorption. (E) Comparison of turbidity profiles of EC–ELPs (or simple ELP) after Cd2+ adsorption. (F) Cadmium binding affinity of simple ELP and EC–ELPs.The measurements were performed in triplicate, and the error bars represent standard deviations. The error bars of Cd2+ adsorption represent relative standarddeviation.

Fig. 4. (A) Comparison of the turbidity profiles of the EC10–ELP and the regenerated EC10–ELPs. (B) Amounts of Cd2+ adsorbed on the EC10–ELP and the regeneratedEC–ELPs analyzed by ICP-MS. The measurements were performed in triplicate, and the error bars represent standard deviations.

H. Choi, et al. Enzyme and Microbial Technology 140 (2020) 109628

4

thermal behavior of the obtained protein, (which is namedEC10–ELP–Re), was observed. Fig. 4A shows that when cadmium ionwas not added, the graph pattern of the EC10–ELP–Re was not sig-nificantly different from that of the EC10–ELP (compare the filled circlewith filled triangle), except that due to the loss of the target proteinduring the regeneration process, the intensity decreased. In the case ofadding Cd2+, the graph of the EC10–ELP–Re also showed a similarpattern to that of the EC10–ELP, except that the graph intensity de-creased, and Tt shifted to slightly high (compare the vacant circle withthe vacant triangle). A similar tendency was observed when the 2ndregenerated protein (EC10–ELP–Re-2) was used, though the graph in-tensity decreased slightly more. Consequently, it was found that theregenerated EC–ELPs maintained their thermal characteristics, in-dicating their metal binding affinity.

The amount of cadmium ions adsorbed on the regenerated EC–ELPswas quantitatively analyzed using ICP-MS. Fig. 4B shows that theamounts of cadmium ion adsorbed on the EC10–ELP, EC10–ELP–Re, andEC10–ELP–Re-2 were (3.238, 1.409, and 1.384) μg/mL, respectively.Although the regenerated EC–ELPs showed a decline of Cd2+ bindingyield, if the regeneration process is improved, these EC–ELPs can beused as effective cadmium ion detection tools in water.

4. Conclusions

This study demonstrated the feasibility of EC–ELP fusion proteinswith metal-binding function for detecting (or removing) cadmium iondissolved in water. After three different EC domains (EC10, EC20, EC30)were incorporated into the ELP, their metal-binding affinity was com-pared via spectrometry. As a result, it was found that among the fourdifferent metal ions, EC10–ELP bound cadmium ion most tightly. Thethermal behavior of the EC–ELPs was also explored according to the EClength. When cadmium ion was added, the turbidity profiles were al-most the same in the EC–ELPs, while when cadmium ion was not added,they exhibited quite different pattern. In addition, the feasibility ofreusing EC–ELPs and the Cd2+ binding affinity of the reused EC–ELPswere investigated. As a result, the regenerated EC–ELPs still maintainedtheir thermal characteristics, although the regenerated EC–ELPsshowed a decline of Cd2+ binding yield. From these results, we an-ticipate that if some technical barriers are overcome, this technique canbe the basis for detecting and eliminating noxious heavy metals in theenvironment.

Author agreement

The corresponding author is responsible for ensuring that the de-scriptions are accurate and agreed by all authors.

CRediT authorship contribution statement

Heelak Choi: Investigation, Writing - original draft, Writing - re-view & editing. Sung-Jin Han: Methodology, Validation. Jong-InWon: Supervision, Funding acquisition, Conceptualization.

Acknowledgments

This work was supported by grants (2018R1D1A1B07041887) and(2016R1C1B3010402) of the National Research Foundation of Korea.

References

[1] V. Tafakori, G. Ahmadian, M.A. Amoozegar, Surface Display of Bacterial

Metallothioneins and a Chitin Binding Domain on Escherichia coli IncreaseCadmium Adsorption and Cell Immobilization, Appl. Biochem. Biotechnol. 167 (3)(2012) 462–473.

[2] I. Alkorta, J. Hernández-Allica, J.M. Becerril, I. Amezaga, I. Albizu, C. Garbisu,Recent findings on the phytoremediation of soils contaminated with en-vironmentally toxic heavy metals and metalloids such as zinc, cadmium, lead, andarsenic, Rev. Environ. Sci. Biotechnol. 3 (1) (2004) 71–90.

[3] L. Järup, Hazards of heavy metal contamination, Br. Med. Bull. 68 (1) (2003)167–182.

[4] S.L. Barry, J.N. William, Neurologic effects of manganese in humans: a review, Int.J. Occup. Environ. Health 9 (2) (2003) 153–163.

[5] L. Laura, V. Bart, V.D.S. Catherine, W. Floris, M. Leen, Cobalt toxicity in humans: areview of the potential sources and systemic health effects, Toxicology 387 (2017)43–56.

[6] C. Yang, H. Yu, H. Jiang, C. Qiao, R. Liu, An engineered microorganism can si-multaneously detoxify cadmium, chlorpyrifos, and γ-hexachlorocyclohexane, J.Basic Microbiol. 56 (7) (2016) 820–826.

[7] E.A. Peroza, R. Schmucki, P. Güntert, E. Freisinger, O. Zerbe, The βE-Domain ofWheat Ec-1 Metallothionein: A Metal-Binding Domain with a Distinctive Structure,J. Mol. Biol. 387 (1) (2009) 207–218.

[8] S. Ha, A.P. Smith, R. Howden, W.M. Dietrich, S. Bugg, M.J. O’Connell, et al.,Phytochelatin Synthase Genes from Arabidopsis and the YeastSchizosaccharomycespombe, Plant Cell 11 (6) (1999) 1153–1163.

[9] M. Malin, B. Leif, Metal-binding proteins and peptides in bioremediation andphytoremediation of heavy metals, Trends Biotechnol. 19 (2) (2001) 67–73.

[10] C.L. Rugh, J.F. Senecoff, R.B. Meagher, S.A. Merkle, Development of transgenicyellow poplar for mercury phytoremediation, Nat. Biotechnol. 16 (10) (1998)925–928.

[11] A. Achour-Rokbani, A. Cordi, P. Poupin, P. Bauda, P. Billard, Characterization of thears gene cluster from extremely arsenic-resistant Microbacterium sp. Strain A33,Appl. Environ. Microbiol. 76 (3) (2010) 948–955.

[12] W. Gekeler, E. Grill, E.-L.-L. Winnacker, M.H. Zenk, Survey of the Plant Kingdom forthe Ability to Bind Heavy Metals through Phytochelatins, Zeitschrift fürNaturforschung 44c (1989) 361–369.

[13] R.K. Mehra, E.B. Tarbet, W.R. Gray, D.R. Winge, Metal-specific synthesis of twometallothioneins and gamma-glutamyl peptides in Candida glabrata, Proc. Natl.Acad. Sci. U. S. A. 85 (23) (1988) 8815–8819.

[14] R.K. Mehra, P. Mulchandani, T.C. Hunter, Role of CdS Quantum Crystallites inCadmium Resistance inCandida glabrata, Biochem. Biophys. Res. Commun. 200 (3)(1994) 1193–1200.

[15] C.T. Dameron, D.R. Winge, Characterization of peptide-coated cadmium-sulfidecrystallites, Inorg. Chem. 29 (7) (1990) 1343–1348.

[16] H. Satofuka, T. Fukui, M. Takagi, H. Atomi, T. Imanaka, Metal-binding properties ofphytochelatin-related peptides, J. Inorg. Biochem. 86 (2) (2001) 595–602.

[17] M.E.V. Schmöger, M. Oven, E. Grill, Detoxification of Arsenic by Phytochelatins inPlants, Plant Physiol. 122 (3) (2000) 793–801.

[18] W. Bae, R.K. Mehra, Metal-binding characteristics of a phytochelatin analog (Glu-Cys)2Gly, J. Inorg. Biochem. 68 (3) (1997) 201–210.

[19] S. Singh, S.H. Kang, W. Lee, A. Mulchandani, W. Chen, Systematic engineering ofphytochelatin synthesis and arsenic transport for enhanced arsenic accumulationinE. coli, Biotechnol. Bioeng. 105 (4) (2010) 780–785.

[20] W. Bae, W. Chen, A. Mulchandani, R.K. Mehra, Enhanced bioaccumulation of heavymetals by bacterial cells displaying synthetic phytochelatins, Biotechnol. Bioeng. 70(5) (2000) 518–524.

[21] H.S. Chu, J. Ryum, J. Won, Cadmium detection by a thermally responsive elastincopolymer with metal-binding functionality, Enzyme Microb. Technol. 53 (3)(2013) 189–193.

[22] D.W. Urry, T.L. Trapane, K.U. Prasad, Phase-structure transition of the elastinpolypentapeptide-water system within the framework of composition-temperaturestudies, Biopolymers 24 (12) (1985) 2345–2356.

[23] D.E. Meyer, A. Chilkoti, Purification of recombinant proteins by fusion with ther-mally-responsive polypeptides, Nat. Biotechnol. 17 (11) (1999) 1112–1115.

[24] J. Kostal, A. Mulchandani, W. Chen, Tunable biopolymers for heavy metal removal,Macromolecules 34 (7) (2001) 2257–2261.

[25] U.L. Lao, A. Chen, M.R. Matsumoto, A. Mulchandari, W. Chen, Cadmium removalfrom contaminated soil by thermally responsive elastin (ELPEC20) biopolymers,Biotechnol. Bioeng. 98 (2) (2007) 349–355.

[26] J.R. McDaniel, J.A. MacKay, F.G. Quiroz, A. Chilkoti, Recursive directional ligationby plasmid reconstruction allows rapid and seamless cloning of oligomeric genes,Biomacromolecules 11 (4) (2010) 944–952.

[27] J. Park, J.I. Won, Thermal behaviors of elastin-like polypeptides (ELPs) according totheir physical properties and environmental conditions, Biotechnol. Bioprocess Eng.14 (5) (2009) 662–667.

[28] H. Choi, H.S. Chu, M. Chung, B. Kim, J.I. Won, Synthesis and Characterization of anELP-conjugated liposome with thermo-sensitivity for controlled release of a drug,Biotechnol. Bioprocess Eng. 21 (5) (2016) 620–626.

H. Choi, et al. Enzyme and Microbial Technology 140 (2020) 109628

5