Structural features of glycoprotein purifiedfrom Saccharina japonica and its effects on the selected probioticproperties of Lactobacillus plantarum in Caco-2 cell

Eun-Young Kim & S. M. Rafiquzzaman & Jong Min Lee &

Gyuyou Noh & Geon-a Jo & Jong-Hee Lee & In-Soo Kong

Received: 7 April 2014 /Revised and accepted: 28 July 2014# Springer Science+Business Media Dordrecht 2014

Abstract The aim of this study was to characterise the struc-tural features of glycoprotein isolated from the brown algaSaccharina japonica (SJGP) and to evaluate its effects on theprobiotic properties of Lactobacillus plantarum in Caco-2cells. The amino acid profile, protein backbone and monosac-charides were analysed by amino acid analysis, Fourier trans-form infrared spectroscopy (FT-IR) and high-performanceliquid chromatography (HPLC), respectively. The pretreat-ment of L. plantarum with SJGP increased cell adhesion,auto-aggregation and growth in Caco-2 cells, as observed byplate counting, light microscopy and scanning electron mi-croscopy. Auto-aggregation and cell surface hydrophobicityof L. plantarum was also increased following pretreatmentwith SJGP. SJGPwas shown to improve adhesiveness throughits lipase inhibitory activity. Adhesion-related genes ofL. plantarum showed upregulated expression in the presenceof SJGP confirmed by reverse transcriptase-PCR assay. Insummary, SJGP could be used as a bioactive compound toimprove the probiotic properties of L. plantarum and could berelevant to the preparation of functional foods.

Keywords Glycoprotein . Saccharina japonica . Structuralfeatures . Probiotic properties . Lactobacillus plantarum .

Caco-2 cell

Introduction

Probiotics have received increasing attention in recent yearsand have been suggested to have positive health effects. Thehealth-promoting effects of probiotics may be acquiredthrough incorporation in food components, but the safety ofthe probiotic is of greatest concern to the consumer.Lactobacillus spp. and Bifidobacterium spp. are popular dueto their long history of safe use in the fermentation industryand their being natural inhabitants of the gastrointestinal tract.These properties have seen generally regarded as safe (GRAS)status conferred on these microorganisms (Ammor et al. 2007;Hsu et al. 2005; Puertollano et al. 2008). When selectingprobiotic bacteria, several aspects, including their stability,functionality, adhesion, auto-aggregation and inhibition ofharmful bacteria, must be taken into consideration. The maincriterion for selecting probiotic strains is their ability to adhereto the intestinal epithelium, as it determines their interactionswith the host and the microorganisms present in the hostsystem (Johanson et al. 1993; Ouwehand et al. 1999). Otherphenotypic traits of lactobacilli, such as auto-aggregation(Voltan et al. 2007) and cell surface hydrophobicity (CSH)(Pelletier et al. 1997), are also correlated with adhesion. How-ever, the mechanisms by which probiotic bacteria adhere tothe human gastrointestinal tract are poorly understood. Recentreports indicated that the attachment of lactobacilli to intesti-nal cell lines is dependent on bacterial surface properties andprotein structures (Tuomola et al. 2000; Bernet et al. 1993). Ithas been found that oxidation of carbohydrate bymetaperiodates and degradation of protein by proteases de-crease adhesion ability (Greene and Klaenhammer 1994). Bycontrast, the addition of honey and inulin as prebiotics en-hanced the aggregation and adhesion properties of Lactoba-cillus acidophilus NCDC 13 and L. acidophilus NCDC 291,indicating that pretreatment can influence their properties(Saran et al. 2012). Kennedy and Sandin (1988) reported that

Eun-Young Kim and S. M. Rafiquzzaman contributed equally to thispaper.

E.<Y. Kim : S. M. Rafiquzzaman : J. M. Lee :G. Noh :G.<a. Jo :I.<S. Kong (*)Department of Biotechnology, Pukyong National University,Busan 608-737, South Koreae-mail: iskong@pknu.ac.kr

J.<H. LeeWorld Institute of Kimchi, Gwangju 503-360, South Korea

J Appl PhycolDOI 10.1007/s10811-014-0390-7

cell adhesion and hydrophobicity were significantly influ-enced by the carbohydrate present in the medium. However,this study provides the first investigation of the effects ofnatural bioactive compounds from seaweed on selected pro-biotic properties of Lactobacillus plantarum.

Seaweeds are an important source of bioactive compounds.For example, compounds isolated from marine macroalgaehave demonstrated various biological activities, such as anti-bacterial (Gonzalez del Val et al. 2001), antioxidant (Yuan andWalsh 2006; Chandini et al. 2008), anti-inflammatory (Kanget al. 2008) and anticoagulant (Guerra-Rivas et al. 2011)properties. Saccharina japonica is a brown alga commonlyfound in East Asia, particularly Japan, China and Korea,which is used mainly as food material (Jia and Chen 2001).Most previous studies have focused on evaluating the biolog-ical functions of polysaccharides and lipids from S. japonica,despite glycoproteins having more biological functions (Kimet al. 2012; Rafiquzzaman et al. 2013). In our previous study,we have isolated and purified glycoprotein from differentseaweeds, such as S. japonica (SJGP) and Undariapinnatifida (UPGP), to characterise the biofunctional activi-ties; they have considerable antioxidant, DNA-protective,NO-scavenging and xanthine-oxidase-inhibition activities(Kim et al. 2012; Rafiquzzaman et al. 2013).

We therefore investigated the structural features of SJGPand its effects on selected probiotic properties of severalL. plantarum strains in a Caco-2 cell line model system. TheCaco-2 cell line has been used to investigate the adhesionmechanisms of bacteria, because of the complexity of workingwith the in vivo system (Bernet et al. 1993). Hence, thepresent study was undertaken to characterise the chemicalcomposition of SJGP and its effects on the adhesion capacity,auto-aggregation ability and CSH of various L. plantarumstrains. Moreover, the lipase inhibitory activity of SJGP wasinvestigated. Both light and scanning electron microscopyimages were used to evaluate the adhesion capacity ofL. plantarum strains in the presence or absence of SJGP inthe in vitro Caco-2 cell line model system. In addition, theexpression patterns ofmultiple adhesion genes ofL. plantarumwere analysed by reverse transcriptase-polymerase chain re-action (RT-PCR).

Materials and methods

Bacterial strains and growth conditions Lactobacillus.plantarum KCTC 3108, KCTC 3928, KCTC 13093 andKCTC 10887BP were obtained from the Korean Collectionfor Type Cultures (KCTC) and were isolated from kimchiand pickled cabbage. All strains were grown in MRS broth(Difco, USA) at 37 °C and stored in MRS with 7 %dimethyl sulfoxide (DMSO) at −70 °C.

Isolation of SJGP Glycoprotein (MW ~10 kDa) was isolatedfrom S. japonica and identified by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) followed byCoomassie Brilliant Blue (CBB), silver and periodic acid-Schiff (PAS) staining, as reported previously (Kim et al.2012).

Analysis of chemical composition of SJGP The amino acidcontent of purified SJGP was determined using an amino acidanalyser (Membrapure Co., Germany) according to the meth-od of Rafiquzzaman et al. (2013). The amount of each aminoacid was expressed as the percentage per 100 g of amino acids.

The freeze-dried SJGP was subjected to Fourier transforminfrared (FT-IR) measurement in the frequency range 4,000–650 cm−1 using a Spectrum X instrument (Perkin Elmer,USA).

SJGP monosaccharides were determined according to themethod of Meinita et al. (2012). The monosaccharides rham-nose, mannose, galactose, xylose, glucose, fructose, lactose,ribose, raffinose and maltose were used as standards for high-performance liquid chromatography (HPLC).

Effect of SJGP on the probiotic properties of L. plantarum

Cell culture Caco-2 cells (KCLB 30037) were obtained fromthe Korean Cell Line Bank (KCLB) and grown at 37 °C in anatmosphere of 95 % air and 5 % CO2 in minimal essentialmedium (MEM, Sigma M0643) supplemented with 25 mMHEPES, 10 % heat-inactivated foetal bovine serum (FBS,Gibco 16000), 1 % non-essential amino acids and 1 %penicillin/streptomycin (Gibco, Grand Island, NY).

Enumeration of adhered cell by direct counting The adhesivecapacities of L. plantarum strains were examined in the ab-sence or presence of SJGP using the Caco-2 cell line, asdescribed previously (Bojana et al. 2003; Kotzamanidiset al. 2010) with slight modifications. Briefly, 100 μL ofL. plantarum (106 CFU mL−1) was added with or withoutSJGP at various concentrations onto a monolayer of Caco-2cells in separate wells. The plates were incubated for 4 h at37 °C in a 5 % CO2 incubator. After incubation, bacterial cellswere collected from the wells and Caco-2 cells were washedtwice with 1 mL sterile phosphate buffered saline (PBS).Adhered cells were treated with 1 mL of 0.5 % Triton X-100for 3 min on ice and then serially diluted and plated ontoMRSagar for quantification.

Microscopic observation of adhered cells The adhered cellswere observed by light microscopy and scanning electronmicroscopy (SEM) for qualitative determination. The lightmicroscopic observation of L. plantarum was carried out byfixing washed cells in 100%methanol for 30min followed by

J Appl Phycol

Gram staining. For SEM, the samples were prepared as de-scribed previously (Darilmaz et al. 2011). Briefly, the sampleswere postfixed with 1 % osmium tetroxide for 2 h in a darkroom. Then, they were washed three times with 0.1 M sodiumphosphate buffer (pH 7.2) for 20 min and serially dehydratedwith series of ethanol solutions of different concentration(50 %→70 %→80 %→90 %→95 %→98 %→100 %→100 %) for 20 min. Next, substitution of ethanol by amylacetate (3:1→1:1→0:1) was performed for 30 min and thesamples were then critical-point dried with CO2 gas andsubjected to sputter coating for 1 min. Sputter-coated cellswere examined using a scanning electron microscope(S-2400, Hitachi, Japan).

Cell surface hydrophobicity Lactobacillus plantarum KCTC3108 was selected for further study based on the resultsobtained from cell line experiments. The CSH of thisstrain with or without SJGP was assessed as describedpreviously (Kotzamanidis et al. 2010) with slight modifi-cations. Cells cultured for 18 h were washed twice withPBS and the OD at 600 nm was adjusted to 1.0 (A0). Onemillilitre of xylene and 3 mL of 0.1, 0.5 or 1.0 mg mL−1

SJGP were then added to the cell suspension to form atwo-phase system. The aqueous phase was removed care-fully and its absorbance at 600 nm (A1) was measured.Percentage CSH was calculated using the following for-mula: % CSH=[(A0−A1)/A0]×100.

Auto-aggregation assay An auto-aggregation assay was per-formed in the presence or absence SJGP as described byRahman et al. (2008), with some modifications. The bacterialculture was collected, harvested by centrifugation at 13,000×gfor 3 min, washed and resuspended in PBS, and then the ODat 600 nm was adjusted to 1.0. Accordingly, the samples weretreated with SJGP at various concentrations. Percentage auto-aggregat ion was expressed as fol lows: % auto-aggregation=[(A0−A1)/A0]×100, where A0 represents initialOD and A1 is OD after mixing with SJGP at different timeintervals.

Lipase inhibition assay The method used for measuringlipase inhibitory activity was modified from that describedpreviously by Zhang et al. (2008). Briefly, lipase (0.3 mg)was dissolved in a buffer consisting of 5 mM CaCl2 and100 mM Tris-HCl (pH 8.0). And then, 30 μL of 10 mMMOPS and 30 μL of 1 mM EDTA was added to thelipase solution. A 100 μL amount of SJGP at differentconcentrations (0.1, 0.5, 1.0 or 2.0 mg mL−1) was addedand incubated at 37 °C for 15 min and subsequentlyadded 10 mM p-nitrophenyl butyrate to that solution.The amount of p-nitrophenol released in the reaction wasmeasured at 400 nm using a UV-visible spectrophotometer(BioTek Synergy HT, USA).

RT-PCR assay for adhesion-related genes L. plantarumKCTC 3108 cells, grown in MRS broth at 37 °C for 18 h,were centrifuged and the resulting pellet was washed twicewith PBS. The washed pellet was resuspended in PBS and theOD at 600 nm was adjusted to 1.0. Cell suspensions contain-ing 0.1, 0.5 or 1.0 mg mL−1 SJGP were incubated at 37 °C for4 h. Total RNA was prepared using TRIzol reagent(Invitrogen, USA) and treated with RNase-free DNase(Takara, Japan) to remove contaminating DNA. Complemen-tary DNA (cDNA) was synthesised using a first-strand cDNAsynthesis kit for RT-PCR (Roche). The expression of cell-adhesion-related genes (mub, map, ef-Tu and fbp) and controlgenes (glyceraldehyde-3-phosphate, gdph; L. plantarumKCTC 3108-specific 16s RNA, lp) was assayed by PCR usingspecific primer sets (Table 1). PCR amplification (94 °C for5 min; 25 cycles of 94 °C for 30 s and annealing at 72 °C for30 s; and 72 °C for 7 min) was performed with ExTaq DNApolymerase (Takara) using L. plantarum KCTC 3108 cDNAas the template. PCR products were subjected to 1 % agarosegel electrophoresis. The band intensity was measured withImage J (version 1.45) software (National Institute of Health,USA).

Results

Analysis of chemical composition

Amino acid and monosaccharide composition The aminoacid profile of purified SJGP is shown in Fig. 1. Purified SJGPcontained both essential and non-essential amino acids. It wasrich in glutamic acid, arginine and aspartic acid and poor inglycine, alanine, valine, cysteine, leucine, tyrosine, histidine,ammonia and lysine.

HPLC analysis of purified SJGP was carried out to deter-mine the monosaccharide composition. Individual compo-nents were identified by comparison of their retention timeswith different commercial sugars used as standards. Peakanalysis identified five monosaccharides: galactose, raffinose,maltose, mannose and xylose.

FT-IR spectroscopy The FT-IR spectrum of purified SJGPshowed 12 major peaks between 3,280 and 704 cm−1 andrevealed the presence of various protein backbones (Fig. 2).The amide B band (3,194 cm−1) originated from Fermi reso-nance and corresponded to N-H stretching vibrations. Theamide B band corresponded to peaks at 2,935, 2,902 and2,838 cm−1, which are associated with C-H stretching vibra-tions. Three other peaks at 1,593, 1,449 and 1,403 cm−1

represented stretching vibrations of C-O and C=O, whichare generated mainly by arginine, histidine and aspartic acid,

J Appl Phycol

respectively. Rocking vibrations of CH2 resulted in peaks at929 and 704 cm−1.

Effects of SJGP on the probiotic properties of L. plantarum

The adhesion of L. plantarumwith or without SJGP to Caco-2cells was investigated quantitatively and qualitatively usingtwo independent methods: enumeration by plating on MRSagar and direct microscopic examination.

Enumeration of adherent bacteria by plate counting

L. plantarum strains were treated with SJGP at various concen-trations to investigate their capacity to adhere to Caco-2 cells. Toliberate lactobacilli from the surface, the Caco-2 cells weretreated with Triton X-100. The adhesion ability of L. plantarumvaried considerably among strains (Table 2). SJGP-treatedKCTC 3108 showed the highest number of adhesive cells(~1.8-fold more than non-treated samples), followed by KCTC

Table 1 Primers used in this study for all the primer set, it should be as per revised submission. It needs to seperate between up and rp by drawing a linebetween the two set of primer for particular gene

Primer set Sequence 5′ to 3′ Target Annealingtemperature (°C)

Size ofamplicon (bp)

Reference

mub GTAGTTACTCAGTGACGATCAATGTAATTGTAAAGGTATAATCGGAGG

Mucus binding protein 50 150 Ramiah et al. (2007)

map TGGATTCTGCTTGAGGTAAGGACTAGTAATAACGCGACCG

Mucus adhesion promotingprotein

50 156 Ramiah et al. (2007)

ef-Tu TTCTGGTCGTATCGATCGTGCCACGTAATAACGCACCAAC

Elongation factor Tu 50 161 Ramiah et al. (2007)

fbp GTCCTTTGATGGTTTATTTACCCAGAAGTATGCGGCGAGATTCGC

Fibronectin binding protein 48 1,500 Kaushik et al. (2009)

gdph ACTGAATTAGTTGCTATCTTAGACGAAAGTAGTACCGATAACATCAGA

Glyceraldehyde-3-phosphate 50 140 Ramiah et al. (2007)

lp ATTCATAGTCTAGTTGGAGGTCCTGAACTGAGAGAATTTGA

L. plantarum specific 16S rRNA 48 248 Song et al. (2000)

Fig. 1 Analysis of amino acid profile of SJGP by amino acid analyser

J Appl Phycol

3928. Overall, the adhesion capacity was 1.13- to 1.86-foldgreater in SJGP-treated compared to non-treated samples.

Microscopic observation

Observations with regard to adhesion scores obtained usingCaco-2 cells were further corroborated by light microscopicand SEM observation of adherent cells. Observation of Gram-stained cells under a light microscope showed that SJGPtreatment improved growth, with the development of smallblack spots (Fig. 3a, b), which extended the cell to a greaterextent that makes unclear cell boundaries. Oppositely, the cellboundaries were clear in case of untreated cells. SEM showedthat SJGP-treated cells were more swollen than non-treatedcells (Fig. 4a, b). Regarding auto-aggregation, it has been

found that SJGP-treated cells were more aggregated thannon-treated cells (Fig. 4c, d).

Cell surface hydrophobicity

CSH is an important determinant of the adhesion capacity ofprobiotic bacteria. Figure 5a shows that CSH increased with anincreasing concentration of SJGP. The highest relative CSHvalue, 110 %, was found at a concentration of 0.8 mg mL−1

whereas the CSH value of the samples without SJGP was 65%.

Auto-aggregation

The rate of auto-aggregation of L. plantarumKCTC 3108wastime-dependent. After 12 h, the cells treated with 0.1 mgmL−1

Fig. 2 FT-IR spectrum of SJGP

Table 2 Total number of bacterial cells of different strains of L. plantarum pretreated with or without SJGP adhering to CaCo-2 cells

L. plantarum strain Number of adhered bacteria (×106 CFU mg mL−1, folda)

SJGP (0 mg mL−1) 0.1 mg mL−1 0.5 mg mL−1 1 mg mL−1

KCTC 3108 4.5±0.5 (1.0)b 5.6±0.6 (1.24)a 7.3±0.9 (1.69)a 8.4±0.6 (1.86)a

KCTC 3928 4.5±0.5 (1.0)b 5.47±0.3 (1.21)a 7.97±0.6 (1.77)a 8.1±0.9 (1.80)a

KCTC 13093 4.5±0.5 (1.0)b 5.1±0.3 (1.13)a 6.3±0.6 (1.40)a 6.7±0.9 (1.49)a

K8 4.5±0.5 (1.0)b 5.9±0.6 (1.31)a 7.9±0.6 (1.76)a 7.3±0.6 (1.62)a

Values are means±standard deviations of three independent experimentsa Relative increment (in fold) of adhered bacteria of different strain of L. plantarum following treatment of SJGP at different concentrationsb Control value of adhered bacteria of different strain of L. plantarum

J Appl Phycol

SJGP showed 86 % auto-aggregation whereas untreated cellsshowed only 17 % auto-aggregation (Fig. 5b).

Lipase inhibitory activity

Lipase inhibition activity is indirectly related to the CSH ofbacteria. Lipase inhibitors can enhance CSH. The pancreaticlipase inhibition activity of SJGP was evaluated; SJGPinhibited lipase activity in a dose-dependent manner. Thehighest inhibition (92 %) was at 1.0 mg mL−1 SJGP, followedby 64 % at 0.5 mg mL−1 (Fig. 6).

Expression of adhesion-related genes

RT-PCR was performed to quantify the expression ofadhesion-related genes (mub, map, ef-Tu and fbp) inL. plantarum treated with various SJGP concentrations. Allgenes were upregulated in the presence of SJGP (Fig. 7).Image analysis showed that map was the most highly upreg-ulated adhesion gene, showing 3.4-fold higher expressioncompared to untreated cells; the values for mub, fbp and ef-Tu were 2.8-, 1.9- and 1.5-fold, respectively.

Discussion

Recently, there has been an increasing recognition of the roleof probiotic bacteria in the maintenance of homeostasis and inthe prevention of colonisation by pathogenic organismswithinthe dynamic ecosystem in the human body. Therefore, theidentification of new natural bioactive compounds that en-hance the probiotic properties is of prime importance.

Therefore, in this study, we characterised the chemical com-position of SJGP and evaluated its effects on selected probi-otic properties of L. plantarum in a Caco-2 cell line modelsystem.

Firstly, we characterised the structural features of SJGP byFT-IR spectroscopy, amino acid analysis and HPLC. Aminoacid analysis and the FT-IR spectrum provided informationregarding the amino acid profile, protein backbone and sec-ondary structure, which are important for structural character-isation of the glycoprotein (Barth 2007). Both analysesshowed that SJGP contains diverse amino acids and proteinbackbones. Notably, no serine or threonine, important deter-minants for glycosylation analysis, was detected by aminoacid analysis (Fig. 1) and FT-IR spectroscopy (Fig. 2) (Varkiet al. 2009). Similarly, in our previous study, we performed achemical composition analysis of a glycoprotein isolated fromU. pinnatifida and confirmed the presence of serine andthreonine residues, suggesting the presence of O-linked gly-can (Rafiquzzaman et al. 2013). The difference in their com-position was confirmed by Western blot analysis (data notshown). Considering the FT-IR and amino acid profiles, wecan predict that the protein of SJGP is linked with carbohy-drates, either N-linked or both. In addition, the analysis of themonosaccharide composition of SJGP revealed that itcontained galactose, raffinose, maltose, mannose and xylose.Generally, characterisation of glycoprotein structure is a com-plex process involving several steps. Therefore, further studiesare required to determine the structure of SJGP.

As part of a continuous effort to identify new functionalactivities from seaweed and its derivatives, we investigatedthe probiotic properties of L. plantarum pretreated with SJGPin a Caco-2 cell line model system. Using this SJGP, weinitially examined the cell adhesion, auto-aggregation andgrowth of several L. plantarum strains. It was found that celladhesion, auto-aggregation and growth were increased in thepresence of SJGP, with variation among the strains (Table 2and Figs. 3a, b and 4a–d). This is in agreement with the studyby Del Re et al. (2000), which suggested that variation inadhesion ability was due to the use of different strains ofB . l o n g n um a n d L . a c i d o p h i l u s . Mo r e o v e r ,exopolysaccharides (EPS) secreted from probiotic bacteriaare one of the major mediators of adhesion to the intestinalepithelium (Darilmaz et al. 2011). To demonstrate this, weisolated EPS from the strains and found that KCTC 3108produced the highest amount of EPS (data not shown). Thismay explain the differing adhesion abilities among the strains.The variation in adhesion ability was confirmed by micro-scopic observations. Light microscopy showed no clear zonesbetween bacterial cells and CaCo-2 cells, whereas untreatedcells exhibited a clear zone (Fig. 3a, b). Similarly, SEMimages also showed that cells pretreated with SJGP tendedto auto-aggregate, indicating that SJGP increased aggregation(Fig. 4c–d). This was most likely due to the presence of

Fig. 3 Light microscopic images (magnification ×1,000) of L. plantarumto Caco-2 cells in the presence or absence of SJGP showing a clearboundaries in untreated cell and b improved growth and extends outsidethe boundaries in case of SJGP-treated cells

J Appl Phycol

several monosaccharides and proteins in SJGP. This result isconsistent with the findings of Tomás and Nader-Macías

(2007), who reported increased auto-aggregation with an in-creasing glucose concentration in the growth medium.

Fig. 5 Cell surfacehydrophobicity (a) and cellularauto-aggregation (b) ofL. plantarum KCTC 3108pretreated with SJGP at differentconcentrations. Mean values andstandard deviations werecalculated from the data obtainedfrom triplicate assays

Fig. 4 SEM images(magnification ×15,000 and×10,000) of L. plantarum toCaco-2 cells in the presence orabsence of SJGP showing anormal cells without SJGP, bswollen cells with SJGP, c lessauto-aggregated cells withoutSJGP, and d more auto-aggregated cells with SJGP

J Appl Phycol

Strong relationships of adhesion capacity with auto-aggrega-tion, CSH and lipase inhibition activity have been reported(Perez et al. 1998; Doyle et al. 1984; Wadstrom et al. 1987).To confirm this, we carried out spectrometric studies of pheno-types related to adhesion capacity, such as auto-aggregation,CSH and lipase inhibition activity, under in vitro conditions.The cellular auto-aggregation rate increased with increasingincubation time and by the addition of SJGP (Fig. 5b). Ourresults confirmed the results of Saran et al. (2012) and Colladoet al. (2007). The measurement of CSH can be considered anindicator of the ability of bacteria to adhere to intestinal epithelialcells. We also found that CSH was increased with increasingSJGP concentration (Fig. 5a). This result was in agreement withthe findings of Kushal (2001), who reported higher CSH in thepresence of inulin. Furthermore, Doyle et al. (1984) reported thatcompounds possessing lipase inhibition activity have a markedeffect on CSH. To confirm this fact, we evaluated the lipaseinhibition activity of SJGP and found that it can potentiallyinhibit the lipase activity (Fig. 6). Thus, SJGP was shown toimprove CSH as a result of its lipase inhibitory activity. It maybe suggested that SJGP either directly improves or acts on thecell surface to improve the receptivity of cells, as probioticscompete for receptor sites. It has been reported that cell

aggregation and adhesion seem to involve the interactions ofcell surface components such as lipoteichoic acid, proteins andcarbohydrates, as well as soluble proteins (Reniero et al. 1991).

In the present study, several important probiotic properties,including adhesion, auto-aggregation, CSH and lipase inhib-itory activity, were evaluated. However, the molecular mech-anisms and genotypic characterisation of adhesive elementshave not received as much attention compared to other aspectsof probiotic research. Here, we also evaluated the expressionof the mucus adhesion genes mub, mapA and fbp and theadhesion-like factor EF-Tu in L. plantarum KCTC 3108 inthe presence or absence of SJGP. Little is known about theexpression of genes involved in adhesion, especially duringexposure of cells to natural bioactive compounds. In thisstudy, all of the genes examined were upregulated upon incu-bation of L. plantarum in the presence of SJGP (Fig. 7). Theeffects of growth medium, pH and enzymes on the expressionof adhesion genes have been reported. Ramiah et al. (2007)reported that in the presence of normal physiological concen-trations of bile and pancreatin, the expression of Mub wasaltered and MapA was over-expressed, while EF-Tu expres-sion remained stable.

In conclusion, our data suggest that SJGP could be usedsuccessfully to improve the probiotic properties ofL. plantarum. Chemical analyses of SJGP demonstrated thatit is composed of diverse chemical compounds that directly orindirectly improve the probiotic properties. Taking all param-eters into consideration, L. plantarum KCTC 3108 was moresuitable than other strains. Regarding the molecular mecha-nism, the expression of adhesion-related genes was upregu-lated by pretreatment with SJGP. Taken together, our findingsindicate that SJGP pretreatment may significantly increase theadhesion, auto-aggregation and CSH of the tested strains.Therefore, SJGP could be used as a food ingredient in com-bination with probiotic bacteria.

Acknowledgments This research was supported from a project titled as“Development for Novel Biofunctional Protein Source from MarineAlgae produced in the Coastal Area of Busan” funded by the Ministryof Land, Transport andMaritime Affairs, Korea. Gyuyou wishes to thankNovus International Inc. for financial support in the form of scholarship.

References

Ammor MS, Florez AB, Mayo B (2007) Antibiotic resistance innonenterococcal lactic acid bacteria and bifidobacteria. FoodMicrobiol 24:559–570

Barth A (2007) Infrared spectroscopy of proteins. BBA Bioenerg 1767:1073–1101

Bernet MF, Brassart D, Neeser JR, Servin AL (1993) Adhesion of humanbifidobacterial strains to cultured human intestinal epithelial cellsand inhibition of enteropathogen-cell interactions. Appl EnvironMicrobiol 59:4121–4128

Fig. 6 Lipase inhibitory activity of SJGP at different concentrations.Mean values and standard deviations were calculated from the dataobtained from triplicate assays

Fig. 7 Expression analysis of the multiple adherence genes ofL. plantarum (KCTC 3108) incubated with SJGP by reverse transcrip-tase-PCR

J Appl Phycol

Bojana BM, Mojca N, Metoda Z (2003) Adhesion of two Lactobacillusgasseri probiotic strains on Caco-2 cells. Food Technol Biotechnol41:83–88

Chandini SK, Ganesan P, Bhaskar N (2008) In vitro antioxidant activitiesof three selected brown seaweeds of India. Food Chem 107:707–713

Collado MC, Meriluoto J, Salminen S (2007) Adhesion and aggregationproperties of probiotic and pathogen strains. Eur Food Res Technol226:1065–1073

Darilmaz DO, Aslim B, Suludere Z, Akca G (2011) Influence of gastro-intestinal system conditions on adhesion of exopolysaccharide-producing Lactobacillus delbrueckii subspecies bulgaricus strainsto Caco-2 cells. Int J Braz Arch Biol Technol 54:917–926

Del Re B, Sgorbati B, Miglioli M, Palenzona D (2000) Adhesion,autoaggregation and hydrophobicity of 13 strains ofBifidobacterium longum. Lett Appl Microbiol 31:438–442

Doyle RJ, Nedjat-Haiem F, Singh JS (1984) Hydrophobic characteristicsof Bacillus spores. Curr Methodol 10:329–332

Gonzalez del Val A, Platas G, Basilio A, Cabello A, Gorrochategui J,Suay I, Vicente F, Portillo E, Jimenez del RioM, Reina GG, Pelaez F(2001) Screening of antimicrobial activities in red, green and brownmacroalgae from Gran Canaria (Canary Islands, Spain). IntMicrobiol 4:35–40

Greene JD, Klaenhammer TR (1994) Factors involved in adherence oflactobacilli to human Caco-2 cells. Appl Environ Funct Microbiol60:4487–4494

Guerra-Rivas G, Gómez-Gutiérrez CM, Alarcón-Arteaga G, Soria-Mercado IE, Ayala-Sánchez NE (2011) Screening for anticoagulantactivity in marine algae from the Northwest Mexican Pacific coast. JAppl Phycol 23:495–503

Hsu CA, Yu RC, Chou CC (2005) Production of galactosidase bybifidobacteria as influenced by various culture conditions. Int JFood Microbiol 104:197–206

Jia J, Chen J (2001) FAO Fisheries Technical Paper, No. 418: sea farmingand sea ranching in China. FAO United Nations, Rome, p 71

Johanson M-L, Molin B, Jeppsson B, Nobaek S, Ahrne S, Bengmark S(1993) Administration of different lactobacillus strains in fermentedoatmeal soup: in vivo colonization of the human intestinal mucosaand effects on the indigenous microflora. Appl Environ Microbiol59:15–20

Kang JY, Khan MNA, Park NH, Cho JY, Lee MC, Fujii H, Hong YK(2008) Antipyretic, analgesic, and anti-inflammatory activities ofthe seaweed Sargassum fulvellum and Sargassum thunbergii inmice. J Ethnopharmacol 116:187–190

Kaushik JK, Kumar A, Duary RK, Mohanthy AK, Grover S, Batish VK(2009) Functional and probiotic attributes of an indigenous isolate ofLactobacillus plantarum. Plos One 4:1–11

Kennedy MJ, Sandin RL (1988) Influences of growth conditions onCandida albicans adhesion, hydrophobicity and cell wall ultrastruc-ture. J Med Vet Mycol 26:79–92

Kim EY, Kim YR, Nam TJ, Kong IS (2012) Antioxidant and DNAprotection activities of a glycoprotein isolated from a seaweedSaccharina japonica. Int J Food Sci Technol 47:1020–1027

Kotzamanidis C, Kourelis A, Litopoulou-Tzanetaki E, Tzanetakis N,Yiangou M (2010) Evaluation of adhesion capacity, cell surfacetraits and immunomodulatory activity of presumptive probioticLactobacillus strains. Int J Food Microbiol 140:154–163

Kushal R (2001) Studies on the effects of microentraped co-culture ofL. acidophilus and B. bifidobacterium on the inhibition ofenteropathogens. Ph.D Thesis, National Dairy Research Institute(Deemed University), Karnal, India

Meinita MDN, Hong YK, Jeong GT (2012) Comparison of sulfuric andhydrochloric acids as catalysts in hydrolysis of Kappaphycusalvarezii (cottonii). Bioprocess Biosyst Eng 35:123–128

Ouwehand AC, Kirjavainen PV, Shortt C, Salminen S (1999) Probiotics:mechanisms and established effects. Int Dairy J 9:43–52

Pelletier C, Bouley C, Cayuela C, Bouttier S, Bourlioux P, Fontaine M(1997) Cell surface characteristics of Lactobacillus casei subsp.casei, Lactobacillus paracasei subsp. paracasei, and Lactobacillusrhamnosus strains. Appl Environ Microbiol 63:1725–1731

Perez PF, Minnaard Y, Disalvo EA, De Antoni GL (1998) Surfaceproperties of bifidobacterial strains of human origin. Appl EnvironMicrobiol 64:21–26

Puertollano E, Puertollano MA, Cruz-Chamorro L, Alvarez deCienfuegos G, Ruiz-Bravo A, De Pablo MA (2008) Orally admin-istered Lactobacillus plantarum reduces pro-inflammatory interleu-kin secretion in sera from Listeria monocytogenes infected mice. BrJ Nutr 99:819–825

Rafiquzzaman SM, Kim EY, Kim YR, Nam TJ, Kong IS (2013)Antioxidant activity of a glycoprotein isolated from a seaweedUndaria pinnatifida measured by an in vitro digestion model. Int JBiol Macromol 62:265–272

Rahman MM, Kim W-S, Kumura H, Shimazaki K-I (2008)Autoaggregation and surface hydrophobicity of bifidobacteria.World J Microb Biotechnol 24:1593–1598

Ramiah K, Van Reenen CA, Dicks LM (2007) Expression of the mucusadhesion genes Mub and MapA, adhesion like factor EF-TU andbacteriocin gene PlaA of Lactobacillus plantarum 423, monitoredwith real-time PCR. Int J Food Microbiol 116:405–409

Reniero R, Cocconcelli PS, Bottazzi V, Morelli L (1991) High-frequencyconjugation in Lactobacillusmediated by an aggregation-promotingfactor. J Gen Microbiol 138:763–768

Saran S, Bisht MS, Singh K, Teotia UVS (2012) Comparing adhesionattributes of two isolates of Lactobacillus acidophilus for assess-ment of prebiotics, honey and inulin. Int J Sci Res Publ 4:1–7

Song YL, Kato N, Liu CX, Matsumiya Y, Kato H, Wantanabe K (2000)Rapid identification of 11 human intestinal Lactobacillus species bymultiplex PCR assays using group and specific marker derived from16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.FEMS Microbiol Lett 187:167–173

Tomás MSJ, Nader-Macías ME (2007) Effect of a medium simulatingvaginal fluid on the growth and expression of beneficial character-istics of potentially probiotic lactobacilli. Curr Res Educ Top TrendsAppl Microbiol 2:732–739

Tuomola EM, Ouwehand AC, Salminen SJ (2000) Chemical, physicaland enzymatic pre-treatments of probiotic lactobacilli alter theiradhesion to human intestinal mucus glycoproteins. Int J FoodMicrobiol 15:75–81

Varki A, Cummings RD, Esko JD, Freeze HH, Stainly P, Bertozzi CR,Hart GW, Etzler ME, (Eds.) (2009) Essentials of glycobiology, 2ndedition, Cold Spring Harbor Laboratory Press

Voltan S, Castagliuolo I, Elli M, Long S, Brun P, D’Inca R,Porzionato A, Macchi V, Palu G, Sturniolo GC, Morelli L,Martines D (2007) Aggregating phenotype in Lactobacilluscrispatus determines intestinal colonization and TLR2 andTLR4 modulation in murine colonic mucosa. Clin VaccineImmunol 14:1138–1148

Wadstrom T, Anderson K, Sydow M, Axelsson L, Lindgren S,Gullmar B (1987) Surface properties of lactobacilli isolatedfrom the small intestine of pigs. J Appl Microbiol 62:513–520

Yuan YV,Walsh NA (2006) Antioxidant and antiproliferative activities ofextracts from a variety of edible seaweeds. Food Chem Toxicol 44:1144–1150

Zhang J, Kang MJ, KimMJ, KimME, Song JH, Lee YM, Kim JI (2008)Pancreatic lipase inhibitory activity of Taraxacum officinale in vitroand in vivo. Nutr Res Pract 2:200–203

J Appl Phycol