English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis
description
Transcript of English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis
![Page 1: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/1.jpg)
English okay? Masters studies offer tracks:This is part of:
VL Microarray data analyisTuesday, 8:30 – 10:00
Ü Thursday 10:15-11:45 (start: Oct. 23)
Next semester: Praktikum + SeminarThereafter possibility for Masters thesis. Anwesenheitspflicht in VL und Ü (Liste!) Literature:See course web page.
![Page 2: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/2.jpg)
1 21. Okt Microarray-Technologien Martin Vingron
2 28. Okt Grundlagen der Datenanalyse Christine Steinhoff
3 4. Nov Varianzanalyse I Christine Steinhoff
4 11. Nov Varianzanalyse II Christine Steinhoff
5 18. Nov LOWESS, Varianzstabilisierung Anja von Heydebreck
6 25. Nov Statistisches Testen Anja von Heydebreck
7 2. Dez Clusterverfahren Anja von Heydebreck
8 9. Dez Klassifikation, Lin. Diskriminanzanalyse Rainer Spang
9 16. Dez Anwendungen in der Krebsforschung Rainer Spang
10 6. Jan Hauptkomponentenanalyse Martin Vingron
11 13. Jan Statistische Lerntheorie Rainer Spang
12 20. Jan Sequenzannotation Rainer Spang
13 27. Jan Bayessche Netzwerke Rainer Spang
14 3. Feb Regulation Martin Vingron15 10. Feb Zusammenfassung, Wiederholung, Ausblick
![Page 3: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/3.jpg)
Functional Genomics:
Genome Sequencing:Determination of DNA sequenceDerivation of amino acid sequencesAnalysis, comparison, classification
Study of gene function gene expression studies proteomicsmetabolic networks
![Page 4: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/4.jpg)
DNAgene
transcription
messenger RNA (mRNA)
proteinsequence
structure
translation
![Page 5: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/5.jpg)
A cell and its population of genes:
![Page 6: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/6.jpg)
What is the problem?
Determine the amount of mRNA for each
gene that is present in a cell/tissue.
![Page 7: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/7.jpg)
DNA forms double strands by a process calledhybridization:
![Page 8: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/8.jpg)
Labeling
![Page 9: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/9.jpg)
Hybridization
![Page 10: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/10.jpg)
Expression Arrays
cDNA Arrays Oligonucleotide Arrays
Glas Arrays Membrane based Arrays
![Page 11: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/11.jpg)
Glass Slide Microarrays
… were first produced at Stanford University (Schena et al, 1995).
Whole cDNA:500-1500 bp
![Page 12: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/12.jpg)
Filter “Macro”arrays
… were first published by Lennon and Lehrach, 1991
Ca 21 cm
7.5x2.5cm
![Page 13: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/13.jpg)
Oligonucleotide Arrays
… were first published by Lockhardt et al, 1996
...
...PMMM
1 2 3 4 ... 17 18 19 20probe pair
probe set
probe cell
... TGTGATGGTGGGAATGGGTCAGAAGGACTCCTATGTGGGTGACGAGGCC TTACCCAGTCTTCCTGAGGATACAC TTACCCAGTCTTGCTGAGGATACACca 25bp
![Page 14: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/14.jpg)
GC AC
GC AC
GC AC
GC AC G
C ACG
C AC
Probe - Reference
GC AC G
C AC
![Page 15: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/15.jpg)
There are other technologies, too, to estimate expression levels:
• EST sequencing – „electronic northern“
• SAGE: tags of mRNAs are concatenated and sequenced
• Reliability of results depends on depth of probing (number of ESTs, number of tags)
![Page 16: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/16.jpg)
Why do we want to know?
• „tissue profiling“: which genes are expressed in a tissue
• Comparing healthy and diseased (e.g., tumor) tissue
• Studying dynamic processes: E.g., cell cycle (time series)
![Page 17: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/17.jpg)
Example: Renal clear cell carcinoma
Comparison of kidney cancer cells to normal tissue. Which genes are altered in their expression?
![Page 18: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/18.jpg)
T98-8880
N98-8880
Molecular Genome Analysis Dr. Judith Boer
![Page 19: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/19.jpg)
![Page 20: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/20.jpg)
G1 S G2 M
Spellman et al took several samples per time-point and hybridized the RNA to a glass chips with all yeast genes
Example: Cell cycle time course
![Page 21: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/21.jpg)
![Page 22: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/22.jpg)
Data processing
• Image collection
• Image analysis, intensity determination
• Within slide normalization
![Page 23: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/23.jpg)
![Page 24: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/24.jpg)
Trends in BiotechHess et al, 19(11),2001
![Page 25: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/25.jpg)
OUPUT: Scanner + Scanner-Software
...
... Trends in BiotechHess et al, 19(11),2001
![Page 26: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/26.jpg)
Different technologies
• Support: membrane or glass slide
• Spotted material: PCR product or oligo (short/long)
• Labeling: – 1-channel: radioactive, Affy
– Absolute values
– 2-channel: 2 color fluorescent labeling– Relative values
![Page 27: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/27.jpg)
Quality issues
![Page 28: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/28.jpg)
![Page 29: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/29.jpg)
-0.2 -0.1 0.0 0.1 0.2 0.3 0.4 0.5
0.0
0.2
0.4
0.6
0.8
1.0
43 a73-u02400vene.txt
log(fg.green/fg.red)
F̂
Kidney1Kidney2Kidney3Kidney4Kidney5Kidney6Onco1Onco2Onco3Onco4Onco5
subpopulations: PCR subpopulations: PCR
Remedies: improve PCR protocols; model “random effect” through plate-wise calibration
Remedies: improve PCR protocols; model “random effect” through plate-wise calibration
![Page 30: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/30.jpg)
subpopulations: pin subpopulations: pin
-0.8 -0.6 -0.4 -0.2 0.0 0.2
0.0
0.2
0.4
0.6
0.8
1.0
41 (a42-u07639vene.txt) by spotting pin
log(fg.green/fg.red)
F̂
1:11:21:31:42:12:22:32:43:13:23:33:44:14:24:34:4
Remedies: handling of pins; pin-wise calibrationRemedies: handling of pins; pin-wise calibration
![Page 31: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/31.jpg)
![Page 32: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/32.jpg)
Distribution of intensities: log-normal?
intensities log intensities
QQPlot
Histogramm
![Page 33: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/33.jpg)
![Page 34: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/34.jpg)
Chip design
• Type of chip: – Global „whole genome“ (yeast, drosophila,
mouse, man)– Domain specific, e.g. cancer, infection
• Spots:– PCR products: E.g., 3´ UTR (avoid crosshyb.)– Oligos: uniqueness, stability
![Page 35: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/35.jpg)
Databases
• Stanford• TIGR• Gene expression atlas • GEO• Arrayexpress
• MIAME standard: Minimum Information About a Microarray Experiment
![Page 36: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/36.jpg)
Software
• R + Bioconductor
• Jexpress
• Genesprings
• Rosetta Resolver
![Page 37: English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis](https://reader036.fdocuments.us/reader036/viewer/2022070412/56814b87550346895db86de5/html5/thumbnails/37.jpg)
Affymetrix technology
• Per gene, spot 20 perfectly matching oligos and 20 oligos with 1 mismatch
• Intensity: weighted average of pixel intensities in perfect and mismatch oligos
(More on this next week)