Elsevier Editorial System(tm) for Plant Science Manuscript...
Transcript of Elsevier Editorial System(tm) for Plant Science Manuscript...
Elsevier Editorial System(tm) for Plant Science
Manuscript Draft
Manuscript Number:
Title: Expression patterns of flower specific SEPALLATA-like MADS-box genes in crocus (Crocus sativus L.).
Article Type: Full Length Article
Section/Category:
Keywords: Crocus; monocots; MADS-box genes; SEPALLATA
Corresponding Author: Prof. Athanasios S Tsaftaris, Ph.D
Corresponding Author's Institution: CERTH
First Author: Athanasios S Tsaftaris
Order of Authors: Athanasios S Tsaftaris; Alexios N Polidoros; Konstantinos Pasentsis; Shiri Freilich;
Christos Ouzounis
Manuscript Region of Origin:
Abstract: MADS-box genes in plants encode transcription factors involved in numerous steps of plant
development including flowering, flower meristem formation and flower organ identity. In an effort to
understand flower formation in the monocot crop crocus (Crocus sativus L.) cultivated for saffron production,
we have cloned four MIKCc type II MADS-box genes of the SEPALLATA (SEP) subfamily (E-type) using a
modified RCA-RACE method, named famRCA-RACE. All proteins contain the typical for this subfamily SEP
I and SEP II motifs. Phylogenetic analysis indicated that the isolated genes belong to the SEP3 subclade
showing high similarity with Asparagus officinalis AOM1 and AoMADS2 SEP-like genes. Expression
analysis revealed that all genes are strongly expressed in flowers but not in leaves. Furthermore the genes
are expressed in all flower organs: outer whorl (whorl 1) tepals, inner whorl (whorl 2) tepals, stamens and
carpels. Expression of the CsatSEP-like genes in the outer tepals together with A-type (CsatAP1/FUL) and
B-type (CsatAP3 and CsatPI) genes fits nicely the modified ABCE model proposed to explain the homeotic
transformation of whorl1 sepals into tepals in Liliales and Asparagales. In contrast, expression of both B-
type (CsatAP3 and CsatPI) together with E-type (CsatSEP-like) genes in the fourth whorl of crocus carpel
without any phenotypic effects raises questions about the role of A-, B- and E-function genes in carpel
formation in this non-grass monocot.
CENTER FOR RESEARCH AND TECHNOLOGY HELLAS (CERTH)
INSTITUTE OF AGROBIOTECHNOLOGY (ΙΝΑ)
6th km. Charilaou-Thermis, 570 01 Thermi, P.O. Box 361
Thermi 1 February 2008
To: M. Delseny
Manuscript submissionTitle: Expression patterns of flower specific SEPALLATA-like MADS-box genes in crocus (Crocus sativus L.).
Dear Dr. Delseny,
We submit our article to be considered for publication in Plant Science because
we believe that it fits the aims and scope of the journal and provides novel and
original data on the structure and regulation of a class of crocus genes as well as
their role in flower development, which comprises a valuable commercial product
of this plant. This manuscript is a continuation of our work with the monocot
crocus crop aiming at not only understanding tepal formation but also to
characterize a number of mutants that could be helpful for saffron production.
Since we now have A-type, B-type, C-type and with this manuscript the E-type
MADS-box TFs of crocus, we present in this manuscript for the first time for such
a perennial monocot with corms, a domain analysis for this important TF family.
I hope that you will find our manuscript a complete and worthy contribution for
publication in PLANT SCIENCE.
We would like to suggest the following scientists who are experts in related fields as possible reviewers:
Dr. Brendan DAVIESCentre for Plant SciencesFaculty of Biological SciencesUniversity of LeedsLeeds LS2 9JTUKemail: [email protected]
Cover Letter
Dr. Chang-Hsien YANGGraduate Institute of BiotechnologyNational Chung hsing UniversityTaichung, Taiwan. 40227Tel: 886-4-22853126email: [email protected]
Gerco C. AngenentPlant Research International, Business Unit Bioscience, 6700 AA Wageningen, The Netherlands e-mail [email protected] ; fax 31-317-423110.
Akira KannoGraduate School of Life Sciences, Tohoku University, Katahira 2-1-1, Aoba-ku,Sendai 980-8577, JapanE-mail: [email protected]
Thank you again for your kind consideration and help in publishing our results.
Best RegardsProf. A. TsaftarisAUTh and INA/CERTH
Expression patterns of flower specific SEPALLATA-like MADS-box genes in crocus (Crocus sativus L.).
Athanasios S. Tsaftaris1,2,*, Alexios N. Polidoros1, Konstantinos Pasentsis1, Shiri Freilich1
, Cristos Ouzounis1
1Institute of Agrobiotechnology, Center for Research and Technology Hellas, Thermi, Greece, GR-570 01
2Department of Genetics and Plant Breeding, Aristotle University of Thessaloniki, Thessaloniki, Greece, GR-541 24
*Corresponding Authoremail: [email protected]
KEYWORDS: Crocus sativus L., monocots, MADS-box genes. SEPALLATA.
ManuscriptClick here to view linked references
Abstract
MADS-box genes in plants encode transcription factors involved in numerous
steps of plant development including flowering, flower meristem formation and
flower organ identity. In an effort to understand flower formation in the monocot crop
crocus (Crocus sativus L.) cultivated for saffron production, we have cloned four
MIKCc type II MADS-box genes of the SEPALLATA (SEP) subfamily (E-type)
using a modified RCA-RACE method, named famRCA-RACE. All proteins contain
the typical for this subfamily SEP I and SEP II motifs. Phylogenetic analysis indicated
that the isolated genes belong to the SEP3 subclade showing high similarity with
Asparagus officinalis AOM1 and AoMADS2 SEP-like genes. Expression analysis
revealed that all genes are strongly expressed in flowers but not in leaves.
Furthermore the genes are expressed in all flower organs: outer whorl (whorl 1)
tepals, inner whorl (whorl 2) tepals, stamens and carpels. Expression of the CsatSEP-
like genes in the outer tepals together with A-type (CsatAP1/FUL) and B-type
(CsatAP3 and CsatPI) genes fits nicely the modified ABCE model proposed to
explain the homeotic transformation of whorl1 sepals into tepals in Liliales and
Asparagales. In contrast, expression of both B-type (CsatAP3 and CsatPI) together
with E-type (CsatSEP-like) genes in the fourth whorl of crocus carpel without any
phenotypic effects raises questions about the role of A-, B- and E-function genes in
carpel formation in this non-grass monocot.
1. Introduction
Flowering plants represent one of the most successful and diverse groups of
organisms on the planet, with more than 250,000 extant species in the wild and
thousands more varieties generated by horticulturists through hybridization and other
breeding efforts. Most flowers contain just four distinct organ types namely from
outside to inside: sepals in whorl 1, petals in whorl 2, stamens in whorl 3, and carpels
in whorl 4. Depending on the species, this model can be adapted replacing for by
species-specific homologous organs in each whorl. But plant like orchids, roses,
asparagus, maize, crocus and many other have varied distinctive flowers. A common
departure from the typical flower for example, observed in several monocots
including crocus (Crocus sativus L.) is that there is no clear distinction between sepals
and petals, and the petaloid organs in whorls 1 and 2 are therefore referred to as tepals
[1]. Crocus is a monocot triploid species belonging to the Iridaceae family of
Asparagales, whose whorl 4 red stigmatic styles constitute saffron, a popular food
additive with delicate aroma and attractive color used also for couloring and medical
purposes. The flower of crocus is bisexual and it is sterile. The perianth consists of 6
petaloid tepals in whorls 1 and 2. Androecium consists of 3 distinct stamens in whorl
3 and the gynoecium consists of a single compound pistil with 3 stigmas in whorl 4.
Several phenotypic flower mutants have been described, such as flowers with larger
numbers of styles and stamens [2] and references therein), as well as a flower without
stamens and a double flower described in this study. Crocus blooms only once a year
during mid-November and is harvested by hand. After a wind separation of tepals the
red stigmas are separated from the yellow stamens by hand. Consequently, the
cultivation of this crop for its flowers and specifically its stigmas is very labor-
intensive leading to high costs [3]. Thus, understanding flower development in crocus
could not only help us understand tepal formation in this monocot but in addition
could reveal ways to increase yield and lower production costs.
The characteristics of the different floral organs during flower development are
determined by actions of floral organ identity genes. The first attempt to explain
flower development through a unifying model was made in the early 1990s based on
genetic experiments in Antirrhinum and Arabidopsis. The proposed model envisaged
the action of flower-specific genes with three distinct functions termed A, B and C,
hence the name of the original ABC model, where A-function genes alone could
determine sepals, A+B function genes determine petals, B+C function genes
determine stamens, and C-function genes alone determine carpels [4]. The ABC
model was broadly adopted because of its simplicity and its applicability to a wide
range of angiosperm species, both dicots and monocots, including economically
important grass species such as rice and maize [5, 6]. Parallel studies identified that
almost all genes responsible for the A, B, and C-function involved in flower
development belong in a large family of MADS-box transcription factors, which
specify flowering time, floral meristem identity and space-time regulation of flower
organ formation [7-10].
However, it was soon realized that flower development was more complex than
the ABC model predicted. Expression of ABC genes throughout a plant does not
transform leaves into floral organs. Thus the ABC functions, although necessary, are
not sufficient to superimpose floral organ identity on a leaf development program
[11]. An additional class of MADS-box genes recognized later, the E-type
SEPALLATA (SEP) genes of Arabidopsis, provide redundant control over the ABC
system. The three different SEP genes in Arabidopsis (SEP1, SEP2 and SEP3) that
were identified through their sequence similarity to AGAMOUS (AG) [12, 13] when
expressed together with the ABC genes are sufficient for specification of petals,
stamens and carpels, and their ectopic expression may turn leaves into floral organs
[14]. Expression of the SEP-like FBP2 in petunia and TM5 in tomato as well as of
many other SEP-like genes was found in petal, stamen, and carpel primordia [15-17].
Triple-null mutants sep1/2/3 produce indeterminate flower structures consisting only
of sepal-like organs and are strikingly similar to the phenotype produced by double
mutants of B and C class floral homeotic genes [18]. A recently recognized SEP4
gene of Arabidopsis is probably still expressed and enough to confer the sepal-like
structure in the triple mutants since in quadruple sepl/2/3/4 mutants leaf-like
structures replace flowers (Ditta et al. 2004). Furthermore, transgenic plants with
inhibited expression of FBP2 in petunia and TM5 in tomato by co-suppression or
antisense technology developed highly aberrant flowers with modified whorl 2, 3 and
4 organs [19, 15, 17].
SEP1/2/3 are still expressed in B and C loss-of-function mutants, and the initial
expression patterns of B and C class genes are not altered in the sep1/2/3 triple
mutant, indicating that SEP 1/2/3 do not act downstream of the B and C genes, and
that they are not required for the initial activation of the B and C class genes,
respectively [18]. Thus, SEP genes comprise a separate class of floral homeotic genes
that provide an additional function. The SEP proteins form higher-order complexes
together with class A, B, or C proteins, several of which are sufficient to transform
leaves into floral organs [14]. These findings led to the suggestion of a protein-based
combinatorial "floral quartet model" that could explain how the different floral organ
identity genes interact at the molecular level [7, 11]. This model predicts that different
floral homeotic proteins form quaternary DNA-binding transcription factor complexes
that may bind to two cis-regulatory elements termed CArG-boxes (consensus: 5'-
CC(A/T)6GG-3’). These factors which result from the expression of A, B, and C
function genes and in addition SEP genes regulate the expression of downstream
target genes responsible for the development of the identities of different floral
organs. More specifically, the revised "ABCE" model postulates that sepals are
specified by A protein activity alone, petals by A+B+E, stamens by B+C+E, and
carpels by C+E [20, 7, 11]. Thus, E activity and consequently SEP expression is
required for the formation of whorl 2, 3 and 4 organs.
Previous results from our group indicated that expression of the B-type paleo AP3-like
homologs in crocus is extended in all four whorls including whorl 4 and whorl 1 and may be
important for the homeotic transformation of whorl 1 sepals into tepals in this species [21].
We also demonstrated the presence of PI homologs, too in all four whorls of crocus flower
[22]. In the present study we have isolated and characterized four SEP-like sequences
from crocus and show that expression of SEP that should be required for whorl 1 tepal
formation under the predictions of the ABCE "quartet model" is also present in whorls 1 and
the combined action of AP3, PI, and SEP may be responsible for morphogenetic patterning
of tepals during flower development in crocus proving further support for the need of
ABCE activities for the formation of tepals. Furthermore the expression of ABE activities
in the reproductive whorls including whorl 4 of carpel together with the previously reported
expression of C-type CsatAG gene [23] raises question of their role in carpel formation in
crocus.
2. Materials and methods.
2.1. Plant material.
Crocus field growing plants were collected from Kozani, Greece. Tissues from
wild type crocus and two mutant plants, one lacking stamens and one with double
number of flower organs were collected. Sampling was during the late flowering
season in October. Tissues were separated and immediately frozen in liquid nitrogen
and stored at –80 0C until used.
2.2. RNA isolation and cDNA synthesis.
Total RNA from flowers and leaves of crocus field growing plants were
extracted using Trizol reagent (Invitrogen) following the manufacturers instructions.
First-strand cDNA synthesis was performed with 200u SuperScript II-RT (Invitrogen)
in a 20μl reaction volume containing a pool of 5 μg total RNA from flowers and
leaves (2.5μg each), 0.5μg NdT-Adaptor primer (5’-
TGACTAATGAATGTGGTAATGA(T)18-3’) 5’ phosphate (synthesized at VBC-
genomics, Austria), 0.5mM dNTPs, 1x first strand buffer (Invitrogen) and 10mM
DTT (Invitrogen) . The reactions were incubated 50min at 420C followed by 15 min at
70 0 C to inactivate the RT. After the addition of 2 units RNAseH (Invitrogen) the
reactions were incubated 20 min at 37 0 C. The reactions were purified using the
QIAquick PCR purification kit (Qiagen).
2.3. Circularization and rolling-cycle amplification of cDNA
Ten μl representing 1/3 of the purified cDNA were used in a circularization
reaction containing 100 units CircLigase (EPICENTRE), 1x reaction buffer and 50
μM ATP (all reagents from EPICENTRE). The reactions were performed for 1h at 600 C followed by inactivation of the enzyme 10 min at 80 0 C. The reactions were
purified using the QIAquick PCR purification kit (Qiagen). Rolling circle
amplification reactions were performed in 50 μl volume containing 1/6 (5μl) of the
circularized cDNA, 1mM dNTPs, 200μg/ml BSA (NEB), 1x phi29 DNA Polymerase
reaction buffer (NEB), 10u phi29 DNA Polymerase (NEB) and 1μM NSFInF primer (
5’-TTCATTAGTCAG-3’), with two PTO linkages on the 3’-end (custom synthesized
at VBC-genomics). The reactions were incubated for 1h at 300C followed by the
addition of 1μM NSFInvR (5’-TGTGGTAATGAT-3’) and further incubated for 1h at
300C. Finally heat inactivation was performed for 10min at 600C.
2.4. Direct cloning of CsatSEP genes.
A 1 μl aliquot of a 1/10 dilution of the rolling circle amplification reaction was
used for the PCR reactions. The reactions were performed in 50 μl volume containing
0.2mM dNTPs,1u DyNAzyme II DNA polymerase (Finnzymes), 0.4μM MADS-2F
degenerate primer (5’- GTKCTYTGYGAYGCYGAGGT -3’) designed from the
conserved amino acid sequence V L C D A E V and in sense orientation and either
0.4μM MADS5R degenerate primer (5’- AAYGTNACYTGNCGRTTDAT -3’)
designed from the conserved amino acid sequence I N R Q V T F and in antisense
orientation or 0.4μM MADS6R degenerate primer (5’-
CGRTTDATYTTRTTYTCDAT -3’) designed from the conserved amino acid
sequence I E N K I N R and in antisense orientation. The cycling conditions were: 3
min at 940C, 40 cycles of 45sec at 940C, 45sec at 500C, 1.5min at 720C and a final
extension step of 10min at 720C.
2.5. Cloning of MADS-box genes using famRCA-RACE.
In a second approach, 1μl of the RCA-RACE library from crocus prepared with
the InVUP primer as described [24], was used as template for inverse PCR using now
degenerate MADS-box primers under the same conditions as above. Primer
combination MADS-2F/MADSPromR degenerate primer (5’-
CTTVSAGWAGGTSACYTG-3’) corresponding to the conserved amino acid
sequence Q V T F S K of the MADS-box genes and designed in antisense orientation
was used under the same conditions as above. Several PCR products ranging from
900bp to 1300bp were excised from an agarose gel, ligated into pCR 2.1-TOPO
vector using the PCR II-TOPO TA cloning kit (Invitrogen) and transformed in DH5a
competent cells. Several individual clones were screened for the presence of an insert
and sequenced.
Based on the sequence information obtained from SEP-like sequences isolated,
gene specific primers were designed and used for PCR to complete small missing
parts (39-57 nucleotides between the two outward oriented primers) and obtain the
full length coding sequence of the CsatSEP3-like genes. Having as template 1/30 of
the single stranded cDNA used in the RCA-RACE experiment the reactions contained
also 0.2mM dNTPs and 1u DyNAzyme II DNA polymerase (Finnzymes) and 0.4μM
of the corresponding primers. The cycling conditions were: 2 min at 940C, 35 cycles
of 45s at 940C, 30s at 540C, 1.5min at 720C and a final extension step of 10min at
720C. The primers used were: Sep3-F (5’-AATAAATTGGGCTCTCAGAA-3’) and
Sep3-2R (5’-ATCGAAGGGCTGATAATTAACC-3’) for amplifying CsatSEP3a,
Contig3F (5’-TTCTAGAGAGAGAAATTAGGTAGT-3’) and Contig3R (5’-
ATGTTCTTTTGATCGATTTGGGAC-3’), for amplifying CsatSEP3b and
Contig5/6F (5’-GAAGGAGAGAAATCGTTGGTAATT-3’) and Contig5/6R (5’-
GCAAGTAACCAAGAGCAAATCACT-3’) for amplifying CsatSEP3c and d. A
single PCR product from each primer pair was cloned as above. Several individual
clones were screened for the presence of an insert and sequenced (Macrogen, Korea).
2.6. Phylogenetic analysis.
The deduced amino acid sequences of the isolated CsatSEP alleles were used in
BLAST searches in the GenBank and the best hits were for the SEP-like protein from another
monocot Asparagales species, the Asparagus officinalis AOM1 (AAQ83834; [25] with
86% identity over the entire sequence. CsatSEP phylogeny was reconstructed using
sequences from Oryza sativa (AAG35652, AAB64250, AAF21900, AF058697,
AAF04972 and AAB71434), Zea mays (AAB00078, AF112150 and AJ430695),
Arabidopsis thaliana (P29382, P29384, P29386, O22456 and Z16421), Asparagus
officinalis (AAQ83835 and AAQ83836), Vitis vinifera (AAM21343),
Chrysanthemum x morifolium (AAO22987), Lolium perenne (AAO45876),
Ranunculus bulbosus (AAP83408), Triticum aestivum (AAQ11687 and BAA33458),
Aristida longiseta (AAT07925), Avena sativa (AAT07926), Magnolia
praecocissima (BAB70739), Agapanthus praecox (BAC66964), Oncidium Gower
Ramsey [26], Antirrhinum majus (CAA64742), Gnetum gnemon (CAB44457), Pisum
sativum (AJ279089), Eucalyptus globulus (AF305076) and the three previously
isolated crocus AP1/FUL-like sequences CsatAP1/FULa (AY337928),
CsatAP1/FULb (AY337929), and CsatAP1/FULc (AY337930) [3, 27].
Alignment was performed by the ClustalW method [28]. Phylogenetic relationships
of the sequences were examined using the Neighbor-Joining Method with p-distance
correction [29]. Bootstrap values were derived from 1000 replicate runs. A phylogenetic tree
was constructed using the MEGA 2.1 software [30].
2.7 Domain distribution across MADS-box proteins from crocus
All known MADS-box proteins from Crocus sativus were retrieved from
genebank. The domain compositions of the proteins were determined according to the
PRODOM database [31]. The full sequence of each protein was subject to a BLAST
search [32] against the PRODOM database with default BlastP parameters. Only
domains with an E-value smaller than 1 X 10-4 or more than 60% conserved residues
were considered to be recognized, as described in [33]. Since in PRODOM domains
are conserved segments of sequence and they do not necessarily represent structural
domains, a sequence can be represented by more than a single PRODOM domain. In
case of overlapping domains, only the domain with the highest score was presented.
2.8. Expression analysis.
The expression analysis of the isolated CsatSEP3-like genes was performed
with RT-PCR. Total RNA from leaves, flowers, sepals, petals, stamens, carpels,
carpels of a mutant flower lacking stamens and a double flower were extracted using
the RNeasy plant mini kit (Qiagen).On-column digestion of DNA during RNA
purification was performed using the RNase-Free DNase Set (Qiagen). One μg of
total RNA from each sample were used in a reverse transcription reactions containing
200u SuperScript II-RT, 0.5 μg NdT-Adaptor primer, 0.5mM dNTPs, 1x first strand
buffer and 10mM DTT in a 20μl reaction volume. The reactions were incubated
50min at 420C followed by 15 min at 70 0 C to inactivate the RT. PCR was performed
having as template 1/20 of the samples cDNAs supplemented with 0.2mM dNTPs ,1u
DyNAzyme II DNA polymerase and 0.4μM of the corresponding primers. A control
PCR having as template 50ng genomic DNA from crocus was included for each
primer pair. Successful cDNA synthesis was monitored by amplifying a fragment of
the actin-beta gene as described [21]. The primers used were: Sep3-F/Sep3-2R for
CsatSEP3a (annealing at 500C), CsSEP3B-F (5’-
CTTGAAAGACAACTTGATTCGTCG-3’)/Contig3R for CsatSEP3b (annealing at
560C), CsSEP3C-F (5’-GAGCCTCCGCAAAAAGCTGGAAG-3’)/ CsSE3C/D-R (5’-
GCAAGTAACCAAGAGCAAATCAC-3’) for CsatSEP3c (annealing at 580C) and
CsCEP3D-F (5’-GAGCCTCCGCAAAAAGTCTCCTT-3’)/CsSE3C/D-R for
CsatSEP3d (annealing at 580C). The cycling conditions were: 2 min at 940C, 35
cycles of 30s at 940C, 45s at annealing temperature, 45s at 720C and a final extension
step of 10min at 720C. The PCR products were separated on 2% agarose gels where
amplification products of the expected size could be observed.
3. Results.
3.1. Isolation of CsatSEP3-like genes.
Thirty individual clones obtained from cloning of MADS-box genes using
degenerate MADS primers in the famRCA-RACE as well as SEP-like genes
specifically, with inserts ranging from 900bp to about 1300bp were sequenced. In a
first analysis 4 sequences were discarded because represented PCR and circularization
artefacts. BLAST similarity searches revealed that 26 remaining clones showed
homology to MADS-box genes from different plant species. These sequences were
grouped to seven distinct contigs using DNA STAR software. BLAST similarity
searches revealed 4 of the 7 contigs showed homology to other Sep-like MADS-box
genes from different plant species while differences were found among them. Two of
them were very similar differing only in a 15bp insertion/deletion.
To verify the above four sequences and complete small missing parts between
inverse primers (see Materials and Methods), gene specific primer designed were used
in RT-PCR as described in the materials and methods section. All three primer pairs
used produced a clear single RT-PCR product. Five to six individual clones for each
one of the 4 contigs were sequenced and analyzed. The sequences obtained together
with the sequences of the original generated RCA-RACE clones were reassembled to
four different sequences witch were termed CsatSEP3a, CsatSEP3b, CsatSEP3c and
CsatSEP3d (GenBank accession nos. EU424137, EU424138, EU424139, EU424140,
respectively). Part of the 3’ end of CsatSEP3c was identified in the recently published
partial collection of crocus stigma-specific 6.803 ESTs [34] under the cluster id.
cr.saCl001179. The rest crocus SEP-like sequences isolated in this study were not
represented in that partial collection.
3.2. Sequence alignment and C-terminal motifs
The alignment of CsatSEP3 deduced amino acid C-terminal sequences with
other SEP-like proteins using Clustalw is shown in Figure 1. The C-terminal motifs
are typical for members of the SEP lineage [35-37]. The crocus sequence has a motif
(YMPGWLQ) characteristic of SEP3-like MADS-box proteins that form a separate
branch in the SEP lineage. Similar motifs as shown in Fig.1 are present in Arabidopsis
thaliana SEP3, Antirrhinum majus DEFH72, and Lilium longiflorum LMADS3 and
LMADS4.
3.3. Phylogeny
SEP genes form a well-supported clade within the MADS box gene phylogeny that can
be further subdivided into three clades: a mixed eudicot and monocot clade containing the
Arabidopsis thaliana SEP3 gene, a eudicot clade containing the Arabidopsis SEP1,
SEP2, and AGL genes, and a clade comprised solely of monocot sequences that is not
homologous to either the SEP3 or the SEP1/SEP2/AGL3 clade [36]. The phylogenetic
relationships of the CsatSEP3-like protein with members of the SEP lineage, together
with the AGL6 and AP1/FUL lineages are shown in Fig. 3. The tree was generated by
the Neighbor-Joining method using the p-distance correction. The crocus gene fall
into a branch together with the Asparagus officinalis (Asparagales) AOM1 SEP-like
sequence. This branch belongs in an SEP3 clade that also includes other SEP3-like
monocot as well as eudicot sequences.
3.4. Patterns of domain composition are conserved between Crocus sativus and
Arabidopsis thaliana
The current sequencing of SEP-like genes extends the variety of MIKCc-type MADS-
proteins from crocus and enables to perform a relatively comprehensive analysis of
the domain composition in this family of transcription factors in crocus. In a previous
study the domain composition of MADS-box subfamilies from Arbidopsis was
determined by identifying the PRODOM-domain content of the corresponding
proteins [33]. The MADS-box domain (PRODOM domain PD000256) and the K-box
domain (PRODOM domain PD000423) were shown to be highly conserved across all
subfamilies, whereas the domain compositions along the C-terminal part are
conserved within but not across subfamilies. Here, we repeated the analysis in crocus,
while using all of the available sequences of MADS-box proteins (Figure 3). All of
the crocus MADS-box proteins are of the MIKCC-type, i.e., in addition to the MADS-
box domain these proteins possess I, K, and C domains [38]. In accordance with the
results from Arabidopsis, we observe that the MADS-box domain and the K-box
domain are found in all subfamilies, whereas the domain compositions along the
C-terminal part are conserved within but not across subfamilies. Similar to
Arabidopsis, the only two subfamilies which share a common third domain are the
SEP-like and AGL6 subfamilies, most likely reflecting the comparatively high
relatedness of theses subfamilies [33].
It is interesting to note that in 4 out of the 6 subfamilies studied (AG, AP3, AGL6,
and SEP-like) the overall domain pattern, including the C-terminus of the proteins, is
conserved between crocus (a monocot) and Arabidopsis (a eudicot). This is surprising
since the C-terminus of the MIKCC-type MADS-proteins was suggested to be
significantly less conserved than the MADS-box and K-box domains [33, 39].
Moreover, the commonly distributed PRODOM domain PD000423 corresponds only
to the first 2 of the 3 predicted α-helices of the K domain [40], helices that were
shown to be more significance to the formation of dimmers than the third helix [41].
The high conservation of the domain composition within subfamilies and across
relatively distant species (Arabidopsis and crocus), found here, indicates that the c-
terminus part of MIKC-type proteins is more conserved than previously suggested.
Considering the high level of conservation of the interaction partners found within the
different subfamilies [33], our results suggest that the nature of the domain
composition in the C-terminus has a role in specifying the nature of interactions.
3.5. Expression analysis of Csat SEP-like in wild type and mutant flowers.
The expression pattern of the isolated CsatSEP-like genes was compared in
different tissues by RT-PCR. Experiments revealed the presence of the transcripts
mainly in flowers and not in leaves (although a weak amplification product was
observed in leaves for CsatSEP3b and CsatSEP3c). The expression pattern of the
CsatSEP3-like genes was also examined in different flower tissues. As shown in
Figure 4 the RT-PCR experiment performed with cDNA synthesized from sepals,
petals, stamens and carpels resulted in the identification of all four transcripts in all
mature flower parts. No differences in expression were observed in the mutant flowers
examined (Figure 5).
4. Discussion
SEP-like genes play an important role in flower development encoding one
member of the transcriptional regulatory complex controlling organ formation in the
three inner whorls of mature flower in most plants. The class E Arabidopsis SEP
genes encode related proteins that are redundantly required to specify petals, stamens
and carpels, as sep1sep2sep3 triple mutant flowers contain only sepals. SEP4 is
required redundantly with the other three SEP genes to confer sepal identity and
contributes to the development of the other three organ types. SEP MADS box gene
phylogeny revealed major duplication events during angiosperm evolution [37, 42]. Thus, SEP
phylogeny is subdivided into a mixed eudicot-monocot clade containing the Arabidopsis
SEP3 gene where all four isolated crocus genes reported here also belong (Figure 2), a
eudicot clade containing the Arabidopsis SEP1, SEP2, and SEP4 genes, and a clade
comprised solely of monocot sequences [36]. Despite our extensive search only SEP3 type
genes were isolated from the monocot crocus flower. All lineages have a conserved C-terminus
common internal motif, but have diverse motifs at the 3’end. The alignment of CsatSEP3
deduced amino acid C-terminal sequences with other SEP-like proteins revealed a
C-terminal motif (YMPGWLQ) typical for members of the SEP3 lineage [35] present
in CsatSEP3A and CsatSEP3B, while a similar but modified (YTPGWFP) motif was
present in CsatSEP3C and CsatSEP3D sequences (Figure 1). Similar motifs are
present in Arabidopsis SEP3, antirrhinum EFH72, and Lilium longiflorum LMADS3
and LMADS4. Our analysis indicates that the domain composition in the SEP-like
protein subfamily, as in three other subfamilies, remains conserved between
Arabidopsis and crocus (Figure 3). In Arabidopsis, the conservation of intra-
subfamily domain composition is correlated with the conservation of the functional
role of the family member – i.e., the conservation of their interactions partner [33].
Unlike the functional-structural conservation, the expression pattern of SEP-like
proteins differs between monocots and eudicots. Within monocots, SEP-like genes
have been most intensively studied in grasses, including the important cereals maize
and rice. SEP-like genes in grasses show relatively heterogeneous expression patterns,
strongly suggesting that they are also functionally not a homogeneous class of genes
[43]. In maize, there are at least eight different SEP-like genes with distinguishable
expression patterns that have been suggested to be involved in determining the
alternative identity of spikelet primordial, the upper vs. the lower floret within each
spikelet primordium, or conferring determinacy to the spikelet or upper floret
meristem [7, 38, 44]. Similar observations have been reported for rice plants in which
OSMADS1, the putative ortholog of the maize ZMM8, plays an important role in floral
meristem determination during the early development of rice florets [45]. Two AGL2-
like MADS-box genes, later renamed LMADS3 and LMADS4 from lily (Lilium longiflorum),
were expressed in the inflorescence meristem, and in floral buds of different developmental
stages. LMADS4 mRNA is also expressed in vegetative leaf and in the inflorescence stem
where LMADS3 expression is absent [46]. Expression of the isolated SEP-like genes of
crocus was detected in all four whorls of flower organs. This pattern of extended
expression of E-type genes together with B-type genes reported previously [22, 21] is
compatible with tepal formation in whorl 1 of crocus. Muscari armeniacum is another
member of Asparagales that has petaloid organs in the outer two whorls and expression
of class B genes extended to whorl 1, similarly to crocus [47]. This extended expression
of class B and class E genes to whorl 1 fits the modified ABCE model proposed to
explain tepal formation in tulip and other nongrass monocots [48-50]. However,
expression of B-type and E-type genes in whorl 4 observed in crocus and other nongrass
monocts is a result difficult to explain [50]. One possibility is that although gene
expression is observed in whorl 4, active protein is not synthesized. This may occur
when expression levels are not adequate for accumulation of translated products or post-
transcriptional mechanisms are involved to restrict ectopic protein synthesis. In the lily
Lilium longiflorum, for example, a class B gene (LMADS1) is strongly expressed in the
second and third and weakly expressed in the first and fourth whorls but the protein is
synthesized only in whorls 2 and 3, suggesting that the expression of LMADS1 is regulated
post-transcriptionaly [51]. It would be very informative to examine protein accumulation of
crocus B- and E-type genes in whorl 4 in order to verify their presence at this site.
In summary, four crocus SEP-like genes have been isolated and their phylogenetic
relationships and expression patterns have been characterized. All four isolated genes
belong to the SEP3 mixed eudicot-monocot subclade of MADS-box proteins and although
presence of other crocus SEP-like genes cannot be ruled out, these were the only genes
isolated after extensive search with different methods. The four genes were expressed in all
flower organs and in the mutant flowers indicating that the CsatSEP genes were not involved
in conferring the mutant phenotypes. These data suggest that the inferred role of the isolated
genes is compatible with that of class E MADS-box transcription factors.
Figure legends
Figure 1. Alignment of the four CsatSEP deduced amino acid sequences C-
terminus regions with selected representatives of SEP-like proteins and the outgroup
lineage AGL6-like proteins using ClustalW (Thompson et al., 1994). Three highly
conserved C-terminal motifs, SEP-motif I, SEP/AGL6-motif, and SEP-motif II
designated according to Kanno et al. (2006) are boxed and residues that are highly
conserved in these regions are shaded.
Figure 2. Phylogenetic relationships of the four CsatSEP proteins with
members of SEP-like MADS-box proteins in other plants. Condensed branches of the
AP1/FUL and AGL6 clades are shown. The tree was generated by the Neighbor-
Joining method using the p-distance correction. Numbers next to the nodes are
bootstrap values from 1000 replications. Scale indicated amino acid substitutions.
Figure 3. Domain conservation and divergence across the MADS proteins and
subfamilies. Full boxes highlight similarities. The phylogeneetic tree was constructed
according to CLUSTALW multiple alignment. The figure is adaptation to crocus of a
figure from (Veron et al, 2007) describing the domain conservation in Arabidopsis.
Figure 4. PCR amplification products on cDNA from Leaves (L) and Flowers
(F), Sepals (S), Petals (P), Stamens (ST) and Carpels (CA) using the CsSEP3a-,b-,c-
,d-and β-actin-gene specific primers. MW indicates the λHindIII/ΦX174HaeIII
molecular weight marker.
Figure 5 Gene expression analysis with RT-PCR in carpels of wild-type (WT)
flower, a mutant (M) crocus flower with no stamens and a double flower (DF) using
CsatSEP3a-, b-, c-, d- gene specific primers.
References
1. J. L. Bowman, Evolutionary conservation of angiosperm flower development at the molecular and genetic levels, J. Biosci. 22 (1997) 515-527.
2. M. Grilli Caiola, P. Caputo and R. Zanier, RAPD analysis in Crocus sativus L. accessions and related crocus species., Biol. Plantarum 48 (2004) 375 - 380.
3. A. S. Tsaftaris, K. Pasentsis, I. Iliopoulos and A. N. Polidoros, Isolation of three homologous AP1-like MADS-box genes in crocus (Crocus sativus L.) and characterization of their expression., Plant Sci. 166 (2004) 1235-1243.
4. E. S. Coen and E. M. Meyerowitz, The war of the whorls: genetic interactions controlling flower development, Nature 353 (1991) 31-37.
5. B. A. Ambrose, D. R. Lerner, P. Ciceri, C. M. Padilla, M. F. Yanofsky and R. J. Schmidt, Molecular and genetic analyses of the silky1 gene reveal conservation in floral organ specification between eudicots and monocots, Mol. Cell 5 (2000) 569-579.
6. P. Bommert, N. Satoh-Nagasawa, D. Jackson and H. Y. Hirano, Genetics and evolution of inflorescence and flower development in grasses, Plant Cell Physiol. 46 (2005) 69-78.
7. G. Theissen, Development of floral organ identity: stories from the MADS house, Curr. Opin. Plant Biol. 4 (2001) 75-85.
8. R. G. Immink and G. C. Angenent, Transcription factors do it together: the hows and whys of studying protein-protein interactions, Trends Plant Sci. 7 (2002) 531-534.
9. T. Jack, Relearning our ABCs: new twists on an old model, Trends Plant Sci. 6 (2001) 310-316.
10. T. Jack, Molecular and genetic mechanisms of floral control, Plant Cell 16 Suppl (2004) S1-17.
11. G. Theissen and H. Saedler, Plant biology. Floral quartets, Nature 409 (2001) 469-471.
12. H. Ma, M. F. Yanofsky and E. M. Meyerowitz, AGL1-AGL6, an Arabidopsis gene family with similarity to floral homeotic and transcription factor genes, Genes Dev. 5 (1991) 484-495.
13. M. A. Mandel and M. F. Yanofsky, The Arabidopsis AGL9 MADS box gene is expressed in young flower primordia, Sex. Plant Reprod. 11 (1998) 22-28.
14. T. Honma and K. Goto, Complexes of MADS-box proteins are sufficient to convert leaves into floral organs, Nature 409 (2001) 525-529.
15. G. C. Angenent, J. Franken, M. Busscher, D. Weiss and A. J. van Tunen, Co-suppression of the petunia homeotic gene fbp2 affects the identity of the generative meristem, Plant J. 5 (1994) 33-44.
16. L. Pnueli, M. Abu-Abeid, D. Zamir, W. Nacken, Z. Schwarz-Sommer and E. Lifschitz, The MADS box gene family in tomato: temporal expression during floral development, conserved secondary structures and homology with homeotic genes from Antirrhinum and Arabidopsis, Plant J. 1 (1991) 255-266.
17. L. Pnueli, D. Hareven, L. Broday, C. Hurwitz and E. Lifschitz, The TM5MADS Box Gene Mediates Organ Differentiation in the Three Inner Whorls of Tomato Flowers, Plant Cell 6 (1994) 175-186.
18. S. Pelaz, G. S. Ditta, E. Baumann, E. Wisman and M. F. Yanofsky, B and C floral organ identity functions require SEPALLATA MADS-box genes, Nature 405 (2000) 200-203.
19. C. Ampomah-Dwamena, B. A. Morris, P. Sutherland, B. Veit and J. L. Yao, Down-regulation of TM29, a tomato SEPALLATA homolog, causes parthenocarpic fruit development and floral reversion, Plant Physiol. 130 (2002) 605-617.
20. K. Goto, J. Kyozuka and J. L. Bowman, Turning floral organs into leaves, leaves into floral organs, Curr. Opin. Genet. Dev. 11 (2001) 449-456.
21. A. S. Tsaftaris, A. N. Polidoros, K. Pasentsis and A. Kalivas, Tepal formation and expression pattern of B-class paleoAP3-like MADS-box genes in crocus (Crocus sativus L.), Plant Sci. 170 (2006) 238-246.
22. A. Kalivas, K. Pasentsis, A. N. Polidoros and A. S. Tsaftaris, Heterotopic expression of B-class floral homeotic genes PISTILLATA/GLOBOSA supports a modified model for crocus (Crocus sativus L.) flower formation., DNA Seq. 18 (2007) 120-130.
23. A. S. Tsaftaris, K. Pasentsis and A. N. Polidoros, Isolation of a differentially spliced C-type flower specific AG-like MADS-box gene from Crocus (Crocus sativus) and characterization of its expression, Biol. Plant. 49 (2005) 499-504.
24. A. N. Polidoros, K. Pasentsis and A. S. Tsaftaris, Rolling circle amplification-RACE: a method for simultaneous isolation of 5' and 3' cDNA ends from amplified cDNA templates, Biotechniques 41 (2006) 35-40.
25. E. Caporali, A. Spada, A. Losa and G. Marziani, The MADS box gene AOM1 is expressed in reproductive meristems and flowers of the dioecious species Asparagus officinalis, Sex. Plant Reprod. 13 (2000) 151-156.
26. H. F. Hsu, C. H. Huang, L. T. Chou and C. H. Yang, Ectopic expression of an orchid (Oncidium Gower Ramsey) AGL6-like gene promotes flowering by activating flowering time genes in Arabidopsis thaliana, Plant Cell Physiol. 44 (2003) 783-794.
27. A. S. Tsaftaris, A. N. Polidoros, K. Pasentsis and A. Kalivas, Cloning, structural characterization, and phylogenetic analysis of flower MADS-Box genes from crocus (Crocus sativus L.), TSWJournal 7 (2007) 1047-1062.
28. J. D. Thompson, D. G. Higgins and T. J. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice, Nucleic Acids Res. 22 (1994) 4673-4680.
29. N. Saitou and M. Nei, The neighbor-joining method: a new method for reconstructing phylogenetic trees, Mol. Biol. Evol. 4 (1987) 406-425.
30. S. Kumar, K. Tamura, I. B. Jakobsen and M. Nei, MEGA2: molecular evolutionary genetics analysis software, Bioinformatics 17 (2001) 1244-1245.
31. F. Servant, C. Bru, S. Carrere, E. Courcelle, J. Gouzy, D. Peyruc and D. Kahn, ProDom: automated clustering of homologous domains, Brief. Bioinform. 3 (2002) 246-251.
32. S. F. Altschul, T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller and D. J. Lipman, Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25 (1997) 3389-3402.
33. A. S. Veron, K. Kaufmann and E. Bornberg-Bauer, Evidence of interaction network evolution by whole-genome duplications: a case study in MADS-box proteins, Mol. Biol. Evol. 24 (2007) 670-678.
34. N. D'Agostino, D. Pizzichini, M. L. Chiusano and G. Giuliano, An EST database from saffron stigmas, BMC Plant Biol. 7 (2007) 53.
35. M. Vandenbussche, G. Theissen, Y. Van de Peer and T. Gerats, Structural diversification and neo-functionalization during floral MADS-box gene evolution by C-terminal frameshift mutations, Nucleic Acids Res. 31 (2003) 4401-4409.
36. S. T. Malcomber and E. A. Kellogg, SEPALLATA gene diversification: brave new whorls, Trends Plant Sci. 10 (2005) 427-435.
37. L. M. Zahn, H. Kong, J. H. Leebens-Mack, S. Kim, P. S. Soltis, L. L. Landherr, D. E. Soltis, C. W. Depamphilis and H. Ma, The evolution of the SEPALLATA subfamily of MADS-box genes: a preangiosperm origin with multiple duplications throughout angiosperm history, Genetics 169 (2005) 2209-2223.
38. G. Theissen, A. Becker, A. Di Rosa, A. Kanno, J. T. Kim, T. Munster, K. U. Winter and H. Saedler, A short history of MADS-box genes in plants, Plant Mol. Biol. 42 (2000) 115-149.
39. L. Parenicova, S. de Folter, M. Kieffer, D. S. Horner, C. Favalli, J. Busscher, H. E. Cook, R. M. Ingram, M. M. Kater, B. Davies, G. C. Angenent and L. Colombo, Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: new openings to the MADS world, Plant Cell 15 (2003) 1538-1551.
40. K. Kaufmann, R. Melzer and G. Theissen, MIKC-type MADS-domain proteins: structural modularity, protein interactions and network evolution in land plants, Gene 347 (2005) 183-198.
41. Y. Yang, L. Fanning and T. Jack, The K domain mediates heterodimerization of the Arabidopsis floral organ identity proteins, APETALA3 and PISTILLATA, Plant J. 33 (2003) 47-59.
42. E. M. Kramer, Floral patterning and control of floral organ formation, in: C. Ainsworth (Ed.), Flowering and its Manipulation, vol. 20, Blackwell Publishing, London, UK, 2006, pp. 49-70.
43. A. Becker and G. Theissen, The major clades of MADS-box genes and their role in the development and evolution of flowering plants, Mol. Phylogenet. Evol. 29 (2003) 464-489.
44. J. Cacharron, H. Saedler and G. Theissen, Expression of MADS box genes ZMM8 and ZMM14 during inflorescence development of Zea maysdiscriminates between the upper and the lower floret of each spikelet, Dev. Genes Evol. 209 (1999) 411-420.
45. J. S. Jeon, S. Jang, S. Lee, J. Nam, C. Kim, S. H. Lee, Y. Y. Chung, S. R. Kim, Y. H. Lee, Y. G. Cho and G. An, leafy hull sterile1 is a homeotic mutation in a rice MADS box gene affecting rice flower development, Plant Cell 12 (2000) 871-884.
46. T. Y. Tzeng, C. C. Hsiao, P. J. Chi and C. H. Yang, Two lily SEPALLATA-like genes cause different effects on floral formation and floral transition in Arabidopsis, Plant Physiol. 133 (2003) 1091-1101.
47. M. Nakada, M. Komatsu, T. Ochiai, K. Ohtsu, M. Nakazono, N. K. Nishizawa, K. Nitta, R. Nishiyama, T. Kameya and A. Kanno, Isolation of MaDEF from Muscari armeniacum and analysis of its expression using laser microdissection, Plant Sci. 170 (2006) 143-150.
48. A. Kanno, H. Saeki, T. Kameya, H. Saedler and G. Theissen, Heterotopic expression of class B floral homeotic genes supports a modified ABC model for tulip (Tulipa gesneriana), Plant Mol. Biol. 52 (2003) 831-841.
49. A. J. van Tunen, W. Eikelboom and G. C. Angenent, Floral organogenesis in Tulipa, Flower. Newsl. 16 (1993) 33-37.
50. A. Kanno, M. Nakada, Y. Akita and M. Hirai, Class B gene expression and the modified ABC model in nongrass monocots, TSWJournal 7 (2007) 268-279.
51. T. Y. Tzeng and C. H. Yang, A MADS box gene from lily (Lilium Longiflorum) is sufficient to generate dominant negative mutation by interacting with PISTILLATA (PI) in Arabidopsis thaliana, Plant Cell Physiol. 42 (2001) 1156-1168.
SEP motif I SEP/AGL6 motif SEP motif II
SEP1 A. thaliana AHHQAQSQGLYQPLEC---NPTLQMGYD--NPVCSEQITATTQAQ---AQQGNGYIPGWML------SEP3 A. thaliana HQQQQHSQAFFQPLECE---PILQIGY-------QGQQDGMGAGP----SVNNY-MLGWLPYDTNSISEP4-AGL3 A. thaliana SNPPIQEAGFFKPLQG---NVALQMSSHYNHNPANATNSATTSQN------VNGFFPGWMV------CsatSEP3a C. sativus QANQ-QEEEFYQPLDCQ---PTLQIGF-------QAD---QMAGP----SVTN-YMPGWLQ------CsatSEP3b C. sativus QANQ-QREEFYQPLDCQ---PTLHIGF-------QGD---QMAGP----SVTT-YMPGWLQ------CsatSEP3d C. sativus QQTQPQVGEFFHPLACQ---PTLQMGF-------QTE---QLSGP----SAST-YTPGWFP------CsatSEP3c C. sativus QQTQPQVGEFFHPLACQ---PTLQMGF-------QTE---QLSGP----SAST-YTPGWFP------AoMADS1 A. officinalis QPNQPHGDQFFHPLECQ---PTLQIGF-------QPD---QMPGP----SVSN-YMPGWLA------AoMADS2 A. officinalis QPSQPQGEEFFHPLECQ---PTLQIGF-------QPD---QMPGP----SASS-FMPGWLQ------DEFH72 A. majus AAQPQG-DGFFHPLECE---PTLQMGF-------QSEITVGAAGP----SVNNYNMTGWLP------SEP-like T. aestivum QAPHHGGNGFFHPLDP-TTEPTLQIGY-------TQE---QINNA----CVAASFMPTWLP------AOM4 A. officinalis QPSQPQGEEFFHPLECQ---PSLGG---------------QC-------------------------
AGL6-like A. praecox VFSMHPS—-HSSAMECE---PTLQIGY---HQLVQPEG-SLPRN----SGGENNFMLGWVL------AOM3 A. officinalis AFSMHPS--QSSAMDCE---PTLQIGY---HHLVQPEA-ALPRS----SGGENNFMLGWVL------CsatAGL6a C. sativus AFPIHPS--QSSAMDCE---PTLQIGY---HHLVQPET-ALPRN----SAGENNFMLGWVL------CsatAGL6b C. sativus AFPFHPS--QSSAMDCE---PTLQIGY---HHLVQPET-VLPRI----SEGENNFMVGWVL------AGL6-like R. bulbosus NYSGHPS--HSSSMDCE---PTLQIGY---HQYVSADGGPIQRN----NAGENNFIQGWEL------
SE
P-l
ike
A
GL
6-l
ike
Figure 1
Figure(s)
CsatSEP3a
CsatSEP3b
AOM4 Asparagus officinalis
CsatSEP3c
CsatSEP3d
SEP-like Triticum aestivum
SEP3 Arabidopsis thaliana
DEFH72 Antirrhinum majus
Mixed monocot-eudicotSEP clade
SEP1 Arabidopsis thaliana
SEP2 Arabidopsis thaliana
SEP4-AGL3 Arabidopsis thaliana
LHS1 Aristida longiseta
OsMADS1 Oryza sativa
LHS1 Avena sativa
OsMADS5 Oryza sativa
AP1/FUL
AGL6
100
72
99
100
100
100
92
99
99
100
94
90
96
88
97
0.000.050.100.150.200.25
Monocot SEP clade
Eudicot SEP clade
Figure 2