Electrical synapses in retinal ON cone bipolar cells:Subtype-specific expression of connexinsYi Han* and Stephen C. Massey

Department of Ophthalmology and Visual Sciences, University of Texas Health Science Center, Houston, TX 77030

Edited by Charles F. Stevens, The Salk Institute for Biological Studies, La Jolla, CA, and approved July 29, 2005 (received for review June 17, 2005)

Retinal bipolar cells are known to form a complex, interconnectingnetwork through electrical synapses that are either heterologous(with amacrine cells) or homologous (with other bipolar cells).These electrical synapses can be functionally as important aschemical synapses because their distinct properties provide adifferent character for the network. Much less is known, however,about electrical synapses in retinal bipolar cells than about chem-ical synapses. Here we report the molecular basis for electricalsynapses in retinal bipolar cells, particularly ON cone bipolar cells.We have found variable connexin 36 (cx36) expression in differenttypes of ON cone bipolar cells: cx36 message was found in some,but not all, ON cone bipolar cells (4 of 14 cells). In one specific typeof ON cone bipolar cell (BPGus-GFP), however, cx36 was detected in17 of 19 cells. Moreover, we have located cx36 puncta at theaxonal terminals of BPGus-GFP cells, and we have found that theseBPGus-GFP-associated cx36 puncta always colocalized with AII ama-crine cell processes. Molecular and immunocytochemical evidenceobtained in this study also shows that connexin 45 (cx45) is notpresent in BPGus-GFP cells. Taken together, our results suggest thatconnexins are expressed in bipolar cells in a neuronal subtype-specific manner and that cx36�cx36 gap junctions form the heter-ologous electrical synapses between AII amacrine cells andBPGus-GFP cells. Our findings imply that visual information can bedifferently processed by distinct subtypes of ON cone bipolar cellsvia electrical synapses.

bipolar cell � cx36 � cx45 � gap junction � AII amacrine cell

B ipolar cells, the interneurons that relay information fromphotoreceptors to ganglion cells in the retina, are essential forvisual information processing. The flow of visual information overseparate parallel pathways, such as the ON�OFF and transient�sustained pathways, depends on various subtypes of bipolar cellsthat employ both chemical and electrical synapses to communicatewith other neurons in the retina. In the past, most research on therole of bipolar cells focused on their chemical synapses, but it hasbeen known for more than two decades that electrical synapses arealso used for signaling by these cells (1–6). In fact, these electricalsynapses seem to be an essential component of certain retinalcircuits, such as the rod pathway (7). To fully understand informa-tion processing in retinal bipolar cells, then, the properties ofelectrical synapses must be elucidated.

Electrical synapses, also called ‘‘gap junctions,’’ are formed byproteins called connexins that belong to a family composed of �20members (20 connexins in mouse and 21 in human have beencloned so far). Different connexins have been shown to endow gapjunctions with different properties, such as conductance, pH mod-ulation, calcium modulation, etc. Because these functional proper-ties depend on the molecular components that make up an elec-trical synapse, it is important to know which connexins are used bywhich retinal neurons. Thus, discovering the possible candidateconnexins expressed in the bipolar cells has recently been an activearea of research.

Precisely localizing connexins to bipolar cells, however, turns outto be very difficult. First, the immunolabeled connexins appear aspuncta in the inner plexiform layer (IPL), and it is impossible toidentify retinal neurons from just these puncta. Second, there are

at least 10 types of bipolar cells in the mouse retina (8, 9), and thepresence of so many subtypes makes sorting out the expressionpattern of connexins even more difficult. Third, connexins arelocated at the junctions between two adjacent cells, and theresolution of light microscopy (even confocal microscopy) is closeto the limit for determining which cellular partner contributesconnexin immunostaining at those junctions.

Here we examine the expression pattern of connexins in ON conebipolar cells. Our goal is to overcome the three problems notedabove by using single-cell RT-PCR and immunocytochemistry andalso by making use of a line of transgenic mice (GUS-GFP) in whicha specific type of ON cone bipolar cell expresses GFP (12), referredto hereafter as BPGus-GFP. Although we find connexin 36 (cx36)message in only a fraction of mixed types of ON cone bipolar cells,transcripts of cx36 are found in almost all BPGus-GFP cells. Weconclude that connexin expression occurs in a subtype-specificmanner in retinal bipolar cells. Furthermore, the cx36 immu-nopuncta have been found in BPGus-GFP axonal processes, and theseBPGus-GFP-associated cx36 puncta are always colocalized with Dab-1-positive AII amacrine cell process. Taking these findings togetherwith the presence of cx36 message in BPGus-GFP cells, we concludethat cx36 is a constituent of both hemichannels in the heterologousgap junctions between BPGus-GFP cells and AII amacrine cells.Additionally, we show evidence that connexin 45 (cx45) is notexpressed in BPGus-GFP cells.

Materials and MethodsAnimal Preparation. All experimental procedures involving animalswere approved by the University of Texas Health Science Center atHouston Animal Care and Use Committee. Animals were killed bya lethal injection with ketamine plus xylazine plus acepromazine(0.1 ml, 100 mg�ml) and were immediately decapitated.

Our protocol for dissociating retinal neurons was modified fromthat described in our previous work (13): 40 units�ml papain(lyophilized, Worthington), 5 mM L-cysteine, 5 mM EGTA, and400 units�ml DNase I (Worthington) were used for a 50-minincubation at room temperature to dissociate bipolar cells. At theend of the incubation, the retina was rinsed five times with Hanks’solution and gently shaken until the tissue dissociated. The cellswere placed on a 35-mm cell culture dish and were used within 2 hof dissociation.

Retinal slices were prepared as described by Werblin (14). Themorphologies of Lucifer Yellow-labeled cells were viewed withepifluorescence and captured with a SenSys charge-coupled devicecamera (Photometrics, Tucson, AZ).

Immunocytochemistry. After fixation, the tissues were washed ex-tensively with 0.1 M phosphate buffer (pH 7.4) and blocked with3% donkey serum. The antibodies (Abs) were diluted in 1% donkeyserum. The retinal whole-mount sections were incubated with

This paper was submitted directly (Track II) to the PNAS office.

Abbreviations: cx, connexin; IPL, inner plexiform layer.

*To whom correspondence should be addressed at: 6431 Fannin Street, Suite 7.024,Department of Ophthalmology and Visual Sciences, University of Texas Health ScienceCenter, Houston, TX 77030. E-mail: yi.han@uth.tmc.edu.

© 2005 by The National Academy of Sciences of the USA

www.pnas.org�cgi�doi�10.1073�pnas.0505067102 PNAS � September 13, 2005 � vol. 102 � no. 37 � 13313–13318

NEU

ROSC

IEN

CE

Dow

nloa

ded

by g

uest

on

June

26,

202

1

primary Abs for 5 days and with secondary Abs overnight at 4°C.The retinal vertical sections were incubated with primary Absovernight at 4°C and with secondary Abs for 2 h at room temper-ature. The primary Abs used in this study included mouse mAbs tocx36 (1:1,000; MAB3045, Chemicon), rabbit polyclonal Abs to cx36(1:250; 51-6200, Zymed), rabbit polyclonal Abs to Dab-1 (1:500; giftfrom Brian Howell, National Institutes of Health, Bethesda), andmouse mAbs to cx45 (1:500; MAB3101, Chemicon). The secondaryAbs, conjugated with Cy3 or Cy5 (1:200), were obtained fromJackson ImmunoResearch.

Digital images (1,024 � 1,024 or 2,048 � 2,048 pixels) wereacquired by using a Zeiss LSM 510 confocal microscope and wereprocessed in PHOTOSHOP (Adobe Systems, San Jose, CA). Thecolocalization analysis was done with IMAGE-PRO PLUS and customcolocalization software (15). Boxes (18 � 18 or 36 � 36 pixels) wereclipped from the image by centering a sampling box around theconnexin puncta. Alignment and averaging of these boxes produceda plot of color intensity against the location of pixels in the x–y plane.This method determines the average distribution of each labeledchannel around a repeated neuronal structure, in this case animmunolabeled gap junction. Controls were performed by rotatingone channel by 90° or transposing one channel from left to right.The ratio of average peak intensity to intensity of GFP in the bipolarcell terminals gave the colocalization rate between connexin punctaand bipolar terminals.

Single-Cell cDNA Amplification. cDNAs were synthesized and am-plified by a single-cell RT-PCR procedure as described in refs. 16and 17. Briefly, individual cells were seeded into thin-walled PCRtubes containing 4 �l of ice-cold cell lysis buffer [1� reversetranscriptase buffer (Invitrogen), 0.5% Nonidet P-40 (UnitedStates Biochemical) containing 80 ng�ml pd(T)19-24 (AmershamPharmacia), 5 units�ml Prime RNase inhibitor (Eppendorf), 324units�ml RNAguard (Amersham Pharmacia), and 10 �M each ofdNTPs (zcomRoche Applied Science)]. Lysis was subsequentlyperformed at 65°C for 1 min. First-strand cDNA synthesis wasperformed by adding 50 units of MMLV and 0.5 units of AMV(Invitrogen) at 37°C for 15 min, and then samples were heat-inactivated at 65°C for 10 min. Poly(A) was added to the first-strandcDNA product by using 10 units of terminal transferase (RocheDiagnostics) at 37°C for 15 min, and samples were heat-inactivatedat 65°C for 10 min. Amplification of tailed cDNA was done by PCRwith primer AL1 (5�-ATT GGA TCC AGG CCG CTC TGG ACAAAA TAT GAA TTC (T)24-3�) (16, 17).

PCR Analyses. Specific primers for the PCR analyses were designedwith PRIMER PREMIER 5.0 (PREMIER Biosoft International, PaloAlto, CA) based on known mouse cDNA. Primers were locatedwithin 600 bp of the poly(A) addition site and had melting tem-peratures close to 52°C. (Primers were as follows: PKC� sense,GCCATCAGTAATCATGCCACT; PKC� anti-sense, GGAAC-CCAAACTATGCTCTT; mGluR6 sense, CCAGAATTTAAG-GTACAGAACTC; mGluR6 anti-sense, GGACTCAAACAG-GACAGAAG; cx36 outer sense, TGGAGGGTATCTACTCA-AGCC; cx36 outer anti-sense, CAATGCTACTCTTGCCTAG-TGC; cx36 inner sense, CCGTGTCAATCCCAACTTATTGTG;cx36 inner anti-sense, TGCTACTCTTGCCTAGTGCTT-CAG; cx45 outer sense, CTAGCAATCCAGGCCTAC; cx45 outeranti-sense, TCTGGAAGACACAACCTG; cx45 inner sense CAT-CACCAAAACAACCC; and cx45 inner anti-sense, CTCCACCT-TCAGAGTCCC). PCRs were performed with an initial denatur-ing step of 5 min at 94°C, then 35 cycles at 94°C for 30 s, 52°C for1 min, and 72°C for 1 min, and a final elongation step of 7 minat 72°C.

ResultsExpression of cx36 in ON Cone Bipolar Cells. Because of the greatvariety of retinal cell types, studies that seek to understand connexin

properties of a single neuron type are always difficult. To study theconnexin expression pattern in ON cone bipolar cells withoutcontamination by other neuronal types, we examined the expressionprofile at the single-cell level. We first used isolated ON conebipolar cells by dissociating the retina; Fig. 1A shows representativemicrographs of retinal bipolar cells isolated in this way from themouse retina. Under optimal dissociation conditions, retinal bipo-lar cells maintain recognizable morphologies, and rod bipolar cells(Fig. 1A Left) can be easily distinguished from cone bipolar cells(Fig. 1A Center and Right) by their knob-shaped axonal terminaland tapered dendritic terminal. The identities of the bipolar cellswere further confirmed by determining the expressions of bipolarcell marker genes PKC� and mGluR6 via a single-cell RT-PCRapproach. After the isolated retinal bipolar cells were collected bymanual microcapture, single-cell cDNA amplifications were per-formed (see Materials and Methods). Then, the amplified single-cellcDNA was used for PCR with specific primers for PKC� andmGluR6. As shown by gel electrophoresis (Fig. 1B), cDNA fromrod bipolar cells gave PCR products for both PKC� and mGluR6,whereas cDNA from ON cone bipolar cells gave PCR products formGluR6 only. We successfully amplified single-cell cDNA samplesfrom 30 bipolar cells, including 10 rod bipolar, 6 OFF cone bipolar,and 14 ON cone bipolar cells.

To examine the expression of cx36 in ON cone bipolar cells,

Fig. 1. Single-cell gene expression analysis of retinal bipolar cells. (A)Microphotographs of dissociated retinal bipolar cells. (B) Single-cell RT-PCRresults from representative bipolar cells samples show the expression ofmarker genes in different types of bipolar cells. (C) Gene expression profile inON cone bipolar cells (ON CB#) by single-cell RT-PCR. Although the bipolar cellmarker gene mGluR6 is detected in all of these neurons, cx36 is detected inonly a fraction of ON cone bipolar cells. (D Left) Morphology of a cx36-positiveON cone bipolar cell revealed by the Lucifer Yellow-filled whole-cell patchelectrode. (Right) The single-cell RT-PCR results from the same bipolar cell.ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer.

13314 � www.pnas.org�cgi�doi�10.1073�pnas.0505067102 Han and Massey

Dow

nloa

ded

by g

uest

on

June

26,

202

1

PCRs with specific primers to cx36 were performed by usingamplified single-cell cDNA from the ON cone bipolar cellsidentified above. Surprisingly, only a fraction (4 of 14) of ONcone bipolar cells was found to have cx36 transcript. On the otherhand, mGluR6 was found in all these samples, as expected (Fig.1C). Such an expression pattern could arise in two different ways:random and subtype-specific expression. The examination ofmorphological details of cx36-positive ON cone bipolar cellsshould distinguish between random and subtype-specificexpression.

To examine the detailed morphology of the cx36-positive bipolarcells, retinal slice preparations were used. We combined whole-cellpatch clamp recording with the single-cell RT-PCR technique. Weused patch electrodes filled with a fluorescence dye (LuciferYellow) so that the dye would diffuse into the cell while cytoplasmicmRNA was diffusing into the recording electrode. With thisstrategy, we had morphological information about the cells whosemRNA we used for RT-PCR to discover which connexin(s) wereexpressing. In total, we successfully collected seven ON conebipolar cells samples from retinal slice preparations. We found cx36expressed in four of these seven ON cone bipolar cells. Amongthese four cx36-positive bipolar cells, three shared similar morphol-ogy as revealed by Lucifer Yellow (Fig. 1D): their axonal terminalsstratified in stratum IV of the IPL with relatively narrow axonalarbors (�20 �m), and their dendritic processes had a graduallytapering shape. These cells resemble type 7 bipolar cells (8) andGFP-expressing ON cone bipolar cells in the transgenic lineGUS-GFP [BPGus-GFP (12)]. Moreover, the percentage of ON conebipolar cells that are thought to be type 7 [�25% (8)] is comparable

with the fraction of ON cone bipolar cells that we found to expresscx36 (29%, 4 of 14 cells).

Taken together, our observations suggest that cx36 expression inON cone bipolar cells may be subtype-specific. Below, we furthercharacterize cx36 expression in a uniform subtype of ON conebipolar cells, BPGus-GFP neurons.

cx36 in a Subtype of ON Cone Bipolar Cells: BPGus-GFP. To test thehypothesis that cx36 expression in ON cone bipolar cells is cellsubtype-specific, we have taken advantage of a transgenic mouseline, GUS-GFP (12). Fig. 2A presents a vertical section of the retinafrom a GUS-GFP mouse in which strong GFP signals are seen inthe narrow-field bipolar cells whose terminals ramified in stratumIV of the IPL. Fig. 2B shows an example of an isolated BPGus-GFPcell prepared from the retina of GUS-GFP mice. Because BPGus-GFP cells can be easily identified by the fluorescence of GFP, we areable to collect cell content from a homogenous subtype of ON conebipolar cells. Single-cell cDNA has been successfully amplified from19 BPGus-GFP cells, and cx36 has been identified in 17 of 19 cells. The

Fig. 2. Gene expression of cx36 in BPGus-GFP cells from GUS-GFP mice. (A)BPGus-GFP is a specific subtype of ON cone bipolar cell. GCL, ganglion cell layer.Other abbreviations are as in Fig. 1. (Scale bar, 20 �m.) (B) A representativedissociated BPGus-GFP cell. (C Upper) Single-cell RT-PCR analysis shows that cx36is expressed in all BPGus-GFP cells. ON CB#, ON cone bipolar cell. (Lower) Theidentities of PCR products are confirmed by restriction (RE) digestion with SspI.

Fig. 3. Immunostainingofcx36 in thewhole-mount retinaofGUS-GFPmice. (A)cx36 puncta (red) and BPGus-GFP axonal arbors (green) are superimposed. (B and C)The overlapping puncta are labeled with numbers. The two boxed areas in A areshown at higher magnification. (G) Sampling boxes (n � 134) around cx36 punctawere randomly selected from those shown in A, and the results of signal-averaging analysis are illustrated. The plot of the red channel, representing thecx36 signals, shows a sharp peak at the center, as expected because samplingboxes were aligned with cx36 puncta in the center. The plot of the green channel,representing the GFP signals, shows a small peak in the center. (D) As a control,the green image in A was rotated 90° relative to cx36 signals, and the results areshown. (E and F) The boxed areas in D are displayed at higher magnification. (D–Fand H) The colocalization analysis was performed again with 134 sampling boxesselected from D. Few overlapping puncta (labeled by numbers) were observed(D–F), and no correlated peak for GFP signal was seen (H).

Han and Massey PNAS � September 13, 2005 � vol. 102 � no. 37 � 13315

NEU

ROSC

IEN

CE

Dow

nloa

ded

by g

uest

on

June

26,

202

1

electrophoresis gel (Fig. 2C Upper) shows the results of PCR, withspecific primers to cx36, using amplified single-cell cDNA fromrepresentative BPGus-GFP cells. To further confirm the results of ourPCR analysis, we performed a restriction enzyme digestion. ThePCR fragments of cx36 contain a unique cutting site for SspI. Gelelectrophoresis (Fig. 2C Lower) shows that the patterns of digestionfragments are as predicted by the cx36 sequence. In addition, wealso confirmed the PCR products in some samples by sequence.Together, then, we are confident that it is the cx36 transcript thatgives rise to the PCR products we have identified. In contrast to ourfinding on cx36 expression in all types of ON cone bipolar cells,almost all (17 of 19) of the BPGus-GFP cells express cx36.

To further examine the subcellular location of cx36 in BPGus-GFPcells, immunocytochemical studies were performed. A whole-mount retina from GUS-GFP mice labeled with cx36 Ab is shownin Fig. 3A. Two selected areas are displayed at higher magnificationin Fig. 3 B and C. Colocalizations of cx36 immunopuncta (shown inred) and BPGus-GFP axonal terminals (shown in green) were firstanalyzed by counting coincidences. We found that 13% (28 of 215)of cx36 puncta were associated with GFP bipolar terminals. We alsosignal-averaged all of the pixels surrounding the cx36 puncta.Sampling boxes, centered on cx36 puncta, were selected with theGFP signals turned off to avoid any sampling bias. The averagedintensities were plotted against the location of pixels in the x–yplane, revealing the spatial distribution for GFP around the cx36puncta (Fig. 3G). A sharp central peak was observed for cx36because these puncta were chosen as the center of the samplingboxes. A small, broader central peak was observed for GFP signals.This broad peak reflects the random orientation and the large sizeof the bipolar terminals; the smallness of the peak was due to theexistence of cx36 puncta not associated with bipolar terminals.Calculation from the intensity measurements suggests (see Mate-rials and Methods) that �12% of the cx36 puncta are associated withbipolar cell terminals, in agreement with the coincidence rate(13%) calculated earlier. As a control, the GFP signals were rotated

90° relative to the cx36 signals (Fig. 3 D–F). Such manipulationdestroyed the spatial relationships in the original image but pro-vided a way to assess chance overlap in a dense image. Thecoincidence rate between cx36 puncta and GFP-labeled bipolarterminals decreased to only 3% (6 of 215) in this control and wasmainly due to random overlaps, as indicated by the loss of thecentral peak for GFP signal in signal-average analysis with thecontrol (Fig. 3H).

Similar observations were also made in retinal cross sections. Inthe low-power micrograph (Fig. 4A), cx36 immunostaining appearsto overlap with BPGus-GFP axonal terminals in stratum IV of the IPL.A single confocal optical image at a higher magnification is shownin Fig. 4B. The GFP signals in Fig. 4B were transposed from left toright for the negative control (Fig. 4C). Because BPGus-GFP termi-nals are narrowly stratified in the IPL, simply rotating the image by90° would automatically mean the structures in the two channelswould no longer overlap. Transposing the image from left to rightmaintained the same stratification level and made a better control.By counting the coincidences, we found that 10% (17 of 165) of cx36puncta were associated with GFP bipolar terminals, whereas thecoincidence rate was only 1% (2 of 165) in the negative control (Fig.4C). In summary, we have demonstrated quantitatively that cx36occurs at the axonal terminals of BPGus-GFP cells.

Because it is known that ON cone bipolar cells form gap junctionswith AII amacrine cells, our observations raise an interestingquestion: Is cx36 in the bipolar cells used to form the gap junctionsbetween BPGus-GFP and AII amacrine cells? To address this ques-tion, AII amacrine cells from GUS-GFP mice were labeled withAbs against disable-1 (Dab-1) (Fig. 4D). The same section was alsoimmunostained for cx36, and the boxed area in Fig. 4D is shown athigher magnification in Fig. 4 E–H. As indicated by the squareboxes, BPGus-GFP-associated cx36 puncta always overlap with Dab-1immunostains. To further confirm this, a colocalization analysis wasdone. In this analysis, we turned off Dab-1 immunostaining signalsand selected the sampling boxes around the BPGus-GFP-associated

Fig. 4. Immunostaining of cx36 in the retinal vertical section of GUS-GFP mice. (A) cx36 puncta (red) are found in the GFP-labeled bipolar cell axonal terminals.(Scale bar, 20 �m.) (B) A confocal image at high magnification. The overlapping puncta are labeled with numbers. (C) As a control, the GFP image in B wastransposed from left to right; few overlapping puncta were observed. (D) Dab-1 immunostaining of the inner mouse retina. (E–H) Double-labeling of the boxedarea in D with cx36 and Dab-1. GFP-labeled bipolar terminals (green), cx36 immunoreactive puncta (blue), and Dab-1 immunostaining (red) are shown. The squareboxes highlight the BPGus-GFP-associated cx36 puncta. (I) The colocalization analysis of the BPGus-GFP terminals and cx36 and Dab-1 immunostains. Sampling boxes(n � 77) with BPGus-GFP-associated cx36 puncta at the center were selected. As indicated by the surface plots, there is a high probability of finding an AII dendriteat the site of cx36 plaques on BPGus-GFP cells. Abbreviations are as in Figs. 1 and 2.

13316 � www.pnas.org�cgi�doi�10.1073�pnas.0505067102 Han and Massey

Dow

nloa

ded

by g

uest

on

June

26,

202

1

cx36 puncta. In other words, only the cx36 puncta colocalized withgreen bipolar terminals were selected. Of 77 BPGus-GFP-associatedcx36 puncta we counted, 73 colocalized with Dab-1-positive AIIamacrine cell processes. A sharp peak was also observed for Dab-1signal in a signal-averaging analysis where sampling boxes werecentered at the BPGus-GFP-associated cx36 puncta (Fig. 4I). Thus,AII amacrine cells provide the partners for the cx36 puncta onbipolar cells. Taken together with the observation that the cx36transcript is present in the BPGus-GFP cells, we conclude that thecx36�cx36 gap junctions form the heterologous electrical synapsesbetween AII amacrine and BPGus-GFP cells.

cx45 in ON Cone Bipolar Cells. A recent study (11) suggests that cx45is present in multiple types of ON cone bipolar cells and thatheterotypic gap junctions are formed by cx36 supplied by AIIamacrine cells and cx45 provided by bipolar cells. We have found,however, that BPGus-GFP cells express cx36 and that they use cx36 toform gap junctions with AII amacrine cells. It is thus interesting toask whether cx45 is also expressed in this particular subtype of ONcone bipolar cell. Accordingly, we have examined the cx45 expres-sion in BPGus-GFP cells by single-cell RT-PCR and immunocyto-chemistry. Fig. 5A shows a retinal vertical section labeled with cx45Ab and many red puncta, which are found throughout the IPL. Wealso double-labeled sections with anti-cx36 and anti-cx45 (Fig. 5B).Three selected fields (Fig. 5B Upper) from the IPL are shown athigher magnification (Fig. 5B Lower). The cx45 immunopunctanever colocalize with cx36 puncta. Occasionally, these two kinds ofpuncta are found near each other, but these puncta are notassociated with BPGus-GFP terminals. In fact, we find no cx45immunostain on BPGus-GFP cells as shown in whole-mount retinafrom GUS-GFP mice (Fig. 5C). The few colocalized puncta ob-served are due to random overlap because there was no centralpeak for GFP signal when cx45 puncta were sampled in oursignal-averaging analysis (Fig. 5I). Single-cell RT-PCR performedwith cx45-specific primers further confirmed our immunostaining

results: BPGus-GFP cells do not express cx45 significantly (Fig. 5J).Overall, mGluR6 was found in 19 of 19 samples, and cx36 waspresent in 17 of 19, but cx45 appeared in only 3 of 19 samples.Furthermore, cx45 puncta were not present at the junctions be-tween AII amacrine and BPGus-GFP cells as revealed by double-labeling the retina vertical sections from GUS-GFP mice with Absto Dab-1 and cx45 (arrows in Fig. 5 D–H). On the other hand, wedid observe that cx45 puncta next to Dab-1-positive AII amacrinecell processes (arrowheads in Fig. 5 D–H). This is consistent withour observation that cx45 puncta sometimes are located next to cx36puncta.

We conclude, therefore, that cx45 is, at most, very infrequentlyused by the BPGus-GFP cells to form gap junctions with AII amacrinecells.

DiscussionThe present study used single-cell RT-PCR and immunocytochem-ical approaches to investigate the molecular basis for electricalsynapses made by ON cone bipolar cells in the mouse retina. Wepresent direct evidence that connexin expression in ON conebipolar cells is cell subtype-dependent. This finding is importantbecause the absolute sensitivity of mammalian vision depends onthe transmission of rod signals from AII amacrine cells to ON conebipolar cells via gap junctions. Our finding implies that visualinformation can be differently processed by distinct subtypes of ONcone bipolar cells via electrical synapses.

Despite the well known fact that bipolar cells are coupled eitherheterologously (with amacrine cells) or homologously (with otherbipolar cells), the role of electrical synapses in information pro-cessing by bipolar cells is not well understood. To date, the bestcharacterized electrical synapses made by bipolar cells are thosebetween AII amacrine cells and ON cone bipolar cells. These gapjunctions play an important role in the rod primary pathway in themammalian retina: rod signals are transmitted through rod bipolarcells, then to AII amacrine cells that couple to ON cone bipolar

Fig. 5. Expression of cx45 in theretina. (A) Immunostainings ofcx45 in retinal vertical section. (BUpper) Confocal micrographs ofvertical sections through the IPL ofmouse retina double-labeled forcx36 (rabbit polyclonal) and cx45(mouse monoclonal). (Lower) Theboxed areas (1, 2, and 3) in B Upperare shown at higher magnifica-tion. (C) A whole-mount sectionfrom GUS-GFP retina was labeledwith cx45 Abs. (D) Confocal micro-graphs of vertical sections of theinner retina from GUS-GFP micedouble-labeled for cx45 andDab-1. (E–H) The boxed area in Dshown at higher magnification. (I)Colocalization analysis of cx45puncta and BPGus-GFP axonal termi-nals. (J) Gene expression profile ofBPGus-GFP cells shows that this sub-type of the ON cone bipolar celluses cx36 rather than cx45. Abbre-viations are as in Figs. 1 and 2.

Han and Massey PNAS � September 13, 2005 � vol. 102 � no. 37 � 13317

NEU

ROSC

IEN

CE

Dow

nloa

ded

by g

uest

on

June

26,

202

1

cells, and finally to ganglion cells. Recently, the molecular basis forthese gap junctions has been under intensive investigation. cx36puncta have been located at junctions between AII and AIIamacrine cells in several species including rabbit, mouse, and rat (7,10, 18). Also, as predicted, cx36 knockout mice have a defect inscotopic light responses (19). It has, however, been debated whethercx36 is used by bipolar cells (7, 10, 11). One view is that homotypicgap junctions formed by cx36 mediate the communication betweenAII amacrine cells and ON cone bipolar cells (7). Another quitedifferent view holds that the gap junctions between AII amacrinecells and bipolar cells are heterotypic: according to this hypothesis,cx36 is used only by AII amacrine cell contribution to the bipolar�amacrine electrical synapses, and some different connexin is con-tributed by the bipolar cell half of the gap junction (10, 11). It isworth pointing out that both views have only taken into consider-ation the homomeric configuration for the hexameric connexinhemichannels. Thus, if cx36 is present in the bipolar cells, thecx36�cx36 bipolar�amacrine gap junction would be homotypic.Heteromeric gap junctions occur only between connexins of thesame group (20), so one might expect cx36 to be unable to form anyheteromeric hemichannels with other connexins because it is in agroup by itself. However, this issue requires further study and isbeyond the scope of the present work.

The first hypothesis, the homotypic hypothesis, is mainly based onthe expression of a reporter gene in bipolar cells of cx36 knockoutmice (in which cx36 was replaced by a reporter gene) (7). Thesecond hypothesis, the heterotypic hypothesis, is based on thefollowing two lines of evidence. First, different permeabilities werefound for gap junctions between homologous AII�AII and heter-ologous AII�ON cone bipolar cells by injecting tracers of differentsizes (21). In other words, these two types have different properties.Second, in the rat retina, recoverin selectively labels a specific typeof ON cone bipolar cell and, in retinal dissociates, none of therecoverin-positive isolated bipolar cells were immunolabeled bycx36 Abs (10).

The evidence for the homotypic hypothesis does not completelyrule out the possible existence of heterotypic gap junctions betweenAII amacrine and bipolar cells: it is not clear what subtypes ofbipolar cells expressed the reporter gene in the cx36 knockout mice,and it is also not clear whether cx36 is the only connexin expressedin these bipolar cells. By the same token, the two lines of evidencethat support the heterotypic hypothesis cannot completely rule outthe possibility of homotypic channels. If the two halves of ahomotypic gap junction are identical but are modulated differentlyin bipolar cells and AII amacrine cells, then different permeabilitiesmight be observed between AII�AII and AII�ON cone bipolarcells even though both have cx36 homotypic gap junctions. Thequestion also remains about the extent to which connexin expres-sion in one subtype of bipolar cell can be generalized to othersubtypes. In other words, it is possible that heterotypic gap junctionsare present between AII and recoverin-positive ON cone bipolarcells and homotypic gap junctions are used by other bipolar cells.

Our finding that cx36 expression in bipolar cells is cell subtype-specific provides a reasonable explanation for the apparently con-flicting results and for how the two competing hypotheses aboutbipolar cell gap junctions could have arisen.

Our results show that the hypothesis that AII�ON cone bipolarcell gap junctions are formed by cx36 in both hemichannels is trueat least for the subtype ON cone bipolar cell, BPGus-GFP. We havefound that cx36 message is present in BPGus-GFP cells by single-cellRT-PCR, and we have found cx36 puncta in axonal terminals ofBPGus-GFP cells. Moreover, all BPGus-GFP-associated cx36 puncta areat the junctions between BPGus-GFP axonal terminals and AIIamacrine cells. Because cx36 has not been found anywhere inBPGus-GFP cells but the junctions between BPGus-GFP and AIIamacrine cells, our conclusion is a reasonable, logical one. The onlyexception would be that cx36 is never translated into protein inBPGus-GFP cells, and such regulation by translation has not beenreported.

Our results also show evidence for the possible existence ofheterotypic gap junctions between AII amacrine cells and bipolarsubtypes other than BPGus-GFP. We have found, by single-cellRT-PCR analysis, that cx36 transcripts are not present in all ONcone bipolar cells. These observations cannot be explained simplyby experimental artifact. The single-cell cDNA amplification pro-tocol used in our studies has been shown to be a powerful tool instudying gene expression and to give an accurate representation ofrelative transcript abundances (17, 22). Because variability amongsamples cannot be completely eliminated, we have carefully char-acterized false-positive and false-negative events in our experimen-tal procedure with known marker genes (unpublished work). Cell-specific markers were observed mainly in the ‘‘correct’’ cells andwere missing from those cells with a false detection rate of �12%.Furthermore, the detection of cx36 in a uniform population ofBPGus-GFP cells is close to 100%. We therefore conclude that cx36is not used by all of the ON cone bipolar cell types and that theconnexin expression in these neurons is cell subtype-dependent.For the bipolar subtypes that lack cx36, communications with AIIamacrine cells must use connexins other than cx36 and must occuras heterotypic gap junctions. cx45 has recently been shown to bepresent in ON cone bipolar cells and might be used to formcx36�cx45 heterotypic gap junctions between bipolar and AIIamacrine cells (11). However, we have shown by single-cell RT-PCR and immunocytochemistry that BPGus-GFP cells do not havecx45. We did occasionally observe cx45 message in unidentifiedsubtypes of ON cone bipolar cells (data not shown). The double-labeling experiments with cx36 and cx45 show that cx36 puncta aresometimes adjacent to cx45 puncta (Fig. 5C), suggesting the pos-sible existence of cx36�cx45 heterotypic gap junctions. Their cel-lular identities are, however, not yet clear. It is quite possible thatthose heterotypic gap junctions are used by AII amacrine cellsbecause the double-labeling experiments with cx45 and Dab-1 showthat cx45 is sometimes adjacent to AII amacrine cell processes.

Note. While this work was under review, Lin et al. (23) reported similarobservations that are consistent with the results presented here.

We thank Dr. Robert F. Margolskee (Mount Sinai School of Medicine,New York) for kindly sending us the GUS-GFP mice. This study wassupported by National Eye Institute grants (to S.C.M.) and by Fight forSight International Retina Research Foundation grants (to Y.H.).

1. Kolb, H. (1979) J. Neurocytol. 8, 295–329.2. Cohen, E. & Sterling, P. (1990) Philos. Trans. R. Soc. London B 330, 323–328.3. Cohen, E. & Sterling, P. (1990) Philos. Trans. R. Soc. London B 330, 305–321.4. Strettoi, E., Raviola, E. & Dacheux, R. F. (1992) J. Comp. Neurol. 325, 152–168.5. Massey, S. C. & Mills, S. L. (1999) Visual Neurosci. 16, 1181–1189.6. Mills, S. L. (1999) Visual Neurosci. 16, 1029–1035.7. Deans, M. R., Volgyi, B., Goodenough, D. A., Bloomfield, S. A. & Paul, D. L. (2002) Neuron

36, 703–712.8. Ghosh, K. K., Bujan, S., Haverkamp, S., Feigenspan, A. & Wassle, H. (2004) J. Comp. Neurol.

469, 70–82.9. Haverkamp, S., Ghosh, K. K., Hirano, A. A. & Wassle, H. (2003) J. Comp. Neurol. 455, 463–476.

10. Feigenspan, A., Teubner, B., Willecke, K. & Weiler, R. (2001) J. Neurosci. 21, 230–239.11. Maxeiner, S., Dedek, K., Janssen-Bienhold, U., Ammermuller, J., Brune, H., Kirsch, T.,

Pieper, M., Degen, J., Kruger, O., Willecke, K., et al. (2005) J. Neurosci. 25, 566–576.

12. Huang, L., Max, M., Margolskee, R. F., Su, H., Masland, R. H. & Euler, T. (2003) J. Comp.Neurol. 455, 1–10.

13. Han, Y., Jacoby, R. A. & Wu, S. M. (2000) Brain Res. 875, 175–186.14. Werblin, F. S. (1978) J. Physiol. 280, 449–470.15. Li, W., Trexler, E. B. & Massey, S. C. (2002) J. Comp. Neurol. 448, 230–248.16. Brady, G. & Iscove, N. N. (1993) Methods Enzymol. 225, 611–623.17. Dulac, C. & Axel, R. (1995) Cell 83, 195–206.18. Mills, S. L., O’Brien, J. J., Li, W., O’Brien, J. & Massey, S. C. (2001) J. Comp. Neurol. 436, 336–350.19. Bloomfield, S. A. & Volgyi, B. (2004) Vision Res. 44, 3297–3306.20. Evans, W. H. & Martin, P. E. (2002) Mol. Membr. Biol. 19, 121–136.21. Mills, S. L. & Massey, S. C. (2000) J. Neurosci. 20, 8629–8636.22. Iscove, N. N., Barbara, M., Gu, M., Gibson, M., Modi, C. & Winegarden, N. (2002) Nat.

Biotechnol. 20, 940–943.23. Lin, B., Jakobs, T. C. & Masland, R. H. (2005) J. Neurosci. 25, 6696–6701.

13318 � www.pnas.org�cgi�doi�10.1073�pnas.0505067102 Han and Massey

Dow

nloa

ded

by g

uest

on

June

26,

202

1