Effects of statins on nitric oxide/cGMP signaling in...

Effects of statins on nitric oxide/cGMP signaling

in human umbilical vein endothelial cells

Claudia Meda1, Christian Plank2, Olga Mykhaylyk2, Kurt Schmidt1,

Bernd Mayer1

�Department of Pharmacology and Toxicology, Karl-Franzens University Graz, Univ–Platz 2, A-8010 Graz, Austria

�Department of Experimental Oncology, Technical University Munich, Ismaninger St. 22, D-81675 München,

Germany

Correspondence: Bernd Mayer, e-mail: [email protected]

Abstract:

Human umbilical vein endothelial cells (HUVECs) were established as in vitro models for the modulation of endothelial function

and cell viability by statins. Emphasis was placed on the biphasic effects of the drugs on nitric oxide (NO) bioavailability and cyto-

toxicity, as well as drug interference with the interaction of endothelial NO synthase (eNOS) with caveolin-1 (Cav-1). Incubation of

HUVECs with fluvastatin, lovastatin or cerivastatin for 24 h caused an approximately 3-fold upregulation of eNOS expression that

was associated with increased eNOS activity and accumulation of cGMP. Cerivastatin exhibited the highest potency with an EC�� of

13.8 ± 2 nM after 24 h, while having no effect after only 30 min. The effects of statins on eNOS expression were similar in control

and Cav-1 knockdown cells, but the increase in eNOS activity was less pronounced in Cav-1-deficient cells. Statin-triggered cyto-

toxicity occurred at ~10-fold higher drug concentrations (maximal toxicity at 1–10 µM), was sensitive to mevalonate, and was sig-

nificantly enhanced in the presence of N�-nitro-L-arginine. The overexpression of eNOS induced by clinically relevant

concentrations of statins may contribute to the beneficial vascular effects of the drugs in patients. Stimulation of NO synthesis and

cytotoxicity appear to share a common initial mechanism but involve distinct downstream signaling cascades that exhibit differential

sensitivity to HMG-CoA reductase inhibition.

Key words:

caveolae, cyclic GMP, cytotoxicity, endothelial function, nitric oxide, HMG-CoA reductase inhibitors

Abbreviations: BH� – tetrahydrobiopterin, Cav-1 – caveolin-1,

Cer – cerivastatin, DEA/NO – 2,2-diethyl-1-nitroso-oxyhydrazine,

EC�� – half-maximally effective concentration, eNOS – endo-

thelial nitric oxide synthase, Flu – fluvastatin, HMG-CoA – 3-

hydroxy-3-methylglutaryl-coenzyme A, HUVECs – human

umbilical vein endothelial cells, LDH – lactate dehydrogenase,

L-NNA – N�-nitro-L-arginine, Lov – lovastatin, MTT – 3-(4,5-

dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide, MVA

– mevalonate, NO – nitric oxide, PBS – phosphate-buffered sa-

line, TEA – triethanolamine

Introduction

One of the early markers of atherosclerosis is endo-

thelial dysfunction, characterized by impaired release

and/or bioavailability of nitric oxide (NO) [1, 6, 7, 42,

52, 59], which plays an essential role in the regulation

of vascular tone [41]. Based on the deleterious effects

of hyperlipidemia, inhibitors of cholesterol biosynthe-

100 ��

��

��

��

��

�� !��

��!�� " �#��

sis have been developed for the prevention of cardio-

vascular diseases associated with atherosclerosis. The

so-called statins, which inhibit the reduction of 3-

hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA)

to mevalonate (MVA), the rate-limiting step of liver

cholesterol biosynthesis, were shown to diminish cho-

lesterol biosynthesis with consequent reduction in se-

rum levels of low-density lipoproteins and triglycerides

[30, 39]. Statins are the most commonly prescribed

drugs for the treatment of hypercholesterolemia with

excellent tolerability and safety [39].

The reduction of cardiovascular events by statin

therapy was found to be partially unrelated to the re-

duction of plasma lipid levels, suggesting additional

beneficial effects of the drugs [50]. Besides choles-

terol biosynthesis, HMG-CoA reductase is essential to

the formation of non-sterol intermediates that are in-

volved in various cellular signaling cascades [19, 33].

Isoprenoid intermediates are required for post-

translational isoprenylation of many proteins, includ-

ing small GTP-binding proteins. Since isoprenylation

is essential for the proper signaling function of these

proteins [38], inhibition of MVA synthesis may result

in inhibition of downstream signaling cascades. In en-

dothelial cells, activation of RhoA results in de-

creased release of NO, a hallmark of endothelial dys-

function [50], presumably through reduced expression

and/or activity of endothelial NO synthase (eNOS), as

well as decreased NO bioavailability [12]. Inhibition

of the RhoA pathway by statins was shown to up-

regulate eNOS expression by increasing the half-life

of eNOS mRNA [31, 32]. In addition, statins were re-

ported to acutely increase eNOS activity via activa-

tion of the PI3/Akt kinase pathway [22, 64]. It has

been suggested that this effect is mediated by tyrosine

phosphorylation of heat shock protein 90 which acti-

vates eNOS [8]. Finally, statins inhibit NADPH

oxidase-catalyzed superoxide formation by interfer-

ing with the translocation of Rac (ras-related C3

botulinum toxin substrate 1) from the cytosol to the

cell membrane [58, 63].

Cholesterol is a key component of caveolae, dis-

crete regions within the plasma membrane that coor-

dinate a variety of signaling processes [21, 44].

Caveolae contain a structural protein called caveolin,

which acts as a scaffolding protein organizing signal-

ing proteins and lipids in microdomains. One of the

best documented functions of caveolae in the cardio-

vascular system is the regulation of eNOS, which tar-

gets to endothelial caveolae via N-terminal myristoy-

lation and palmitoylation, and forms an inhibitory

complex with caveolin-1 (Cav-1), resulting in de-

pressed enzyme activity in resting cells [21]. Ca2+

mobilizing agents are thought to cause disinhibition

of eNOS by promoting Ca2+/calmodulin-triggered dis-

sociation of Cav-1. In support of this concept, eNOS

was found to become constitutively active upon ex-

perimental reduction of Cav-1 expression. This result

was apparent as hyporesponsiveness to vasoconstric-

tors and potentiated endothelium-dependent relaxa-

tion in Cav-1 knockout mice [48].

Transcription of the Cav-1 gene appears to be regu-

lated by cholesterol-responsive elements. Exposure of

fibroblasts [16] and endothelial cells [15] to free cho-

lesterol and low density lipoprotein cholesterol, re-

spectively, was found to up-regulate Cav-1 expres-

sion. Conversely, inhibition of cholesterol biosynthe-

sis by HMG-CoA reductase inhibitors was reported to

down-regulate Cav-1 in endothelial cells [45], sug-

gesting that the favorable effects of statins on vascular

function may partially be mediated by disruption of

the eNOS/Cav-1 complex. However, this proposal has

been questioned by others [47].

Statins appear to exhibit biphasic effects on angio-

genesis [60]. At nanomolar concentrations, the drugs

were found to enhance endothelial cell proliferation,

migration and differentiation, while higher concentra-

tions (> 0.1 µM) induced apoptosis [65]. In that study,

the anti- but not the proangiogenic effects of statins were

reversed by geranylgeranyl pyrophosphate. Together

with the finding that inhibitors of the RhoA/RhoA ki-

nase pathway, including statins, induce apoptosis in

human umbilical vein endothelial cells (HUVECs)

[37], these results suggested that the antiangiogenic

action of HMG-CoA reductase inhibitors is a conse-

quence of decreased isoprenylation of small GTPases,

whereas the proangiogenic effects occurring at low

therapeutic concentrations of the drugs may be medi-

ated independently of isoprenylation by activation of

eNOS either via the PI3/Akt kinase pathway [29] or

by reduced Cav-1 abundance [14].

Despite a bulk of literature on the beneficial cardio-

vascular effects of statins in vivo, comprehensive

studies with cultured endothelial cells are rare, and it

is still unclear whether eNOS activation does indeed

explain the improvement of vascular function ob-

served in vivo. The present study was designed to es-

tablish HUVECs as a cell culture model for the modu-

lation of endothelial function by statins. In particular,

we were interested in clarifying whether acute eNOS

�� 101

Statins and endothelial NO/cGMP signaling��

activation contributes to improved endothelial func-

tion and whether statin-triggered stimulation of NO

synthesis is affected by Cav-1 expression levels.

Materials and Methods

Materials

Fluvastatin (Flu) was obtained from Calbiochem, lo-

vastatin (Lov) from Merck, and cerivastatin (Cer)

from APIN Chemicals. The EZ4U kit was from Bio-

medica (Graz, Austria), and ChemiGlow detection

reagents were from Alpha Innotech (San Leandro,

USA). The SilencerTM siRNA Construction Kit was

from Ambion (Cambridgeshire, United Kingdom).

Magnetic plates were from Chemicell (Berlin, Ger-

many). The fluorosurfactant ZONYL® FSA and

25 kDa polyethyleneimine were from Sigma-Aldrich.

All other chemicals were purchased from Sigma (Vi-

enna, Austria), Amersham Biosciences (Vienna, Aus-

tria) or Biomedica (Graz, Austria).

Cell culture

HUVECs were isolated by dispase digestion from

normal umbilical cords according to a published pro-

tocol [24] and cultured in Medium 199 supplemented

with 15% fetal calf serum, penicillin/streptomycin

(100 units/ml), L-glutamine (2 mM), amphotericin B

(1.25 µg/ml), heparin (5,000 I.E./ml) and endothelial

cell growth factor (10 µg/ml). For transfection, cells

from passage 1 or 2 were used; for all other type of ex-

periments, cells from passage 1, 2, 3 or 4 were used.

Cells grown to confluence were incubated at 37°C for

24 h with the indicated concentrations of Flu, Lov or

Cer. Lov and MVA were activated as described [53].

Protein concentration was measured according to

Bradford [5], with bovine serum albumin as standard.

Construction of siRNA

Cav-1 double-stranded siRNA was designed using the

antisense sequence (AAGAGCUUCCUGAUUGAGAUU),

corresponding to nucleotides 403–423 of the coding

region of human Cav-1 (GenBankTM accession

number BC009685). The two Cav-1 primers (sense:

5´-AATCTCAATCAGGAAGCTCTTCCTGTCTC-3´

and antisense: 5´-AAGAGCTTCCTGATTGAGATT-

CCTGTCTC-3´) were used to synthesize specific

small interfering RNA (siRNA) according to the Am-

bion SilencerTM siRNA Construction kit (Part. Num-

ber AM 1620). GAPDH siRNA, supplied with the kit,

and a scrambled siRNA (sense sequence 5´-AACCA-

GUCGCAAACGCGACUGCCUGUCUC-3´) were used

as controls.

Magnetofection and cell transfection

HUVECs were transfected with Cav-1 double-

stranded siRNA using the magnetofection method de-

scribed previously [46], but with a novel type of mag-

netic nanoparticle equipped with a surface coating of

branched 25 kDa polyethyleneimine and the fluoro-

surfactant ZONYL® FSA [43]. The day before trans-

fection, endothelial cells were seeded at a density of

2 × 105 cells/well in 6-well plates. 24 h later, at a con-

fluency of 80–90%, the growth medium was removed

and 1.8 ml/well of serum-free medium was added. For

each well, 20 nM Cav-1 siRNA was complexed with

iron oxide nanoparticles (particles to siRNA ratio of

2:1; w/w) and with branched 25 kDa polyethyleni-

mine (N/P ratio of 10), then diluted to a final volume

of 200 µl with serum-free medium. The magnetofec-

tion mixture was left for 20 min at room temperature

and then added to the cells to give a final volume of 2

ml/well. For magnetofection, culture plates were

placed on magnetic plates for 20 min. The medium

was then removed and cultivation of the cells was

continued for a further 48 h, followed by incubation

with statins.

Preparation of cell homogenates and

subcellular fractions

Cells treated in the absence or presence of statins for

24 h were washed two times with phosphate-buffered

saline (PBS) and disrupted by treatment with trypsin

solution (0.05 % + 0.02 % ethylenediamine tetraacetic

acid). After centrifugation for 5 min at 1,000 rpm,

pellets were washed once with PBS and resuspended

in 50 mM triethanolamine/HCl buffer, pH 7.0, con-

taining 10 mM 2-mercaptoethanol, 0.5 mM ethylene-

diaminetetraacetic acid and 0.5 mM phenylmethylsul-

fonyl fluoride. Cell suspensions were homogenized

by three cycles of freeze-thawing. Cytosolic fractions

(~1 mg protein/ml) were obtained by centrifugation at

100,000 × g for 40 min. The pellet was washed once

102 ��

and then resuspended in triethanolamine/HCl buffer

at a protein concentration of ~3 mg/ml. All proce-

dures were carried out at 4°C. Protein fractions were

stored at –70°C until use.

Determination of eNOS activity in intact cells

NOS activity in intact cells was determined by the

formation of 3H-citrulline from 3H-arginine as previ-

ously described [55]. HUVECs pretreated with statins

for 24 h were incubated at 37°C in 1 ml of 50 mM

Tris buffer, pH 7.4, containing 100 mM NaCl, 5 mM

KCl, 3 mM CaCl2 and 1 mM MgCl2 in the presence

of 3H-arginine (~106 cpm), histamine (100 µM), and

NG-nitro-L-arginine (L-NNA) (0.3 mM), as indicated

in the text and figure legends. After 10 min, cells were

washed with 1 ml chilled nominally Ca2+-free incuba-

tion buffer before lysis in HCl (10 mM). After 1 h,

0.1 ml aliquots were removed for determination of in-

corporated radioactivity. Samples were adjusted to pH

5.0 with 0.2 M sodium acetate buffer, pH 13.0, con-

taining 10 mM L-citrulline. 3H-citrulline was sepa-

rated from 3H-arginine by cation exchange chroma-

tography [40].

Determination of eNOS activity in subcellular

fractions

NOS activity was determined by the formation of3H-citrulline from 3H-arginine. Samples (0.3–0.4 mg

of protein) were incubated for 1 h at 37°C in 0.1 ml of

50 mM triethanolamine/HCl buffer, pH 7.4, contain-

ing 10 µM L-arginine (~30,000 cpm), 0.5 mM CaCl2,

10 µg/ml calmodulin, 0.2 mM NADPH, 10 µM tetra-

hydrobiopterin (BH4), 5 µM FAD and 5 µM FMN,

and assayed for 3H-citrulline as described [35, 40].

Determination of cGMP accumulation

Following incubation for 30 min or 24 h in the pres-

ence of statins, HUVECs were equilibrated at 37°C in

50 mM Tris buffer, pH 7.4, containing 100 mM NaCl,

5 mM KCl, 3 mM CaCl2, 1 mM MgCl2, 1 mM 3-iso-

butyl-1-methylxanthine, and 10 µM indomethacin.

After 15 min, histamine was added to give a final con-

centration of 0.01 to 100 µM. Reactions were termi-

nated 10 min later by removal of the incubation buffer

and treatment for 1 h with 1 ml of 0.01 M HCl. Intra-

cellular cGMP was measured in the supernatants of

lysed cells by radioimmunoassay [56].

Determination of intracellular BH4 levels

Cells were assayed for intracellular BH4 levels as de-

scribed previously [28, 57]. For acidic and alkaline

oxidation, respectively, aliquots of cell homogenates

were mixed with either 1 M HCl and 0.1 M KI/I2 or

1 M NaOH and 0.1 M KI/I2. After incubation for 1 h,

the acidic and basic solutions were neutralized with

NaOH and HCl (1 M each), respectively, and excess

iodine was removed by addition of 0.2 M ascorbic

acid, followed by quantification of biopterin and

pterin by reversed-phase HPLC and fluorescence de-

tection. The amount of BH4 was calculated as the dif-

ference between the amount of biopterin formed upon

acidic oxidation (BH4 + 7,8-dihydrobiopterin) and the

amount of biopterin measured after alkaline oxidation

(derived from 7,8-dihydrobiopterin).

Immunoblotting

Proteins were separated by SDS-polyacrylamide gel

electrophoresis and transferred to nitrocellulose mem-

branes by electroblotting as described [20]. Proteins

were then subjected to immunodetection with anti-

eNOS or anti-Cav-1 (1:5,000 dilution) antibodies and

horseradish peroxidase-conjugated anti-rabbit IgG

(1:8,000 dilution) as the secondary antibody. Immu-

noreactive proteins were detected with the Chemi-

Glow detection reagents. The amount of eNOS was

quantified by densitometric analysis using recombi-

nant purified human eNOS [35] as standard.

Determination of lactate dehydrogenase (LDH)

release

To test for membrane integrity, cells were assayed for

release of LDH in the culture medium. Subsequent to

incubation of HUVECs with statins (0.1 to 10 µM) for

24 h, 20 µl aliquots of the culture media were mixed

with 200 µl of reagent buffer (1 mM pyruvate and

0.1 mM NADH+ in PBS). The decrease in light absor-

bance at 340 nm was monitored using a diode array

spectrophotometer (Hewlett Packard 8452A). Maxi-

mal LDH release was determined by treating the cells

with 10 % Triton X-100.

Determination of cell viability

Cell viability was assayed by MTT (3-(4,5-dimethyl-

thiazol-2-yl)-2,5-diphenyl tetrazolium bromide) re-

�� 103


duction using EZ4U kits. HUVECs grown to conflu-

ency in 96-well plates were incubated with statins

(0.1 to 10 µM each) in the absence and presence of

MVA (0.1 mM) or L-NNA (0.3 mM) for 24 h, fol-

lowed by replacement of the incubation medium with

200 µl of fresh medium containing 20 µl of MTT so-

lution, prepared according to the recommendations of

the company. After 2 h of incubation at 37°C, light

absorbance at 492 nm was measured in a microplate-

reader against a reference wavelength of 620 nm. Blank

values were measured under identical conditions in

the absence of cells. Data are expressed as percent of

MTT reduction by HUVECs treated with vehicle in-

stead of statins.

Data evaluation

All data are expressed as the means ± SE of the

number of experiments given in the text. EC50 values

were calculated from individual concentration-

response curves obtained by non-linear regression

analysis. Statistical significance was calculated by

ANOVA, followed by Fisher´s post-hoc test. Differences

among means were considered significant at p < 0.05.

Results

Effects of statins on the activity and expression

of eNOS in HUVECs

The activity of eNOS in intact HUVECs was assayed

by the conversion of 3H-arginine to 3H-citrulline upon

stimulation of the cells with 100 µM histamine.

Citrulline formation was very low and insensitive to

L-NNA in the absence of histamine (data not shown),

indicating that basal eNOS activity was below the de-

tection limit of the assay. As shown in Figure 1A,

3.43 ± 0.55 % (n = 4) of incorporated 3H-arginine was

converted to 3H-citrulline in the presence of hista-

mine, an effect that was blocked by 0.3 mM L-NNA.

The statins tested (Flu, Lov, and Cer, 1 µM each) had

no detectable effect on arginine conversion in the ab-

sence of histamine, but increased the response to his-

tamine around 2.6-fold (9–10 % conversion). Again,

citrulline formation was reduced to blank levels in the

presence of L-NNA, indicating that the increase in3H-arginine-to-3H-citrulline conversion was due to

a statin-triggered increase in eNOS activity. Addition-

ally, the effect of the statins was found to be concen-

tration dependent. Figure 1B shows the concentration-

response curve for Cer, which increased 3H-arginine-

104 ��

Fig. 1. Effects of statins on eNOS activity in intact cells and subcellu-lar fractions. (A) HUVECs grown in 6-well plates were incubated for24 h with Flu, Lov and Cer (1 µM each) and then stimulated with hista-mine (100 µM) for 10 min in the absence or presence of L-NNA(300 µM). This was followed by determination of eNOS activity by theconversion of �H-arginine to �H-citrulline. Data are expressed as per-cent of incorporated �H-arginine converted to �H-citrulline (mean val-ues ± SE; n = 4). (B) HUVECs grown in 6-well plates were incubatedfor 24 h with Cer at the indicated concentrations and then stimulatedwith histamine (100 µM) for 10 min, followed by determination ofeNOS activity by the conversion of �H-arginine to �H-citrulline. Dataare expressed as percent of incorporated �H-arginine converted to�H-citrulline (mean values ± SE; n = 3). (C) Crude homogenates,soluble fractions and insoluble fractions (40 µl each) of HUVECs in-cubated for 24 h in the absence or presence of Flu, Lov and Cer(1 µM each) were assayed for �H-citrulline formation in the presenceof saturating substrate and cofactor concentrations, as described inMaterials and Methods. Data are expressed as specific enzyme ac-tivity (mean values ± SE; n = 4)

to-3H-citrulline conversion with an EC50 of 13.8 ± 2.0 nM

(n = 3). While Flu exhibited similarly high potency

(EC50 51.1 ± 17.0 nM), Lov was one order of magni-

tude less potent (EC50 416 ± 83.3 nM; curves not

shown).

The effect on eNOS activity was also apparent in

subcellular fractions of HUVECs. Maximal citrulline

formation was 0.76 ± 0.12 pmol min–1 mg–1 in crude

homogenates. As expected, eNOS activity was en-

riched in membrane fractions, which exhibited about

a 4-fold higher specific activity than the soluble frac-

tions. As shown in Figure 1C, subcellular fractions of

statin-treated cells exhibited about 3-fold higher

eNOS activity than the controls (2.06 ± 0.3, 2.21 ± 0.29

and 2.33 ± 0.48 pmol min–1 mg–1 in homogenates ob-

tained from cells treated with Flu, Lov, and Cer, re-

spectively; n = 4, each). The effects of the statins were

similar in soluble and insoluble fractions, suggesting

that the drugs do not affect the subcellular distribution

of the enzyme.

Aliquots from the same samples were subjected to

quantitative immunoblotting using purified recombi-

nant eNOS as standard. According to the data shown

in Figure 2, crude homogenates contained 6.6 ± 0.8 ng

of eNOS per mg of total protein. Incubation of HU-

VECs with statins (1 µM each) resulted in ~2.5-fold

increases in eNOS expression (16.1 ± 1.7, 15.5 ± 1.6,

and 17.5 ± 6.6 ng/mg in the presence of Flu, Lov, and

Cer, respectively; n = 5). As observed in the activity

measurements, the statins had no apparent effect on

the subcellular distribution of eNOS. The effect of the

drugs was completely inhibited when MVA (100 µM)

was present during the 24 h incubation period (data

not shown).

Effects of statins on cGMP accumulation and

intracellular BH4 levels

Increased eNOS activity is not necessarily associated

with increased NO bioavailability, in particular under

conditions of oxidative stress. Moreover, the 3H-arginine-

to-3H-citrulline conversion assay does not always re-

veal the correct rate of endothelial NO synthesis, as it

is strictly dependent on the presence of extracellular

arginine [54], despite the presence of sufficient cellu-

lar arginine to sustain NO synthesis from endogenous

substrates [10]. Taking into account this well known

�� 105


Fig. 2. Effects of statins on eNOS protein expression. Crude ho-mogenates (80 µg of protein), as well as soluble and insoluble frac-tions (50 µg of protein each), of HUVECs incubated for 24 h in the ab-sence or presence of Flu, Lov and Cer (1 µM each) were subjected toquantitative immunoblotting with an eNOS antibody. Purified recom-binant human eNOS (50 ng) was used as the protein standard. Immu-noreactive bands were quantified by densitometric analysis. Dataare expressed as ng of eNOS per mg of applied protein (mean values± SE; n = 5)

Fig. 3. Effects of statins on endothelial cGMP accumulation.(A) HUVECs grown in 24-well plates were incubated for 24 h with Flu,Lov and Cer (1 µM each), followed by stimulation with increasingconcentrations of histamine (0–100 µM). Intracellular cGMP levelswere then determined by radioimmunoassay, as described in Mate-rial and Methods. Data are expressed as pmol cGMP per mg of totalcellular protein (mean values ± SE; n = 5). (B) HUVECs grown in24-well plates were incubated for 30 min with Cer (50 nM–10 µM) inthe absence and presence of 0.3 mM L-NNA, followed by determina-tion of intracellular cGMP levels by radioimmunoassay, as describedin Material and Methods. Data are expressed as pmol cGMP per mgof total cellular protein (mean values ± SE; n = 3)

“arginine paradox”, we measured intracellular accu-

mulation of cGMP as an established highly sensitive

and specific indicator of NO bioactivity. As shown in

Figure 3A, histamine induced a concentration-dependent,

and more than 10-fold, increase in intracellular cGMP

with an EC50 of 0.58 ± 0.01 µM (n = 5). In the pres-

ence of Flu, Lov, and Cer, basal cGMP levels were in-

creased from 1.02 ± 0.24 to 1.78 ± 0.20, 1.70 ± 0.17,

and 2.63 ± 0.39 pmol cGMP/mg of protein, respec-

tively. Likewise, the presence of statins increased

histamine-stimulated cGMP levels about 3-fold. The

drugs did not significantly affect the potency of the

agonist, however. The acute effects of statins on

eNOS activity were assayed by L-NNA-sensitive ac-

cumulation of cGMP in HUVECs treated for 30 min

with Cer, which caused the most pronounced long-

term effect of the three statins tested. cGMP accumu-

lation was not significantly affected by short-term in-

cubation with up to 10 µM Cer (Fig. 3B).

Intracellular BH4 levels limit eNOS activity in cul-

tured HUVECs [66], suggesting that statins may in-

duce expression of partially uncoupled enzyme, and

consequent superoxide/peroxynitrite formation. How-

ever, it has been reported that Cer-triggered eNOS

overexpression in HUVECs is associated with in-

creased transcription of the GTP cyclohydrolase I gene

and consequent increases in cellular BH4 [23]. We con-

firmed this finding under our experimental conditions

by measuring intracellular BH4 levels in HUVECs

treated for 24 h with Flu, Lov, and Cer (1 µM each).

The BH4 content of the cell homogenates was 0.93 ±

0.32 pmol/mg protein in control cells and 2.35 ± 0.05,

2.03 ± 0.13, and 1.8 ± 0.18 pmol/mg protein (n = 3,

each) in cells that had been treated with Flu, Lov and

Cer, respectively. These values are virtually identical

to those published by Hattori et al. [23].

Effects of statins on membrane integrity and

cell viability

It is well established that statins induce apoptosis in

a variety of cell types including HUVECs [4, 13, 37].

Under our experimental conditions, incubation of

HUVECs for 24 h with statins (0.1–10 µM) did not

affect membrane integrity (� 2% of LDH release; data

not shown) but caused a marked, concentration-

dependent mitochondrial dysfunction measured by

MTT reduction. As shown in Figure 4, MTT activity

was reduced to 30–50% of controls by all three statins

tested in an MVA-sensitive manner (n = 8, each). The

potency of Cer was considerably higher (maximal

toxicity at ~1 µM) than that of Flu and Lov, which

showed maximal effects at about 5 and 10 µM,

respectively. Cytotoxicity of Flu and Lov, as well as

0.1 µM Cer, was significantly enhanced in the pres-

ence of L-NNA (0.3 mM), indicating that activation

of eNOS counteracts the cytotoxic and presumably

proapoptotic effects of the drugs.

106 ��

Fig. 4. Effects of statins on cell viability. Cell viability was assayed byMTT reductase activity. Cells were grown in 96-well plates and incu-bated for 24 h with Flu (A), Lov (B) and Cer (C) (0.1 to 10 µM each) inthe absence (open circles) or presence (filled circles) of MVA (100 µM)or L-NNA (300 µM; squares), followed by spectroscopic determina-tion of MTT reduction, as described in Materials and Methods. Dataare expressed as percent of controls incubated in the absence ofstatins (mean values ± SE; n = 6; * p < 0.05 of controls vs. L-NNA)

Effects of statins on the activity and expression

of eNOS in HUVECcav-1(–/–)

Transfection of HUVECs with Cav-1 siRNA for 48 h

caused a reduction of Cav-1 expression levels to 21.8

± 4.3% of controls (n = 6). A representative immunoblot

is shown in Figure 5. In the following, these cells are

designated as HUVECcav-1(–/–). Figure 6A shows that

knockdown of Cav-1 caused a marked increase in

histamine-stimulated eNOS activity measured as con-

version of 3H-arginine to 3H-citrulline in intact cells

(from 3.45 ± 0.84 to 8.55 ± 1.17% conversion). In the

presence of statins, eNOS activity was further in-

creased about 1.6-fold (14.88 ± 2.27, 14.20 ± 0.85,

and 13.67 ± 1.65% conversion in the presence of Flu,

Lov and Cer, respectively). Note that the degree of

stimulation of eNOS activity triggered by the statins was

clearly less pronounced in HUVECcav-1(–/–) cells than in

control cells (1.6- vs. 2.6-fold increase in 3H-arginine-

to-3H-citrulline conversion; cf. Fig. 1A and 6A).

As shown in Figure 6B, the disinhibition of eNOS

by Cav-1 downregulation was also apparent when

maximal enzyme activity was measured in cell ho-

mogenates, even though the activity assays were per-

formed in the presence of high Ca2+ (0.5 mM) and 50-

to 100-fold molar excess of calmodulin over eNOS

(10 µg of calmodulin per ml corresponding to 0.62 µM

based on a molecular mass of 16 kDa). The ~1.8-fold

increases in maximal eNOS activity observed in ho-

mogenates of statin-treated cells agreed well with the

effects of the drugs in intact cells. Knockdown of

Cav-1 did not affect the expression levels of eNOS

measured by immunoblotting of crude homogenates

(7.7 ± 2.2 ng/mg of protein; n = 3). As shown in Fig-

ure 6C, eNOS expression was increased 3.1-fold upon

treatment of the cells with Flu, Lov, and Cer (22.8 ±

1.2, 24.7 ± 2.1 and 23.3 ± 2.3 ng/mg of protein, re-

�� 107


Fig. 5. Downregulation of Cav-1 expression by siRNA transfection ofHUVECs. HUVECs were transfected with either 20 nM Cav-1 orscrambled siRNA for 48 h, followed by cell lysis and immunoblottingof the homogenates (10 µg of protein) using a Cav-1 antibody. Bandintensities were analyzed by densitometric analysis. Shown is an im-munoblot representative of the 6 cell transfections

Fig. 6. Effect of statins on eNOS activity and expression in HU-VEC��

��. (A) Wild-type HUVECs and HUVEC�� grown in

6-well plates were incubated for 24 h with Flu, Lov, or Cer (1 µMeach), and then stimulated with histamine (100 µM) for 10 min. Thistreatment was followed by determination of eNOS activity by the con-version of �H-arginine to �H-citrulline. Data are expressed as percentof incorporated �H-arginine converted to �H-citrulline (mean values± SE; n = 3). (B) Crude homogenates of wild-type HUVECs and HU-VEC��

�� (40 µl each) that had been incubated for 24 h in the ab-sence or presence of Flu, Lov and Cer (1 µM each) were assayed for�H-citrulline formation in the presence of saturating substrate and co-factor concentrations, as described in Materials and Methods. Dataare expressed as specific enzyme activity (mean values ± SE; n = 3).(C) Crude homogenates (10 µg of protein) of HUVEC��

��, whichhad been incubated for 24 h in the absence or presence of Flu, Lovand Cer (1 µM each), were subjected to quantitative immunoblottingwith an eNOS antibody. Purified recombinant human eNOS (50 ng)was used as the protein standard. Immunoreactive bands werequantified by densitometric analysis. Data are expressed as ng ofeNOS per mg of applied protein (mean values ± SE; n = 3)

spectively), as compared to 2.5-fold increases of ex-

pression levels in control cells (cf. Fig. 2). Treatment

of untransfected HUVECs for 24 h with up to 1 µM

Cer did not affect the expression level of Cav-1 in

crude homogenates (n = 2; data not shown).

The data on specific L-citrulline formation by

crude homogenates, and the amount of eNOS protein

present in the same samples, enabled us to estimate

the “true” activity of eNOS in control cells and HU-

VECcav-1(–/–) cells incubated with and without statins.

As shown in Table 1, this activity was 115 nmol/min

and mg of eNOS in homogenates obtained from un-

treated control cells. The three statins tested slightly,

but consistently, increased this value up to 143 nmol/

min and mg eNOS (1.13- to 1.24-fold; see Tab. 1).

Knockdown of Cav-1 led to a calculated eNOS activ-

ity of 766 nmol/min and mg eNOS in homogenates

from untreated cells. Interestingly, the statins de-

creased the “true” eNOS activity of HUVECcav-1(–/–)

homogenates down to 420 nmol/min and mg eNOS.

Overall, the calculated eNOS activity in cell ho-

mogenates agreed very well with the specific activity

of eNOS purified from various tissues and expression

systems (see [35] and references therein).

Discussion

The most prominent effect of all three statins tested

was the increase in eNOS protein expression and ac-

tivity that occurred with EC50 values of 14 (Cer) to

400 (Lov) nM, and was fully prevented by incubation

in the presence of MVA. At about 10-fold higher con-

centrations, the statins caused a decrease in cell vi-

ability apparent as an MVA-sensitive decrease in

MTT reductase activity, suggesting that the drugs af-

fected mitochondrial function. Reduction of MTT ac-

tivity does not necessarily reflect apoptosis, but in

combination with full membrane integrity (indicated

by lack of significant LDH release), our observations

strongly suggested that the statins caused apoptosis of

the endothelial cells, as has been reported previously

[60, 62, 65]. Similarly to its effects on endothelial NO

synthesis, Cer was the most potent compound in

terms of cytotoxicity. The high incidence of severe

rhabdomyolysis associated with Cer therapy, particu-

larly in combination with fibrates, had led to world-

wide withdrawal of Cer from the market [18]. Though

it is tempting to speculate that this adverse effect is re-

lated to the high pro-apoptotic potency of Cer as com-

pared to other statins, mitochondrial injury does not

appear to be the major cause of skeletal myopathy

[51].

Interestingly, we found that the cytotoxic effects of

Flu and Lov, and that of the lowest concentration of

Cer (0.1 µM), were significantly potentiated by L-

NNA, indicating that increased eNOS activity par-

tially counteracts statin-triggered mitochondrial dys-

function. Protection by NO against apoptotic cell

death is well established and may involve inactivation

of caspases or increased expression of antiapoptotic

proteins, including Bcl-2 and heme oxygenase [9, 27].

Both eNOS overexpresssion and cytotoxicity have

been attributed to inhibition of RhoA isoprenylation,

resulting in enhanced eNOS mRNA stability [34] and

apoptotic cell death [25, 37]. Since both statin-

induced eNOS overexpression and cytotoxicity were

prevented by co-incubation with MVA, but occurred

at significantly different concentrations of the drugs,

the two processes may be triggered by a common ini-

tial mechanism that affects different signaling cas-

cades downstream of protein isoprenylation.

Three different experimental protocols revealed

that the eNOS protein overexpressed in response to

statins was functionally active. Intact HUVECs

stimulated with histamine exhibited 2.6-fold higher

rates of 3H-arginine-to-3H-citrulline conversion if in-

cubated for 24 h in the presence of statins. The effect

on citrulline formation was accompanied by increased

accumulation of intracellular cGMP, a sensitive and

highly specific indicator of NO bioactivity. While the3H-arginine-to-3H-citrulline conversion assay was not

sensitive enough to detect eNOS activity in non-

stimulated cells, determination of cGMP revealed sig-

nificantly increased NO formation in HUVECs

treated with statins in the absence of histamine. Fi-

nally, maximal enzyme activity, measured by the for-

mation of citrulline in crude homogenates in excess of

substrates and cofactors, was increased approximately

3-fold. Determination of eNOS protein content and

enzyme activity in soluble and insoluble fractions did

not reveal significant re-distribution of eNOS be-

tween these cell compartments.

In patients, therapeutic statin plasma levels are be-

tween 2 and 200 nM (see [65] and references therein),

i.e., in the same range as the concentrations causing

eNOS overexpression in HUVECs, indicating that the

effects observed in the cell culture model may at least

108 ��

partially explain the therapeutic improvement of en-

dothelial function in atherosclerosis. The proangio-

genic effects observed with statins at nanomolar con-

centrations were suggested to be due to rapid

isoprenylation-independent eNOS activation, possibly

via PI3/Akt kinase-mediated phosphorylation of the

enzyme [22, 29]. Although it has been reported that

activation of eNOS in cultured bovine aortic endothe-

lial cells occurs upon incubation with statins for

15–60 min, there is no published evidence that this ef-

fect takes place at concentrations below 1 µM [22,

29]. In the present study we did not observe signifi-

cant eNOS activation, as measured by the accumula-

tion of cGMP after 30 min of incubation of HUVECs

with up to 10 µM cer, the drug that caused the most

pronounced long-term effects among the statins tested.

The discrepancy between our results and earlier stud-

ies may be explained by cell type- or drug-specific ef-

fects. Previous studies reporting acute eNOS activa-

tion were performed with bovine aortic endothelial

cells, with other statins (simvastatin in [29] and pita-

vastatin in [58]) or very high drug concentrations

(e.g., 10 µM in [22]).

The pronounced increase in cellular BH4 may be

critical for expression of functional eNOS in response

to statins, and contribute to the protective effects of

the drugs. BH4 is essential for NO biosynthesis in en-

dothelial cells [57], limits eNOS activity in HUVECs

[66], prevents eNOS uncoupling [2, 3], and acts as

a superoxide scavenger [61] and antioxidant, protect-

ing blood vessels from oxidative stress [26]. Numer-

ous clinical studies have demonstrated the beneficial

effects of BH4 in endothelial dysfunction [36]. Our

present data, demonstrating about a 2-fold increase in

BH4 levels in statin-treated HUVECs, are in excellent

agreement with a previous study reporting on in-

creased expression levels of GTP cyclohydrolase I,

the rate-limiting enzyme of BH4 biosynthesis, in re-

sponse to statins [23]. Interestingly, the authors found

that the statins did not affect GTP cyclohydrolase I

mRNA stability, but increased the rate of gene tran-

scription, indicating the involvement of a molecular

mechanism distinct from that causing stabilization of

eNOS mRNA.

Current evidence suggests that eNOS forms an in-

hibitory complex with Cav-1 that becomes disrupted

by Ca2+/calmodulin binding in response to Ca2+ mo-

bilizing agonists [21]. To test this concept under our

experimental conditions, and to study the potential

link between Cav-1 levels and statin-triggered eNOS

activation, we aimed to artificially decrease Cav-1 ex-

pression levels using the siRNA technique. A number

of protocols successfully applied to other cell types

turned out to be unsuitable for efficient siRNA trans-

fection of HUVECs (Meda C. and Mayer B., unpub-

lished). Eventually, the magnetofection method de-

scribed previously [46] proved to be highly efficient

(~80% decrease in Cav-1 levels) and sufficiently re-

producible (variation coefficient ~20%). In previous

studies, Cav-1 expression has been artificially de-

creased by transfection with antisense RNA [49, 67]

or gene deletion in mice [11, 48]. The siRNA method

described here may prove useful for future studies on

the role of Cav-1 and caveolae in endothelial mem-

brane biology and cellular signaling.

In line with the current concept of eNOS inhibition

by endogenous Cav-1, 3H-arginine-to-3H-citrulline

conversion was markedly increased in histamine-

stimulated HUVECcav-1(–/–). Unexpectedly, this in-

crease in eNOS activity was also apparent when

citrulline formation was assayed in cell homogenates

in the presence of excess Ca2+/calmodulin. These data

suggest that either a relatively large pool of Cav-1 be-

comes accessible to eNOS binding upon cell homog-

enization, or that Cav-1 dissociates only slowly from

eNOS, even in the presence of excess calmodulin.

While Cav-1 knockdown slightly increased the effects

of statins on eNOS expression levels (3.1- vs. 2.5-

fold), the response to the drugs in terms of eNOS ac-

tivity was clearly less pronounced in HUVECcav-1(–/–)

than in control cells (1.6 vs. 2.6 and 1.8 vs. 2.5-fold

when measured in intact cells and homogenates, re-

spectively). This difference in the response of two cell

types became even clearer when the “true” activity of

eNOS in the cell homogenates, i.e., L-citrulline for-

mation per min and mg of eNOS protein, was calcu-

�� 109


Tab. 1. Activity of eNOS in homogenates of HUVECs andHUVEC��

��. The actual activity of eNOS in crude homogenatesobtained from control cells and HUVEC��

�� cells that had beentreated for 24 h with either vehicle (control) or statins (1 µM each) wascalculated from the specific L-citrulline formation and the amount ofeNOS protein in homogenates shown in Figure 6. Data are given asnmol L-citrulline per min and mg of eNOS

HUVECs Fold HUVEC�� Fold

Control 115 – 766 –

Flu 128 1.13 518 0.68

Lov 143 1.24 471 0.61

Cer 133 1.16 420 0.55

lated. According to the calculated data shown in Table

1, the statins caused a decrease in the activity of the

caveolin-unbound form of the enzyme. Under condi-

tions of normal caveolin expression, this effect is ap-

parently overcome by an increase in eNOS activity

due to disruption of the inhibitory eNOS/Cav-1 com-

plex. Feron et al. [14] reported that incubation of bo-

vine aortic endothelial cells with up to 1 µM atorvas-

tatin led to a dramatic decrease in Cav-1 expression,

resulting in a 1.5-fold increase in eNOS activity. Un-

der our experimental conditions, however, Cav-1 ex-

pression in HUVECs was not affected at up to 10 µM

cer, suggesting that the statins promoted either disso-

ciation of eNOS or translocation of Cav-1, rather than

reducing caveolin expression levels in human endo-

thelial cells. Further studies are warranted to clarify

the mechanisms underlying the statin-triggered de-

crease in activity of caveolin-unbound eNOS and the

effects of the drugs on the eNOS/Cav-1 interaction.

In summary, the present study investigated the ef-

fects of three different statins and demonstrated that

this class of drugs caused pronounced up-regulation

of eNOS expression without having acute effects on

eNOS activity. As revealed by the significantly in-

creased accumulation of intracellular cGMP in re-

sponse to histamine, statin-induced eNOS overexpres-

sion resulted in increased synthesis and bioavailabil-

ity of endothelium-derived NO and was accompanied

by increased cellular levels of the eNOS cofactor

BH4. Considering that BH4 protects blood vessels

against oxidative stress-related endothelial dysfunc-

tion [17], both effects may contribute to the well

documented beneficial effects of statins in cardiovas-

cular disease.

Acknowledgments:

We thank Margit Rehn for excellent technical assistance. This work

was supported by the Fonds zur Förderung der Wissenschaftlichen

Forschung in Austria (SFB F30 Lipotox, B.M.).

References:

1. Bauersachs J, Widder, JD: Endothelial dysfunction in

heart failure. Pharmacol Rep, 2008, 60, 119–126.

2. Bendall JK, Alp NJ, Warrick N, Cai S, Adlam D, Rock-

ett K, Yokoyama M et al.: Stoichiometric relationships

between endothelial tetrahydrobiopterin, endothelial NO

synthase (eNOS) activity, and eNOS coupling in vivo:

insights from transgenic mice with endothelial-targeted

GTP cyclohydrolase 1 and eNOS overexpression. Circ

Res, 2005, 97, 864–871.

3. Bevers LM, Braam B, Post JA, van Zonneveld AJ,

Rabelink TJ, Koomans HA, Verhaar MC, Joles JA:

Tetrahydrobiopterin, but not L-arginine, decreases NO

synthase uncoupling in cells expressing high levels of

endothelial NO synthase. Hypertension, 2006, 47, 87–94.

4. Blanco-Colio LM, Villa A, Ortego M, Hernandez-Presa

MA, Pascual A, Plaza JJ, Egido J: 3-Hydroxy-3-methyl-

glutaryl coenzyme A reductase inhibitors, atorvastatin

and simvastatin, induce apoptosis of vascular smooth

muscle cells by downregulation of Bcl-2 expression and

Rho A prenylation. Atherosclerosis, 2002, 161, 17–26.

5. Bradford MM: A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing

the principle of protein-dye binding. Anal Biochem,

1976, 72, 248–254.

6. Brevetti G, Schiano V, Chiariello M: Endothelial dys-

function: A key to the pathophysiology and natural his-

tory of peripheral arterial disease? Atherosclerosis, 2008,

197, 1–11.

7. Brocq ML, Leslie SJ, Milliken P, Megson IL: Endothe-

lial dysfunction: From molecular mechanisms to meas-

urement, clinical implications, and therapeutic opportu-

nities. Antiox Redox Signal, 2008, 10, 1631–1673.

8. Brouet A, Sonveaux P, Dessy C, Moniotte S, Balligand

JL, Feron O: Hsp90 and caveolin are key targets for the

proangiogenic nitric oxide-mediated effects of statins.

Circ Res, 2001, 89, 866–873.

9. Brüne B: The intimate relation between nitric oxide and

superoxide in apoptosis and cell survival. Antiox Redox

Signal, 2005, 7, 497–507.

10. Closs EI, Scheld JS, Sharafi M, Förstermann U: Sub-

strate supply for nitric-oxide synthase in macrophages

and endothelial cells: Role of cationic amino acid trans-

porters. Mol Pharmacol, 2000, 57, 68–74.

11. Drab M, Verkade P, Elger M, Kasper M, Lohn M,

Lauterbach B, Menne J et al.: Loss of caveolae, vascular

dysfunction, and pulmonary defects in caveolin-1 gene-

disrupted mice. Science, 2001, 293, 2449–2452.

12. Endres M, Laufs U: Effects of statins on endothelium

and signaling mechanisms. Stroke, 2004, 35, 2708–2711.

13. Feng C, Ye C, Liu X, Ma H, Li M: 4 integrin is involved

in statin-induced endothelial cell death. Biochem Bio-

phys Res Commun, 2004, 323, 858–864.

14. Feron O, Dessy C, Desager JP, Balligand JL: Hydroxy-

methylglutaryl-coenzyme A reductase inhibition pro-

motes endothelial nitric oxide synthase activation

through a decrease in caveolin abundance. Circulation,

2001, 103, 113–118.

15. Feron O, Dessy C, Moniotte S, Desager JP, Balligand JL:

Hypercholesterolemia decreases nitric oxide production

by promoting the interaction of caveolin and endothelial

nitric oxide synthase. J Clin Invest, 1999, 103, 897–905.

16. Fielding CJ, Bist A, Fielding PE: Caveolin mRNA levels

are up-regulated by free cholesterol and down-regulated

by oxysterols in fibroblast monolayers. Proc Natl Acad

Sci USA, 1997, 94, 3753–3758.

17. Förstermann U: Janus-faced role of endothelial NO syn-

thase in vascular disease: Uncoupling of oxygen reduc-

110 ��

tion from NO synthesis and its pharmacological reversal.

Biol Chem, 2006, 387, 1521–1533.

18. Furberg CD, Pitt B: Withdrawal of cerivastatin from

the world market. Curr Control Trials Cardiovasc Med,

2001, 2, 205–207.

19. Goldstein JL, Brown MS: Regulation of the mevalonate

pathway. Nature, 1990, 343, 425–430.

20. Golser R, Gorren ACF, Leber A, Andrew P, Habisch HJ,

Werner ER, Schmidt K et al.: Interaction of endothelial

and neuronal nitric-oxide syntheses with the bradykinin

B2 receptor – Binding of an inhibitory peptide to the

oxygenase domain blocks uncoupled NADPH oxidation.

J Biol Chem, 2000, 275, 5291–5296.

21. Gratton JP, Bernatchez P, Sessa WC: Caveolae and

caveolins in the cardiovascular system. Circ Res, 2004,

94, 1408–1417.

22. Harris MB, Blackstone MA, Sood SG, Li C, Goolsby

JM, Venema VJ, Kemp BE, Venema RC: Acute activa-

tion and phosphorylation of endothelial nitric oxide syn-

thase by HMG-CoA reductase inhibitors. Am J Physiol,

2004, 287, H560–H566.

23. Hattori Y, Nakanishi N, Akimoto K, Yoshida M, Kasai

K: HMG-CoA reductase inhibitor increases GTP cyclo-

hydrolase I mRNA and tetrahydrobiopterin in vascular

endothelial cells. Arterioscler Thromb Vasc Biol, 2003,

23, 176–182.

24. Jaffe EA, Nachman RL, Becker CG, Minick CR: Culture

of human endothelial cells derived from umbilical veins.

Identification by morphologic and immunologic criteria.

J Clin Invest, 1973, 52, 2745–2756.

25. Kaneta S, Satoh K, Kano S, Kanda M, Ichihara K: All

hydrophobic HMG-CoA reductase inhibitors induce

apoptotic death in rat pulmonary vein endothelial cells.

Atherosclerosis, 2003, 170, 237–243.

26. Kase H, Hashikabe Y, Uchida K, Nakanishi N, Hattori Y:

Supplementation with tetrahydrobiopterin prevents the

cardiovascular effects of angiotensin II-induced oxidative

and nitrosative stress. J Hypertens, 2005, 23, 1375–1382.

27. Kim YM, Bombeck CA, Billiar TR: Nitric oxide as a bi-

functional regulator of apoptosis. Circ Res, 1999, 84,

253–256.

28. Klatt P, Schmidt K, Werner ER, Mayer B: Determination

of nitric oxide synthase cofactors: Heme, FAD, FMN,

and tetrahydrobiopterin. Methods Enzymol, 1996, 268,

358–365.

29. Kureishi Y, Luo Z, Shiojima I, Bialik A, Fulton D, Lefer

DJ, Sessa WC, Walsh K: The HMG-CoA reductase in-

hibitor simvastatin activates the protein kinase Akt and

promotes angiogenesis in normocholesterolemic animals.

Nature Med, 2000, 6, 1004–1010.

30. Lahera V, Goicoechea M, de Vinuesa SG, Miana M, de

las Heras N, Cachofeiro V, Luño J: Endothelial dysfunc-

tion, oxidative stress and inflammation in atherosclero-

sis: Beneficial effects of statins. Curr Med Chem, 2007,

14, 243–248.

31. Laufs U, Endres M, Stagliano N, Amin-Hanjani S, Chui

DS, Yang SX, Simoncini T et al.: Neuroprotection medi-

ated by changes in the endothelial actin cytoskeleton.

J Clin Invest, 2000, 106, 15–24.

32. Laufs U, LaFata V, Plutzky J, Liao JK: Upregulation of

endothelial nitric oxide synthase by HMG CoA reductase

inhibitors. Circulation, 1998, 97, 1129–1135.

33. Laufs U, Liao JK: Direct vascular effects of HMG-CoA

reductase inhibitors. Trends Cardiovasc Med, 2000, 10,

143–148.

34. Laufs U, Liao JK: Post-transcriptional regulation of en-

dothelial nitric oxide synthase mRNA stability by Rho

GTPase. J Biol Chem, 1998, 273, 24266–24271.

35. Leber A, Hemmens B, Klösch B, Goessler W, Raber G,

Mayer B, Schmidt K: Characterization of recombinant

human endothelial nitric oxide synthase purified from

the yeast Pichia pastoris. J Biol Chem, 1999, 274,

37658–37664.

36. Li H, Förstermann U: Nitric oxide in the pathogenesis

of vascular disease. J Pathol, 2000, 190, 244–254.

37. Li X, Liu L, Tupper JC, Bannerman DD, Winn RK,

Sebti SM, Hamilton AD, Harlan JM: Inhibition of pro-

tein geranylgeranylation and RhoA/RhoA kinase path-

way induces apoptosis in human endothelial cells. J Biol

Chem, 2002, 277, 15309–15316.

38. Maltese WA: Posttranslational modification of proteins

by isoprenoids in mammalian cells. FASEB J, 1990, 4,

3319–3328.

39. Maron DJ, Fazio S, Linton MF: Current perspectives on

statins. Circulation, 2000, 101, 207–213.

40. Mayer B, Klatt P, Werner ER, Schmidt K: Molecular

mechanism of inhibition of porcine brain nitric oxide

synthase by the antinociceptive drug 7-nitroindazole.

Neuropharmacology, 1994, 33, 1253–1259.

41. Moncada S, Higgs EA: The discovery of nitric oxide and

its role in vascular biology. Br J Pharmacol, 2006, 147

Suppl. 1, S193–S201.

42. Münzel T, Sinning C, Post F, Warnholtz A, Schulz E:

Pathophysiology, diagnosis and prognostic implications

of endothelial dysfunction. Ann Med, 2008, 40,

180–196.

43. Mykhaylyk O, Vlaskou D, Tresilwised N, Pithayanukul

P, Möller W, Plank C: Magnetic nanoparticle formula-

tions for DNA and siRNA delivery. J Magnet Magn Mat,

2007, 311, 275–281.

44. Patel HH, Murray F, Insel PA: Caveolae as organizers of

pharmacologically relevant signal transduction mole-

cules. Annu Rev Pharmacol Toxicol, 2008, 48, 359–391.

45. Pelat M, Dessy C, Massion P, Desager JP, Feron O, Bal-

ligand JL: Rosuvastatin decreases caveolin-1 and im-

proves nitric oxide-dependent heart rate and blood pres-

sure variability in apolipoprotein E�� mice in vivo.

Circulation, 2003, 107, 2480–2486.

46. Plank C, Schillinger U, Scherer F, Bergemann C, Remy

JS, Krotz F, Anton M et al.: The magnetofection method:

using magnetic force to enhance gene delivery. Biol

Chem, 2003, 384, 737–734.

47. Plenz GA, Hofnagel O, Robenek H: Differential modula-

tion of caveolin-1 expression in cells of the vasculature

by statins. Circulation, 2004, 109, e7–e8.

48. Razani B, Engelman JA, Wang XB, Schubert W, Zhang

XL, Marks CB, Macaluso F et al.: Caveolin-1 null mice

are viable but show evidence of hyperproliferative and

vascular abnormalities. J Biol Chem, 2001, 276,

38121–38138.

�� 111


49. Razani B, Schlegel A, Liu J, Lisanti MP: Caveolin-1,

a putative tumour suppressor gene. Biochem Soc Trans,

2001, 29, 494–499.

50. Rikitake Y, Liao JK: Rho GTPases, statins, and nitric ox-

ide. Circ Res, 2005, 97, 1232–1235.

51. Schaefer WH, Lawrence JW, Loughlin AF, Stoffregen

DA, Mixson LA, Dean DC, Raab CE et al.: Evaluation

of ubiquinone concentration and mitochondrial function

relative to cerivastatin-induced skeletal myopathy in rats.

Toxicol Appl Pharmacol, 2004, 194, 10–23.

52. Schäfer A, Bauersachs J: Endothelial dysfunction, im-

paired endogenous platelet inhibition and platelet activa-

tion in diabetes and atherosclerosis. Curr Vasc Pharma-

col, 2008, 6, 52–60.

53. Schmidt A, Goepfert C, Feitsma K, Buddecke E:

Lovastatin-stimulated superinduction of E-selectin,

ICAM-1 and VCAM-1 in TNF-� activated human vascu-

lar endothelial cells. Atherosclerosis, 2002, 164, 57–64.

54. Schmidt K, Klatt P, Mayer B: Characterization of endo-

thelial cell amino acid transport systems involved in the

actions of nitric oxide synthase inhibitors. Mol Pharma-

col, 1993, 44, 615–621.

55. Schmidt K, Mayer B.: Assay of tissue activity of nitric

oxide synthase. In: Current Protocols in Toxicology, Eds.

Maines M, Costa L, Reed D Sassa S, John Wiley & Sons

Inc., New York, 1999.

56. Schmidt K, Mayer B, Kukovetz WR: Effect of calcium

on endothelium-derived relaxing factor formation and

cGMP levels in endothelial cells. Eur J Pharmacol, 1989,

170, 157–166.

57. Schmidt K, Werner ER, Mayer B, Wachter H, Kukovetz

WR: Tetrahydrobiopterin-dependent formation of

endothelium-derived relaxing factor (nitric oxide) in aor-

tic endothelial cells. Biochem J, 1992, 281, 297–300.

58. Shinozaki K, Nishio Y, Ayajiki K, Yoshida Y, Masada M,

Kashiwagi A, Okamura T: Pitavastatin restores vascular

dysfunction in insulin-resistant state by inhibiting

NAD(P)H oxidase activity and uncoupled endothelial ni-

tric oxide synthase-dependent superoxide production.

J Cardiovasc Pharmacol, 2007, 49, 122–130.

59. Simonsen U, Rodriguez-Rodriguez R, Dalsgaard T, Buus

NK, Stankevicius E: Novel approaches to improving

endothelium-dependent nitric oxide-mediated vasodilata-

tion. Pharmacol Rep, 2009, 61, 105–115.

60. Urbich C, Dernbach E, Zeiher AM, Dimmeler S:

Double-edged role of statins in angiogenesis signaling.

Circ Res, 2002, 90, 737–744.

61. Vasquez-Vivar J, Whitsett J, Martasek P, Hogg N, Kaly-

anaraman B: Reaction of tetrahydrobiopterin with super-

oxide: EPR-kinetic analysis and characterization of the pte-

ridine radical. Free Radic Biol Med, 2001, 31, 975–985.

62. Vincent L, Soria C, Mirshahi F, Opolon P, Mishal Z,

Vannier JP, Soria J, Hong L: Cerivastatin, an inhibitor of

3-hydroxy-3-methylglutaryl coenzyme A reductase, in-

hibits endothelial cell proliferation induced by angio-

genic factors in vitro and angiogenesis in in vivo models.

Arterioscler Thromb Vasc Biol, 2002, 22, 623–629.

63. Wagner AH, Kohler T, Ruckschloss U, Just I, Hecker M:

Improvement of nitric oxide-dependent vasodilatation by

HMG-CoA reductase inhibitors through attenuation of

endothelial superoxide anion formation. Arterioscler

Thromb Vasc Biol, 2000, 20, 61–69.

64. Wang J, Xu Z, Kitajima I, Wang Z: Effects of different

statins on endothelial nitric oxide synthase and AKT

phosphorylation in endothelial cells. Int J Cardiol, 2008,

127, 33–39.

65. Weis M, Heeschen C, Glassford AJ, Cooke JP: Statins

have biphasic effects on angiogenesis. Circulation, 2002,

105, 739–745.

66. Werner-Felmayer G, Werner ER, Fuchs D, Hausen A,

Reibnegger G, Schmidt K, Weiss G, Wachter H: Pte-

ridine biosynthesis in human endothelial cells. Impact on

nitric oxide-mediated formation of cyclic GMP. J Biol

Chem, 1993, 268, 1842–1846.

67. Zhao YY, Liu Y, Stan RV, Fan L, Gu Y, Dalton N, Chu

PH et al.: Defects in caveolin-1 cause dilated cardiomyo-

pathy and pulmonary hypertension in knockout mice.

Proc Natl Acad Sci USA, 2002, 99, 11375–11380.

Received:

March 26, 2009; in revised form: January 22, 2010.

112 ��

Effects of statins on nitric oxide/cGMP signaling in...

Documents

Transcript of Effects of statins on nitric oxide/cGMP signaling in...