Effects of oxylipin on pathogen infection,...

Effects of oxylipin on pathogen

infection, physiological active

substances and aroma volatile synthesis

in grapes

January 2016

Wang Shanshan

Graduate School of Horticulture

CHIBA UNIVERSITY

（千葉大学学位申請論文）

ブドウの病原菌感染、生理活性物質お

よび香気成分合成に及ぼす

オキシリピンの影響

２０１６年１月

千葉大学大学院園芸研究科環境園芸専攻生物資源科学コース

王珊珊

i

TABLE OF CONTENTS

List of abbreviations .................................................................................................... v

Chapter 1 General introduction and literature review ................................................. 1

1.1 General introduction ...................................................................................... 2

1.2 Literature review ............................................................................................ 7

1.2.1 Basic pathology of anthracnose disease .............................................. 7

1.2.2 Schematic of grape berry growth and development ........................... 8

1.2.3 Plant hormones and fungal defense .................................................. 11

1.2.3 Aroma volatiles biosynthestic pathways and enzymes ..................... 17

1.2.4 Aroma volatiles and fungal defense .................................................. 22

1.2.6 Retrospect of PDJ application ........................................................... 23

1.2.7 Retrospect of KODA application ...................................................... 23

Chapter 2 Jasmonate application influences endogenous abscisic acid, jasmonic acid

and aroma volatiles in grape berries infected by a pathogen (Glomerella cingulata) 25

2.1 Introduction .................................................................................................. 26

2.2 Materials and methods ................................................................................. 28

2.2.1 Plant material .................................................................................... 28

2.2.2 Fungal strain, culture, and inoculation .............................................. 29

2.2.3 Quantitative analysis of ABA and PA .............................................. 30

2.2.4 Jasmonic acid analysis ...................................................................... 30

ii

2.2.5 Volatile compound analysis .............................................................. 31

2.2.6 Measurement of O2− radical-scavenging activity ............................. 32

2.2.7 RNA extraction, cDNA synthesis, and quantitative real-Time

RT-PCR analysis ........................................................................................ 33

2.2.8 Statistical analysis ............................................................................. 35

2.3 Results .......................................................................................................... 36

2.3.1. Lesion diameter ................................................................................ 36

2.3.2. Endogenous abscisic acid (ABA), phaseic acid (PA) and expression

Of VvNCED1 And VvCYP707A1 .............................................................. 37

2.3.3 Endogenous jasmonic acid (JA), ethylene production, and the

changes in the O2-radical scavenging activities ......................................... 37

2.3.4 Aroma volatiles ................................................................................. 41

2.4 Discussion .................................................................................................... 45

Chapter 3 α-Ketol linolenic acid (KODA) application affects endogenous abscisic

acid, jasmonic acid, and aroma volatiles in grape berries infected by a pathogen

(Glomerella cingulata) .............................................................................................. 49

3.1 Introduction .................................................................................................. 50

3.2 Materials and methods ................................................................................. 53

3.2.1. Plant material ................................................................................... 53

3.2.2. Fungal strain, culture, and inoculation. ............................................ 54

3.2.3 Quantitative analysis of ABA and PA .............................................. 54

iii

3.2.4 Jasmonic acid analysis ...................................................................... 55

3.2.5. Volatile compound analysis ............................................................. 55

3.2.6 Measurement of O2− radical-scavenging activity ............................. 55

3.2.7 RNA extraction, cDNA synthesis, and quantitative real-Time

RT-PCR analysis ........................................................................................ 55

3.2.8 Statistical analysis ............................................................................. 57

3.3 Results .......................................................................................................... 58

3.3.1. Lesion diameter ................................................................................ 58

3.3.2. Endogenous abscisic acid (ABA), phaseic acid (PA) and expression

Of VvNCED1 And VvCYP707A1 .............................................................. 59

3.3.3 Endogenous jasmonic acid (JA), expression of VvLOX and VvAOS,

ethylene production, and the changes in the O2− radical scavenging

activities ..................................................................................................... 59

3.3.4 Aroma volatiles ................................................................................. 64

3.4 Discussion .................................................................................................... 66

Chapter 3 General conclusion ............................................................................. 71

Summary ............................................................................................................. 75

Acknowlegement ................................................................................................. 77

Referemces .......................................................................................................... 79

List of abbreviations

iv

LIST OF ABBREVIATIONS

GA gibberellic acid

ABA abscisic acid

PA phaseic acid

JA jasmonic acid

SA salicylic acid

G. cingulate Glomerella cingulata

ET ethylene

CK cytokinin

LOX lipoxygenase

MeJA Methyl Jasmonate

PDJ n-propyl dihydrojasmonate

KODA 9,10-ketol-octadecadienoic acid

Q-PCR quantative-PCR

AOS allene oxide synthase

AOC allene oxide cyclase

OPDA cis (+)-12-oxophytodienoic acid

◦C degree Celsius


v

µg microgram

µL microliter

µM micromolar

% percentage

DAFB days after full bloom

et al. et. alli (Latin), and others

GC-MS gas chromatography-mass spectrometry

g gram

h hour

HPLC high performance liquid chromatography

L liter

M Molar

mg milligram

mm millimeter

min minute

mL milliter

mM millimolar

m/s mass/charge ratio

nm nanometer

pH power of hydrogen ion


vi

RNA ribonucleic acid

rpm revolution per minute

sec second

SIM selected ion montoring

v/v volume by volume

w/v weight by volume

BHT butylated hydroxytoluene

KI Kovats Index

Chapter 1 General introduction and literature review

1

CHAPTER 1

GENERAL INTRODUCTION AND LITERATURE

REVIEW


2

1.1 GENERAL INTRODUCTION

Plant hormones act as a crucial role in controlling growth and development

of plants. The plant hormones such as auxin, cytokinin (CK), gibberellic acid (GA),

abscisic acid (ABA), jasmonic acid (JA), and ethylene (ET) can regulate cell division,

expansion and differentiation and so on (Tuteja and Sopory 2008). These effects can

be highly complex, with a single cell responding to multiple hormones and a single

hormone having differential effects on distinct tissues (Spartz and Gray, 2008).

Plants undergo continuous exposure to various biotic and abiotic stresses in

their natural environment. In response to microbial attack, plants stimulate a complex

series of responses that lead to the local and systemic induction of a broad spectrum

of antimicrobial defenses (Hammond-Kosack et al., 1996). The fungi Glomerella

cingulata has been associated with diseases in a wide range of host plants, and it can

infect fruits, flowers, leaves, and other non-lignified tissue (Weir et al., 2012). It is

well-known to cause anthracnose disease (ripe rot) on grapes and apples, which leads

to commercial losses annually (Southworth, 1981). Infections occurring before

veraison typically remain “dormant” until fruit begin to ripen in development of

grapes.

Recently, many progresses, including the cloning and characterization of

plant disease resistance genes that govern the recognition of specific pathogen strains,


3

have been made (Dangl and Jones, 2001; Staskawicz, 2001). The identification of

components are involved in the signal transduction pathways coupling pathogen

recognition to the activation of defense responses (Glazebrook, 2001; Feys and

Parker, 2000), and the demonstration that three endogenous plant signaling

molecules, salicylic acid (SA), JA, and ethylene, are involved in plant defense (Dong,

1998; Thomma, 2001). In addition, many other hormones, including ABA, GA, auxin,

and CK, have been shown to differentially affect Arabidopsis resistance against

biotroph and necrotroph by feeding into the SA-JA-ET cascades (Robert-Seilaniantz

et al., 2007, 2011).

Plants could have interaction with their environment by emitting volatile

organic compounds. Aroma volatile emissions influenced by pathogen inoculation

could be correlated with the ethylene production in Japanese apricot (Prunus mume

Sieb.) (Nimitkeatkai et al., 2011), and also varied by inoculation of fungus in

‘Mclntosh’ apple (Malus domestica Borkh.) (Vikram et al., 2004). From the aspect of

chemical characterization, volatiles can be classified as esters, alcohols, aldehydes,

ketones, lactones, and terpenoids (Hadi et al., 2013). Among these compounds,

C6-volatiles derived from the lipoxygenase (LOX) pathway, which including

C6-aldehydes and C6-alcohols act as a wound signal in plants, but result in a

moderate plant response relative to Methyl Jasmonate (MeJA) at both the

physiological and molecular level in Arabidopsis (ecotype Columbia) (Bate and


4

Rothstein, 1998). Many interactions of plants with pathogens also can depend on the

quantity and identity of terpenoids produced by plants (Bohlmann et al., 1998).

Jasmonic acid derivative, n-propyl dihydrojasmonate (PDJ) have been

applied for fruit thinning on Japanese pear ‘Hosui’ (Pyrus pyriforia Nakai), aroma

volatiles biosynthesis and accumulation of anthocyanidin in apple (Malus domestica

Borkh.), and decreased the lesion diameter on climacteric fruit Japanese apricot

(Prunus mume Sieb.) (Kondo and Mattheis, 2006; Kondo et al., 2000; Ohkawa et al.,

2006). However, there is not any cue on the relationship of PDJ treatment and fungus

defense in non-climacteric fruit grape. Moreover, complex crosstalk of plant

hormones involved in resistance system in grapes is also unclear.

α-Ketol linolenic acid (KODA): [9,10-ketol-octadecadienoic acid or

9-hydroxy-10-oxo-12(Z), 15(Z)-octadecadienoic acid] was identified as a

stress-induced substance in duckweed (Lemna paucicostata) (Yokoyama et al., 2000).

In oxylipin pathway, both KODA and JA are metabolized via LOX and allene oxide

synthase (AOS), known as AOS pathway (Yamaguchi et al., 2001; Creelman and

Mullet, 1997).


5

Fig. 1.1. The pathway for KODA and JA biosynthesis in higher plants (Kitticorn et

al., 2010)

(JA)


6

The objective of this study is to investigate the roles of PDJ and KODA on

resistance to fungus pathogen in grapes as follows:

1) Effects of PDJ and KODA application on lesion caused by fungus

inoculation.

2) Analysis of ABA, PA, JA, aroma volatiles and antioxidant activity after

inoculation and treatment.

3) Investigation of the interaction among JA, ABA, and aroma volatiles on

plant resistance to pathogen.

4) To detect the influences of PDJ and KODA treatments on the key genes

involved in biosynthetic pathways of plant hormones.


7

1.2 LITERATURE REVIEW

1.2.1 Basic pathology of anthracnose disease

Anthracnose disease, usually called ripe rot, is a disease that occurs on

ripening berries or near harvest (Christensen et al., 1890). The disease can be a

particularly devastating disease of muscadine grapes at warm and humid weather,

and its pathogen also causes fruit rots on series of other fruit and vegetable crops.

Circular, uniformly brown lesions develop on ripening fruit and eventually cover the

entire berry. Tiny black fruiting bodies form in the diseased tissue and exude masses

of salmon-colored to pink spores. Once the entire berry is rotted, it may drop to the

ground or remain on the vine as a mummy. Ripe rot is caused by the fungus

Glomerella cingulata (asexual stage: Colletotrichum gloeosporioides). This fungus

overwinters in fruit mummies and infected fruit stems. Spores (conidia) are released

in the spring and spread via splashing or blowing rain. While infections can occur at

any time, even when the fruit is still immature, decay does not begin until the fruit

ripens. Abundant conidia are produced on rotting fruit and spread to other ripe fruit.

Heavy losses can occur when frequent rains, coupled with warm temperatures, occur

during harvest. Although fungicides used early in the season may be effective for

limiting the damage caused with anthracnose. In view of characteristic of the

pathogen, condition in fruit ripening is usually favorable for ripe rot. Therefore,


8

application of fungicides should be deliberated.

1.2.2 Schematic of grape berry growth and development

Anthesis

Flower opening, commonly referred to as anthesis or bloom, occurs when

the calyptra detaches from the flower base and is shed, exposing the stamens and

pistil (Christensen and Andris, 1983). Anthesis normally occurs 6 to 8 weeks after

the commencement of shoot growth, depending on climatic conditions. Anthesis

proceeds rapidly when temperatures range between 29°C and 35°C.

Pollination and fertilization

Immediately after anthesis, the anthers split open and release their pollen

grains (Hardie et al., 1996). Grape varieties with hermaphroditic flowers are

considered self-pollinating, and the activity of insects or the presence of wind is

believed to be unnecessary for pollination. Pollination is complete once the pollen

has reached the stigma. If environmental conditions are favorable, the pollen grains

germinate and form pollen tubes. Fertilization occurs when sperm reaches and

impregnates the eggs within the embryo sacs. Under normal field conditions,

fertilization typically occurs two to three days after pollination. Temperature is an

important factor controlling germination and pollen tube growth. Optimum

temperatures for both germination and pollen tube growth range between 26.7°C and


9

32.2°C, and both processes are greatly reduced or even inhibited when temperatures

fall below 15.6°C or rise above 37.8°C.

Fruit set

In grapes, fruit set is defined as the stage when the berry diameter is

between 1⁄16 and 1⁄8 inch (1.6 and 3.2 mm) (Coombe, 1976; Lavee and Nir, 1986).

There are two other fruit set mechanisms, however, that allow seedless or seemingly

seedless berries to form. The first mechanism, parthenocarpy, is the only method by

which truly seedless berries are produced. The second mechanism, stenospermocarpy,

results in the formation of berries that appear to be seedless but are not. Several other

factors influence seed trace development, including the vine’s rootstock and year,

also climatic factors have a significant effect on fruit set.

Grape Berry Growth

Following fruit set, the grape flower ovary develops and advances through

three distinct stages of development during their growth (Harris et al., 1968; Pratt,

1971) (Fig. 1.2):

Stage I: the first phase of rapid berry growth. A period of rapid berry

growth begins cell division and enlargement immediately after bloom. Berry is firm,

while its color is green due to the presence of chlorophyll. The sugar concentrations

of the berry are low, while organic acids are high.


10

Fig. 1.2. Diagram to indicate berry and colour development measured at 10 day

intervals from just after flowering. The times when other components start to

accumulate, as well as the flow of xyleme and phloem juice in the berry, are

indicated (Kennedy, 2002).


11

Stage II: the lag phase of berry growth. Berry growth slows markedly

during the second period while the berries’ organic acid concentration reaches its

highest level. Berries are still firm, but begin to lose chlorophyll.

Stage III: the phase of rapid berry growth and fruit ripening. The

resumption of rapid berry growth and initiation of ripening commences with the

beginning of this stage (Coombe and Bishop, 1980; Uhlig and Clingeleffer, 1998).

The term berry softening (in French, veráison), which characterizes the initial stages

of color development, is commonly used to describe the striking changes in fruit

characteristics that mark the beginning of stage III. Berries soften and lose

chlorophyll, while red pigments begin to accumulate in the skin in colored varieties.

Sugar also begins to accumulate, and the concentration of organic acids declines.

Aroma and flavor components accumulate in the fruit. Berry growth during this stage

is limited to cell enlargement, and normally lasts between 6 and 8 weeks.

1.2.3 Plant hormones and fungal defense

Plant growth and response to environmental cues are largely governed by

plant hormones. The plant hormones ethylene, JA, and SA play a central role in the

regulation of plant immune responses. In addition, other plant hormones, such as

auxins, ABA, CK, GA, and brassinosteroids, that have been thoroughly described to

regulate plant development and growth, have recently emerged as key regulators of


12

plant immunity. Plant hormones interact in complex networks to balance the

response to developmental and environmental cues and thus limiting defense

associated fitness costs. The molecular mechanisms that govern these hormonal

networks are largely unknown. Moreover, hormone-signaling pathways are targeted

by pathogens to disturb and evade plant defense responses.

Jasmonic acid

JA is an important signalling molecule for the activation of defence in

response to wounding, herbivores and pathogen attack (Rosahl and Feussner, 2004).

It is synthesized from α-linolenic acid by enzymes of the lipoxygenase pathway

(Feussner and Wasternack, 2002). Linolenic acid liberated from chloroplast

membranes, putatively by phospho-/galactolipases, is oxygenated by

plastid-localized 13-lipoxygenases to 13-hydroperoxyoctadecatrienoic acid, which

serves as a substrate for a number of cytochrome P450 enzymes. One of these, allene

oxide synthase (AOS), catalyzes the conversion of 13-hydroperoxyoctadecatrienoic

acid to an unstable epoxide, allene oxide, which is subsequently cyclized by allene

oxide cyclase (AOC) to cis (+)-12-oxophytodienoic acid (OPDA).

OPDA is also found in a membrane-bound form as sn1-O-(12-

oxophytodienoyl)-sn2-O-(hexadecatrienoyl)-monogalactosyl-diglyceride (Stelmach

et al., 2001). Further enzymatic conversions take place in the peroxisome, to which

OPDA is translocated. OPDA reductase (OPR3) reduces the double bond of the


13

cyclopentenone, leading to the formation of 12-oxophytoenoic acid. In the

peroxisome, three rounds of beta-oxidation are required to synthesize JA. Then JA

can in turn be converted to the volatile ester, MeJA, by the enzyme jasmonic acid

carboxyl methyltransferase (Song et al., 2005). A new type of peroxisomal

acyl-coenzyme A synthetase was identified in A. thaliana which is capable of

catalyzing the synthesis of the CoA ester of OPDA, as well as of

3-oxopentenyl-cyclopentane-hexanoic acid (Schneider et al., 2005). The

wound-inducible acyl-CoA oxidase gene ACX1 from Arabidopsis was shown to be

required for JA-dependent responses (Cruz Castillo et al 2004). Recombinant ACX1A,

encoded by a gene identified from a JA-deficient tomato mutant, is indeed able to

catalyze the first step in the β-oxidative chain shortening of 12-oxophytoenoic acid

(Li et al., 2005). Multifunctional proteins which possess 2-trans-enoyl-CoA

hydratase and 3-hydroxy-acyl-CoA dehydrogenase activities, as well as a 3-ketoacyl-

CoA thiolase are responsible for the β-oxidation steps (Afitlhile et al., 2005). Finally,

a thioesterase is presumably involved in the release of jasmonic acid from its CoA

ester. Mutants defective specifically in the JA biosynthetic pathway were reported

for the AOS and OPR3 genes of Arabidopsis. The AOS mutants dde2

(delayed-dehiscence; von Malek et al., 2002) and aos (Park et al., 2002) were unable

to accumulate JA in response to wounding; however, only a little on aos mutants and

their response to microbial pathogens are available especially in fruits so far.


14

Ethylene

Introduction ET is a gaseous plant hormone that affects myriad

developmental processes and fitness responses, including germination, flower and

leaf senescence, fruit ripening, leaf abscission, root nodulation, programmed cell

death, and responsiveness to stress and pathogen attack (Bleecker and Kende, 2000;

Johnson and Ecker, 1998). Host-derived ET has been hypothesized to be an

important signal for disease development. Previous studies have shown a correlation

between the timing of increased ethylene evolution in response to pathogen

infections and the development of chlorotic and wilting symptoms in many plant

species (Goto et al., 1980; Pegg, 1981), including tomato (Gentile and Matta, 1975).

The accumulation and increasedactivities ofthe ET biosynthetic enzymes

1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase have

been localized to chlorotic tissue directly surrounding primary lesions in tobacco

leaves in response to tobacco mosaic virus (De Laat and Van Loon, 1983) and

Phytophthora infestans (Spanu and Boller, 1989) infections. The localized activities

of ET biosynthetic enzymes in tissues surrounding primary lesions suggest that host

ET production may be a response to the cell death that occurs during primary lesion

formation. Bent et al. (1992) were the first to use a genetic approach to determine

whether ethylene perception plays a causal role in foliar disease development. This

finding of a critical function for the downstream ET signal transduction element


15

EIN2 in the regulation of disease development is not easily reconciled with the

relative lack of importance of ETR1, the ethylene receptor. He concluded that either

EIN2 is a critical component of additional pathogen response pathways or the ein2-1

allele is much stronger than is the etr1-3 allele in reducing ET sensitivity.

Salicylic acid

SA was identified as a crucial signaling molecule required for the

expression of plant defence responses. Transgenic Arabidopsis and tobacco plants

that cannot accumulate SA due to the expression of the bacterial NahG gene

encoding a salicylate hydroxylase, are hyper-susceptible to virulent pathogens,

unable to mount systemic acquired resistance, and impaired, although not completely

compromised, in race-cultivar-specific resistance (Delaney et al., 1994; Rairdan and

Delaney, 2002). SA is also required for the hypersensitive cell death response, which

is usually associated with resistance (Alvarez, 2000). Salicylic acid signalling

proceeds via the ankyrin repeat-containing protein NPR1, encoded by the NON

EXPRESSOR OF PR1 gene, which was identified in mutant screens of Arabidopsis

(Cao et al., 1994). NPR1 is present in the cytoplasm, presumably as an oligomer, and

responds to pathogen-induced alterations in the cellular redox state by translocating

to the nucleus in its monomeric form (Fobert and Despres, 2005). In Arabidopsis,

pathogen-induced salicylic acid accumulation requires de novo biosynthesis via the

isochorismate pathway, since mutants compromised in SA accumulation carry a


16

defective gene for isochorismate synthase (Wildermuth et al., 2001). On the other

hand, labelling studies in tobacco revealed that SA is also produced via the

phenylpropanoid pathway from phenylalanine, cinnamic acid, and benzoic acid, or

conjugates thereof (Ribnicky et al., 1998). In potato, these compounds were also

shown to be precursors for salicylic acid synthesis in untreated plants; however, after

elicitor treatment, SA accumulated that was not derived from phenylalanine (Coquoz

et al., 1998), suggesting that here, as in Arabidopsis, pathogen or elicitor-induced

accumulation of SA involves synthesis via an alternative, possibly the isochorismate

pathway.

Abscisic acid

ABA concentrations in grape berries increase just before véraison;

therefore, ABA may be a signal of ripening in grape berries (Coombe and Hale,

1973). ABA is involved in the regulation of many aspects of plant growth and

development including seed germination, embryo maturation, leaf senescence,

stomatal aperture and adaptation to environmental stresses (Wasilewskaa et al. 2008).

In ABA biosynthesis in higher plants, the 9-cis-epoxycarotenoid dioxygenase

(NCED) is a key enzyme that cleaves 11, 12 double bonds of C40 carotenoids and

produces xanthoxin (Qin and Zeevaart, 1999). Subsequently, ABA is primarily

catabolized to form 8′-hydroxy ABA by hydroxylation with ABA 8′-hydroxylase,

and then isomerizes to phaseic acid (PA) (Nambara and Marion-Poll, 2005).


17

Several recent papers have reported that ABA plays important roles in

plant defence responses (Adie et al. 2007; de Torres-Zabala et al. 2007; Mauch-Mani

and Mauch 2005; Mohr and Cahill 2007). However, the role of ABA in plant defence

appears to be more complex, and vary among different types of plant-pathogen

interactions. Yasuda et al. (2008) reported that ABA treatment suppressed SAR

induction indicating that there is an antagonistic interaction between SAR and ABA

signaling in Arabidopsis, however, the role of ABA as a positive regulator of defence

has also been reported (Mauch-Mani and Mauch 2005). ABA activates stomatal

closure that acts as a barrier against bacterial infection (Melotto et al. 2006). These

results demonstrate that ABA is not a positive regulator of plant defence against all

necrotrophs and its role depends on individual plant pathogen interactions.

1.2.3 Aroma volatiles biosynthestic Pathways and enzymes

Plants are able to emit volatile organic compounds and the content and

composition of these molecules show both genotypic variation and phenotypic

plasticity (Maffei, 2010). Various types of fresh fruits produce distinct volatile

profiles. Fruit volatile compounds are mainly comprised of diverse classes of

chemicals, including esters, alcohols, aldehydes, ketones, lactones, and terpenoids

(Goff and Klee, 2006). Grape (Vitis vinifera L.) volatiles include a great number of

compounds, among which monoterpenes, C13-norisoprenoids, alcohols, esters and


18

carbonyls are found (Dieguez et al., 2003)

Since volatiles are comprised of at least five chemical classes, there are

several pathways involved in volatile biosynthesis. Volatiles important for aroma and

flavor are biosynthesized from membrane lipids, amino acids and carbohydrates

(Sanz et al.,1997).

Fatty acids pathway

Fatty acids are major precursors of aroma volatiles in most fruit (Sanz et

al.,1997). Fatty acid-derived straight-chain alcohols, aldehydes, ketones, acids, esters

and lactones ranging from C1 to C20 are important character-impact aroma

compounds that are responsible for fresh fruit flavors with high concentrations, and

are basically formed by three processes: α-oxidation, β-oxidation and the

lipoxygenase (LOX) pathway (Schwab and Schreier, 2002). Aroma volatiles in intact

fruit are formed via the β-oxidation biosynthetic pathway, whereas when fruit tissue

is disrupted, volatiles are formed via the LOX pathway (Schreier, 1984). Many of the

aliphatic esters, alcohols, acids, and carbonyls found in fruits are derived from the

oxidative degradation of linoleic and linolenic acids (Reineccius, 2006). In addition,

some of the volatile compounds derived from enzyme-catalyzed oxidative

breakdown of unsaturated fatty acids may also be produce by autoxidation

(Chan, 1987). Autoxidation of linoleic acid produces 9,13-hydroperoxides, whereas

linolenic acid also produces 12,16-hydroperoxides (Berger, 2007). Hexanal and


19

2,4-decadienal are the primary oxidation products of linoleic acid, while autoxidation

of linolenic acid produces 2,4-heptadienal as the major product. Further autoxidation

of these aldehydes leads to the formation of other volatile products (Chan, 1987).

Lipoxygenase (LOX)

The metabolism of polyunsaturated fatty acids, via the first LOX-catalyzed

step and the subsequent reactions, is commonly known as the LOX pathway.

Saturated and unsaturated volatile C6 and C9 aldehydes and alcohols are important

contributors to the characteristic flavors of fruits, vegetables and green leaves. The

short-chain aldehydes and alcohols are produced by plants in response to wounding

and play an important role in the plants defense strategies and pest resistance (Matsui,

2006; Stumpe and Feussner, 2006). At least four enzymes are involved in the

biosynthetic pathway leading to their formation: LOX, hydroperoxide lyase (HPL),

3(Z), 2(E)-enal isomerase and ADH. When fruit are homogenised, linoleic and

linolenic acid are oxidised to various C6 and C9 aldehydes (Lea, 1995). In intact fruit,

enzymes in the LOX pathway and their substrates have different subcellular

locations, preventing formation of volatile compounds (Chan, 1987). During ripening,

cell walls and membranes may become more permeable, allowing the LOX pathway

to become active without tissue disruption. The LOX biosynthetic pathway has the

potential to provide substrates for ester production (De Pooter et al., 1983). If the

LOX biosynthetic pathway were active during ripening, it would act as an alternative


20

to β-oxidation of fatty acids. As shown in Fig 1.3, volatile fatty acid derivatives such

as trans-2-hexenal, cis-3-hexenol and MeJA are derived from C18 unsaturated fatty

acids including linoleic acid or linolenic acid, which undergo dioxygenation in a

reaction catalyzed by LOX (Feussner and Wasternack, 2002). These enzymes can

catalyze the oxygenation of polyenoic fatty acids at C9 or C13 positions yielding two

groups of compounds, the 9-hydroperoxy and the 13-hydroperoxy derivatives of

polyenoic fatty acids. These derivatives can be further metabolized by an array of

enzymes, including AOS and HPL, which represent two branches of the LOX

pathway yielding volatile compounds. In the AOS branch of the LOX pathway,

13-hydroxyperoxy linolenic acid is converted to 12,13-epoxyoctadecatrienoic acid

by AOS. A series of subsequent enzymatic reactions leads to the formation of JA,

which can in turn be converted to the volatile ester, MeJA, by the enzyme jasmonic

acid carboxyl methyltransferase (Song et al., 2005). In the HPL branch of the LOX

pathway, the oxidative cleavage of hydroperoxy fatty acids through the action of

HPL leads to the formation of short chain C6 or C9 volatile aldehydes (e.g., 3-hexenal

or 3,6-nonadienal) and the corresponding C12 or C9 ω-fatty acids (e.g.,

12-oxo-dodecenoic acid or 9-oxononanoic acid). HPL C6 aldehyde products can be

further converted to their isomers by spontaneous rearrangement by alkenal

isomerases, or reduced to alcohols by the action of ADH (Akacha et al., 2005).


21

Fig 1.3. Linolenic acid-derived flavor molecules. AAT, alcohol acyl CoA transferase;

ADH, alcohol dehydrogenase; AER, alkenal oxidoreductase; AOC, allene oxide

cyclase; AOS, allene oxide synthase; HPL, hydroperoxide lyase; JMT, jasmonate

methyltransferase; LOX, lipoxygenase; OPR, 12-oxo-phytodienoic acid reductase;

3Z,2E-EI, 3Z,2E-enal isomerase (El Hadi et al., 2013).


22

1.2.4 Aroma volatiles and fungal defense

C6 compounds and fungal defense

In aroma volatiles, green leaves volatiles consist of a family of C6

compounds, including aldehydes, alcohols and esters, originate in the HPL branch of

the oxylipin pathway (Matsui, 2006). They are almost ubiquitously made by green

plants and increased release can be caused by herbivores (Fall et al., 1999) or

pathogens (Heden et al., 2003). Exogenous application of E-2-hexenal or

Z-3-hexenal to Arabidopsis plants induces the expression of VSP1 and AOS, showed

that C6 compounds may activating the accumulation of JA (Kishimoto et al., 2006).

Terpenoids and fungal defense

Recent work has shown that the octadecanoid molecule, methyl

jasmonate (MeJA), plays a substantial role in the induction of TPS genes

located terpenoid synthases and in defense-related changes in terpenoid

biochemistry and anatomy in spruce (Franceschi et al., 2002; Fa’ldt et al.,

2003; Martin et al., 2002). For example, while sapling trees emitted mainly

monoterpene hydrocarbons on a constitutive basis, the MeJA-induced tissues

released large amounts of oxygenated monoterpenes, e.g., linalool, and

sesquiterpenes, e.g., farnesene and bisabolene, which implied the interaction

of terpenoid and JA pathway (Martin et al., 2003).


23

1.2.6 Retrospect of PDJ application

Over decade, the synthetic analogue of MeJA: n-propyl dihydrojasmonate

(PDJ) were widely applied in many aspects on growth and development of fruits,

such as, thinning effect on Japanese pear (Pyrus pyrifolia var. culta. ) (Ohkawa et al.,

2006), promoting ripening by inducing ACC synthase gene ACS1 gene in ethylene

pathway (Kondo et al., 2007), increasing the production of esters (butyl propanoate,

butyl butyrate, and propyl butyrate) and of anthocyanin in apple (Malus sylvestris L.

Mill. var. domestica Borkh. Mansf.) by treating at pre-climacteric stage (Kondo and

Mattheis, 2006), decreasing the injury of pathogen Colletotrichum gloeosporioides in

climacteric fruit Japanese apricot (Prunus mume Sieb.), regulating the development

and growth of peach (Prunus persica L. Batsch) (Ziosi et al., 2008).

1.2.7 Retrospect of KODA application

α-Ketol linolenic acid (KODA): [9,10-ketol-octadecadienoic acid or

9-hydroxy-10-oxo-12(Z), 15(Z)-octadecadienoic acid] was identified as a


KODA is formed from 9-hydroperoxy-10(E), 12(Z), 15(Z)-octadecatrienoic acid

(9-HPOT) generated from linolenic acid via 9-lipoxygenase (9-LOX) (Vick and

Zimmerman 1987). KODA reacted as a flower-inducing compound in violet

(Pharbitis nil), carnation (Dianthus caryophyllus L.), and apple (Malus domestica


24

Borkh.) (Suzuki et al., 2003; Yokoyama et al., 2005; Kittikorn et al., 2010). In the

interaction with JA in biosynthesis pathway, KODA are assumed to be involved with

resistance against invasion of pathogen.

Chapter 2 Jasmonate application influences endogenous abscisic acid, jasmonic acid and aroma

volatiles in grapes infected by a pathogen (Glomerella cingulata)

25

CHAPTER 2

JASMONATE APPLICATION INFLUENCES

ENDOGENOUS ABSCISIC ACID, JASMONIC ACID，

AND AROMA VOLATILES IN GRAPES INFECTED BY

A PATHOGEN (GLOMERELLA CINGULATA)



26

2.1 INTRODUCTION

Fungal disease spoils the quality of fruits and vegetables. G. cingulata is a

plant pathogenic fungus that causes disease in different hosts and anthracnose in

many fruit and vegetable species. Some phytohormones and secondary metabolites

are induced as responses to prevent development of the pathogen. For example, JA

levels rise steeply against damage caused by environmental stress, and trigger the

formation of many different kinds of plant defenses (Taiz et al., 2002). It has been

shown that jasmonates, especially JA and its methyl ester (MeJA) mediate resistance

to insects and disease (Creelman et al., 1997). A previous report (Nimitkeatkai et al.,

2011) showed that application of PDJ, which is a synthetic analog of JA, influenced

ethylene production and aroma volatiles, a response mediated by endogenous JA

levels in a Japanese apricot (Prunus mume Sieb.) infected by a pathogen. Japanese

apricot is a climacteric fruit, and ET is closely associated with environmental stresses

(Abeles et al., 1992). However, the relationship between JA and ethylene in grapes, a

non-climacteric fruit, when infected by fungus is unclear.

ABA concentrations in grape berries increase just before véraison;

therefore, ABA may be a signal of ripening in grape berries (Coombe et al., 1973).

ABA triggers responses (stomatal close, induction, etc.) against environmental stress

such as drought, high salinity, and herbicide toxicity (Cho et al., 2012; Grossmann et



27

al., 1996). In ABA biosynthesis in higher plants, NCED is a key enzyme that cleaves

11, 12 double bonds of C40 carotenoids and produces xanthoxin (Qin et al., 1999).

Subsequently, ABA is primarily catabolized to form 8′-hydroxy ABA by

hydroxylation with ABA 8′-hydroxylase, and then isomerizes to PA (Nambara et al.,

2005). ABA can also prominently regulate pathogen defense responses

(Vleesschauwer et al., 2010). Therefore, ABA and JA may interact in grapes in

response to environmental stress.

In this study, the effects of PDJ application on lesion diameter, endogenous

JA, ABA, aroma volatiles, and antioxidant activity were investigated in grapes

infected by G. cingulata). In addition, changes in the expression of VvNCED1 and

ABA VvCYP707A1 genes in grapes were analyzed.



28

2.2 MATERIALS AND METHODS

2.2.1 Plant material

Three 7-year-old ‘Kyoho’ grapevines [Vitis labrusca × V. vinifera] grafted

onto ‘Teleki-kober 5BB’ rootstocks [V. berlandieri × V.riparia hibrids] were

harvested at the véraison stage (50 days after full bloom [DAFB]). The vines had

been growing in an open field at Chiba University, located at 35 °N Lat, 140 °E

Long, and at an altitude of 37 m. Two times of 25ppm Gibberellin (GA) treatment

were applied for the development and seedless of grape berries (First time: at full

blood date; Second time: 10 days after full bloom). Berries of similar size and color

were selected and rinsed with tap water, then sterilized by 0.5% sodium hypochlorite

for 3 min and washed with distilled water prior to treatment. The fruits were

randomly divided into three groups of 800 berries. In the first and second groups, the

fruits were dipped into distilled water containing 0.1% (v/v) surfactant Approach BI

(50% polyoxyethylene hexitan fatty acid ester; Kao, Osaka, Japan) for 5 min. In the

third group, the fruits were dipped in 0.4 mM PDJ solution (Nippon Zeon Co., Tokyo,

Japan), containing 0.1% (v/v) Approach BI. All berries were then air-dried and

wounded with the needle of a syringe to a depth of 5 mm. Fruits from the second and

third groups were inoculated with G. cingulata.



29

2.2.2 Fungal strain, culture, and inoculation

The G. cingulate (MAFF, 239927) used in this study as the anthracnose

pathogen was incubated on potato dextrose agar at 25°C for 7 days. The conidia were

collected with distilled water after the surface of the medium was scraped. Density of

the conidia suspension was adjusted to 106 conidia/mL with distilled water using a

hemosytometre (Thoma [EKDS Co., Tokyo, Japan], depth 1/10 mm, No. D7092,

1/400 sqmm).

The suspension with spores was dripped onto the wounded surfaces of the

fruit in the second and third groups, hereafter referred to as PDJ− inoc+ and PDJ+

inoc+, respectively. A suspension without spores was placed on the wounds of the

control fruit in the first group, hereafter referred to as control.

All fruit from the three groups were placed in a controlled room at 25 °C

and 95% relative humidity. Two hundred berries per treatment group (three

replications of 66-67 berries) were sampled at 3, 6, 9, and 12 days after treatment.

Before treatment (day 0), two hundred berries (three replications of 66-67 berries)

were collected immediately after harvest. After lesion diameter and ethylene

production were measured, the skin was sampled and frozen in liquid N2. The

samples were stored at −80°C.



30

2.2.3 Quantitative analysis of ABA and PA

The frozen skin samples [1g fresh weight (FW); three replications] were

homogenized in 20 mL cold 80% (v/v) methanol including 0.5 g

polyvinylpyrrolidone with 0.2 µg ABA-d6 and PA-d3 as an internal standard. The

extraction and analysis of ABA and PA in samples were performed as previously

described by Kondo et al. (2012). The methyl ester of ABA and PA was analyzed by

gas chromatography-mass spectrometry-selected ion monitoring (GC-MS-SIM;

model QP5000; Shimadzu, Kyoto, Japan). The column temperature was a step

gradient of 60°C for 2 min, and thereafter was raised to 270°C at 10°C min−1; it was

held at 270°C for 35 min. The ions were measured as ABA-d0 methyl ester/ABA-d6

methyl ester at m/z 190, 260, 194, and 264. For PA, the ions were measured as

follows: PA-d0 methyl ester/PA-d3 methyl ester at m/z 276, 294, 279, and 297. ABA

concentration was determined from the ratio of peak areas for m/z 190 (d0)/194 (d6).

The PA concentration was calculated from the ratio of peak areas for m/z 276

(d0)/279(d3).

2.2.4 Jasmonic acid analysis

Extraction and analysis of JA were performed according to the procedure

described in a previous paper (Kondo et al., 2005) with GC-MS-SIM. One gram of

fruit peel was homogenized with 100 µL of ((±)- 2-(2, 3-2H2) JA (100 mg L-1)) as an



31

internal standard in 10 mL of saturated NaCl solution and 20 mL of diethyl ether

containing 0.005% butylated hydroxytoluene (BHT) as an antioxidant. The aqueous

layer was extracted 3 times with 20 mL of diethyl ether containing 0.005% BHT.

The pooled ether extract was dried under warm air, then the residue was dissolved in

200 µL of chloroform/isopropylethylamine, 1:1 (v/v), and derivatized at 50°C for 60

min with pentafluorobenzyl bromide. The derivatization mixture were then dried

under N2. The residue was dissolved in 2mL n-hexane and added onto a silica gel

column. The sample was eluted with 7mL n-hexane/diethyl ether (v/v=2:1) then

dried at 50°C under N2. After dissolved in 1mL methanol, sample was filtrated

through Millipore. The ions were measured as m/z 392, 390, 211, and 209. The

concentration of JA in the original extract was determined from the ratio of peak

areas for m/z 209 (2H0)/211 (2H2).

2.2.5 Volatile compound analysis

0.1 g of grape peel was put in a 4-mL vial to which was added 1 µL of

1000-ppm cyclohexanol. The sample was stirred for 50 min at 25°C, and the

equilibrium of headspace volatile compounds between the grape matrix and the

headspace was accelerated. Volatile compounds extraction was then performed by

injecting a 10-µM polydimethylsiloxane SPME fiber (Supelco, Bellefonte, PA, USA)

into the vial and exposing it to the headspace for 5 min at 25°C. After extraction,



32

samples were directly desorbed into the injection port of the GC, which was at 230°C.

The volatile compounds were analyzed with a Shimadzu GC-MS QP2010 (Shimadzu

Co., Ltd., Kyoto, Japan). Volatile compounds were separated using a capillary

column (DB-WAX; 60 m × 0.25 mm ID × 0.25-µM film thickness; Agilent, Santa

Clara, CA, USA), with a helium gas linear flow rate of 30 cm/min. The temperature

program was isothermal at 40°C for 7 min, then was raised 5°C/min to 220°C, and

finally raised 20°C/min to 245°C, where it was maintained for 15 min. The GC-MS

transfer line temperature was at 200°C. The mass spectrometry (MS) operated in

electron impact mode with electron impact energy of 70 eV, and collected data at a

velocity of 0.5 scans/s over a range of m/z 50–350. N-Alkanes were analyzed under

the same conditions to calculate the Kovats Index (KI) for volatile compounds. The

compounds were identified by comparison with commercial reference compounds.

These were provided by comparison of KI with those described in the literature, and

by comparison of their MS data with those contained in the National Institute of

Standards and Technology (NIST, 21 and 28).

2.2.6 Measurement of O2− radical-scavenging activity

The analyses of O2− radical-scavenging activity were performed according

to the method described in Kondo et al. (2005). Skin samples of 1g (three

replications) were homogenized in 10 mL 13.7 mol/L ethanol and filtered. The



33

Potassium phosphate-borax-EDTA buffer (pH 8.2), 0.5mM Hypoxantin solution,

10mM Hydroxylammonium Chloride (Wako, Co., Ltd., Japan) and distill water was

mixed with sample then Xantineoxidase was added and incubated at 37°C for 30 min

in water bath and constantly shaking. A mixed solution with 30 mM of

N-(1-Naphthyl)ethylenediamine dihydrochloride, 3mM of Sulfanilic acid and 25%

Acetic acid then keep at room temperature for 30 min. The analysis with

spectrophotometer was at 550nm.

2.2.7 RNA extraction, cDNA synthesis, and quantitative real-time RT-PCR

Total RNA extraction from the skin (1 g FW; three replications) was

performed as previously reported by Kondo et al. (2012). The sample was pulverized

then incubated in 65°C water bath for 10 min with 200mg polyvinyl polypyrrolidine,

200 µL β-Mercaptoethanol and 10 mL extraction solution contained 2% CTAB

(Cetyltrimethylammonium Bromide). The mixture was extracted 2 times by the

equal volume of Chloroform: Isoamyl alcohol (24:1), and centrifuged at 9000×g, 4°C

for 10 min. The upper phase was transferred to a new tube then 10% volume 3M

NaOAc and 60% volume of isopropanol was added and kept at -80°C for 30 min.

After centrifuge at 3500×g, 4°C for 30 min and remove the solution, the pellet was

kept and rinsed with 70% ethanol then air-dried. 1 mL of 1% TE was used to

dissolve the pellet then transferred to a 2 mL tube. After add 120 µL of 10 M LiCl,



34

the tube was kept at 4°C more than 2 hours. Centrifuge at 20000×g, 4°C for 30 min

and remove the supernatant then washed by 160 µL of 70% ethanol. After the sample

was dried then dissolved with 30 µL hyperpure water. CcDNA synthesis was carried

out according to the method described in Kondo et al. (2014) after the measurement

of RNA concentration and electrophoresis. Gene-specific primers for each gene

(Table 2.1) were used for RT-PCR. Primers for the amplification of the

VvCYP707A1 gene were based on a previous report (Kondo et al. 2014). The

nucleotide sequence of the fragment amplified with these primers was confirmed by

sequencing. Primers for the VvNCED1 gene were constructed based on the sequences

reported by Sun et al. (2010). The relative expression level of each gene was

determined by a relative standard curve method. The expression level was

normalized to that of the VvUbiquitin gene (Fujita et al. 2007).

Table 2.1. Primers used for real-time RT-PCR.

Gene Forward/reverse primer (5′ – 3′ ) Reference

VvNCED1 (F) GGTGGTGAGCCTCTGTTCCT Sun et al. (2010)

(R) CTGTAAATTCGTGGCGTTCACT

VvCYP707A1 (F) GAAACATTCACCACAGTCCAGA Kondo et al. (2014)

(R) AGCAAAAGGGCCATACTGAATA

VvUbiquitin (F) TCTGAGGCTTCGTGGTGGTA Fujita et al. (2007)

(R) AGGCGTGCATAACATTTGCG



35

2.2.8 Statistical analysis

The data was presented as the mean values of the three replications ± the

standard error (SE), and separated by Fisher’s least significant difference (P≤0.05)

using the SAS analysis of variance procedure (version 8.2, SAS Institute, Cary, NC,

USA). The lesion diameter in Fig. 2.1 was evaluated using the Tukey-Kramer test at

each date.



36

2.3 RESULTS

2.3.1. Lesion diameter

The diameters of the lesions infected by G. cingulata in the PDJ− inoc+ and

PDJ+ inoc+ samples are shown in Figure 1. Lesion diameters in PDJ+ inoc+ samples

were significantly smaller than those in PDJ− inoc+ at 9 and 12 days after treatment.

Fig. 2.1. Lesion diameter in ‘Kyoho’ grape berries after pathogen inoculation and

PDJ application. Values are from three replications of 50 fruits. Asterisks indicate

significant differences on each day after treatment (**, P < 0.01).

0

5

10

15

20

25

0 3 6 9 12 15

PDJ+ inoc+

PDJ- inoc+

Days after inoculation

Leis

ion

diam

eter

(mm

)

**

ns

**

ns

PDJ+ inoc+

PDJ− inoc+



37

2.3.2. Endogenous abscisic acid (ABA), phaseic acid (PA) and expression of

VvNCED1 and VvCYP707A1

ABA concentrations in inoculated fruit increased at 3 days after treatment

(Fig. 2.2). In addition, the ABA concentrations in PDJ+ inoc+ were higher than those

in PDJ− inoc+. PA concentrations were highest in PDJ+ inoc+, followed by PDJ− inoc+;

lowest were in the untreated control. The expression levels of VvNCED1 in PDJ+

inoc+ were highest 6 and 12 days after inoculation, followed by PDJ− inoc+ and the

untreated control (Fig. 2.3). The expressions of VvCYP707A showed a similar

tendency with that of VvNCED1.

2.3.3 Endogenous jasmonic acid (JA), ethylene production, and the changes in

the O2-radical scavenging activities

In general, JA concentrations in PDJ+ inoc+ were higher than those in the

other two treatments (Fig. 2.4). The JA concentrations in PDJ+ inoc+ were highest at

9 and 12 days after treatment. There were no significant differences in ethylene

production between the three treatments through measured data (not shown). EC50

value was defined as the concentration of substrate that caused a 50% loss in O2−

scavenging activities. Low EC50 values show high antioxidant activity (Fig. 5). The

values of EC50 in PDJ+ inoc+ were lowest at 3 and 6 days after treatment.



38

Fig. 2.2. Endogenous (A) ABA and (B) PA concentrations in ‘Kyoho’ grape skins

after pathogen inoculation and PDJ application. Data are the means ± SE of three

replications.

0

0.5

1

1.5

2

2.5

3

AB

A (µ

mol

/kg)

Control

PDJ-inoc+

PDJ+inoc+

LSD0.05 = 0.12 (A)

PDJ- inoc+

PDJ+ inoc+

Control

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

0 3 6 9 12 15

PA (

µmol

/kg)

Days after incoculation

LSD0.05 = 0.08

(B)



39

Fig. 2.3. Quantitative real time RT-PCR analysis of (A) VvNCED1 and (B)

VvCYP707A1 in ‘Kyoho’ grape skins after pathogen inoculation and PDJ application.

Data are the means ± SE of three replications.

0

1

2

3

4

5

6

7

0 6 12 Days after inoculation

Rel

ativ

e Vv

CYP

'07A

1 ex

pres

sion

LSD0.05 = 0.61（B）

0

0.5

1

1.5

2

2.5 Control

PDJ-inoc+

PDJ+inoc+

LSD0.05 = 0.12

Rel

ativ

e vv

NC

ED1

expr

essi

on (A)

PDJ+ inoc+

Control

PDJ− inoc+



40

Fig. 2.4. Endogenous JA concentrations in ‘Kyoho’ grape skins after pathogen

inoculation and PDJ application. Data are the means ± SE of three replications.

0

20

40

60

80

100

120

0 3 6 9 12 15

Control

PDJ- inoc+

PDJ+ inoc+

Control

PDJ+ inoc+

LSD0.05 = 14.4

PDJ− inoc+


JA（

nmol

/kg ）



41

Figure. 2.5. Changes in O2− radical scavenging activity in ‘Kyoho’ grapes after

pathogen inoculation and PDJ application. Data are the means ± SE of three

replications.

2.3.4 Aroma volatiles

Sixty-four kinds of aroma volatiles were detected in grape skins, including

17 aldehydes, 24 alcohols, 19 esters, 2 terpenes, and other small amount of

compounds (Table 2.5). At harvest, the aroma volatiles were comprised of an

abundance of aldehydes (90.9%), followed by alcohols (7.2%), esters (1.1%), and

terpenes (0.5%). (E)-2-hexenal (76.47 mg kg-1), hexanal (25.06 mg kg-1), and

0

1

2

3

4

5

6

7

0 3 6 9 12 15

Control PDJ- inoc+ PDJ+ inoc+

EC50（

mg

/mL ）


LSD0.05 = 0.97Control

PDJ− inoc+

PDJ+ inoc+



42

cis-3-hexenal (5.16 mg kg-1) were the primary compounds of aldehydes in ‘Kyoho’

grape skins. In general, aldehyde concentrations in PDJ− inoc+ were lower than in

PDJ+ inoc+ and the untreated control (Fig. 2.6). Alcohol concentrations increased

gradually with days after treatment, but were not significantly different between

treatments. The ester concentrations in PDJ+ inoc+ were higher than those in the

untreated control at 6 days after inoculation. Moreover, the concentrations of terpene

in PDJ+ inoc+ significantly increased in the 6 days after inoculation. The total aroma

volatiles reached a maximum at 9 days after inoculation.



43

1

Table 2. Typical aroma volatile compounds identified in ‘Kyoho’ grape skins after pathogen inoculation and PDJ application.

Concentrations (mg kg-1)

Control PDJ

− inoc

+ PDJ

+ inoc

+

KIb Compounds 0 3 6 9 12 3 6 9 12 3 6 9 12

Alcohol

836 ethanol 2.1±0.5 13.9±4.6 16.6±0.0 34.9±1.8 38.2±6.9 5.8 ±1.0 9.5 ±1.6 41.6±4.4 47.0±10.0 6.8±2.2 14.8±1.4 33.4±3.4 47.5±4.8

1055 1-penten-3-

ol trc 0.6±0.3 1.5±0.2 2.2±0.9 1.0±0.2 0.6 ±0.2 1.1 ±0.1 1.1±0.2 0.8±0.1 1.7±0.2 2.3±0.2 1.5±0.2 1.0±0.2

1245 1-hexanol 0.3±0.0 0.6±0.1 0.5±0.1 0.7±0.1 0.9±0.1 0.9±0.2 0.4±0.0 0.6±0.1 0.6±0.1 0.8±0.0 1.0±0.2 0.7±0.1 0.6±0.1

1380 2-ethyl

-hexanol 2.3±0.2 2.0±0.4 2.2±0.4 2.6±0.3 1.1±0.5 2.7±0.6 3.0±0.7 3.1±0.5 2.2±0.2 2.0±0.1 3.2±0.4 4.8±1.9 3.8±0.8

Aldehyde

975 hexanal 25.1±4.8 47.7±4.6 46.1±6.9 60.0±12.1 38.1±6.5 22.7±4.9 34.5±3.9 40.7±6.6 37.9±1.2 36.3±4.3 51.1±2.5 65.3±5.2 43.6±5.8

1035 cis-3-

hexenal 5.2±2.3 6.9±1.4 4.6±0.3 2.6±0.4 1.5±0.4 2.8±0.2 2.5±0.9 3.0±0.3 0.3±0.1 3.5±0.6 3.4±0.2 4.9±1.5 1.3±0.0

1079 n-heptanal NDd 0.4±0.0 0.7±0.2 0.8±0.3 1.6±0.7 0.5±0.2 0.8±0.3 0.6±0.1 tr 0.7±0.0 1.0±0.3 1.5±0.8 0.9±0.2

1094 (Z)-2-

hexenal 1.3±0.2 2.2±0.8 1.5±0.2 1.2±0.2 0.8±0.1 0.6±0.2 0.9±0.0 1.1±0.2 0.6±0.2 1.0±0.2 1.1±0.2 1.3±0.1 0.7±0.2

1110 (E)-2-

hexenal 76.5±13.3 48.5±15.1 89.0±15.5 116.8±15.7 84.1±9.5 36.9±7.2 74.7±7.1 95.3±19.3 88.7±0.8 56.9±6.5 74.4±7.2 124.8±10.7 86.5±12.9

1289 nonanal 0.6±0.0 1.1±0.1 0.7±0.1 1.2±0.2 1.1±0.1 0.5±0.1 0.8±0.1 0.7±0.1 1.1±0.3 0.6±0.1 0.9±0.1 1.1±0.2 0.8±0.2

Ester

1020 hexyl

butanoate ND ND 0.4±0.1 0.6±0.2 0.5±0.1 0.8±0.1 0.6±0.1 0.3±0.1 tr 0.5±0.1 1.1±0.4 0.9±0.2 0.3±0.1

1030 ethyl

hexanoate 0.5±0.1 2.0±0.6 1.0±0.2 0.7±0.1 0.5±0.0 0.3±0.0 0.8±0.0 0.8±0.2 0.4±0.2 0.5±0.1 0.5±0.0 0.8±0.1 0.8±0.3

1305 3-heptene-1-

yl acetate tr 0.3±0.1 0.2±0.1 0.9±0.3 tr 2.1±0.9 0.5±0.2 0.6±0.4 2.9±0.4 5.3±2.8 4.1±2.4 2.6±0.9 0.2±0.1

1738

ethyl (E,Z)-

2,4-

decadienoate

ND 2.1±0.3 1.3±0.3 1.2±0.2 0.6±0.0 0.9±0.3 1.4±0.1 0.8±0.3 0.7±0.3 1.2±0.2 1.1±0.1 1.3±0.3 0.9±0.3

Others

1449 α-Farnesene 0.2±0.0 0.5±0.1 0.3±0.0 0.6±0.1 0.5±0.1 0.3±0.1 0.3±0.0 0.4±0.1 0.4±0.0 0.3±0.0 0.4±0.1 0.5±0.1 0.4±0.0

1231

6-methyl-5-

hepten-2-

one

0.3±0.1 0.5±0.1 0.5±0.1 0.5±0.0 0.6±0.1 1.1±0.2 0.3±0.0 0.4±0.1 0.5±0.0 1.2±0.2 1.4±0.4 0.6±0.1 0.5±0.1

a Data are the means ± SE of three replications. b n-Alkanes were analysed under the same conditions to calculate Kovats Index (KI) for the volatile compounds. c tr = relative concentration less than 0.2

mg kg-1

. d ND = relative concentration less than 0.1 mg kg-1

a



44

Fig. 2.6. The concentration of volatile compounds [(A) Aldehydes concentrations; (B)

Alcohol concentrations; (C) Ester concentrations; (D) Terpene concentrations] in

‘Kyoho’ grape skins after pathogen inoculation and PDJ application. Data are the

means ± SE of three replications.

0

50

100

150

200

250 Control PDJ-inoc- PDJ+inoc-

Ald

ehyd

e co

ncen

tratio

n��(m

g/kg

) �

LSD0.05= 35.70�

(A)�

PDJ− inoc+ PDJ+ inoc+ Control

0

10

20

30

40

50

60

70

80

Alc

ohol

con

cent

ratio

n��(m

g/kg

)�

LSD0.05= 9.66�

(B)�

0

2

4

6

8

10

12

14

16

0 3 6 9 12 15

Este

r con

cent

ratio

n��(m

g/kg

)�

Days after inoculation�

LSD0.05= 3.36� (C)�

0

1

2

3

4

0 3 6 9 12 15

��

T

erpe

ne c

once

ntra

tion��(m

g/kg

) �

Days after inoculation�

LSD0.05= 0.52�(D)�



45

2.4 DISCUSSION

Some reports have shown a positive correlation between ABA levels and

disease resistance. Viral infection increased ABA concentrations, and ABA

application increased virus resistance in tobacco (Nicotiana tabacum L.) (Fraser et

al., 1982; Whenham et al., 1986). ABA treatment enhanced basal resistance of rice

(Oryza sativa L.) against the brown spot-causing ascomycete Cochliobolus

miyabeanus (Vleesschauwer et al. 2010). In addition, cds2-1D mutants,

which overexpress 9-cis epoxycarotenoid dioxigenase5 (NCED5; one of the six

genes encoding the ABA biosynthetic enzyme NCED), show enhanced endogenous

ABA and increased resistance against Alternaria brassicicola. In contrast,

ABA-deficient mutant aba3-1 did not have resistance against A. brassicicola in

Arabidopsis (Arabidopsis thaliana) (Fan et al., 2009). In my study, the increased

concentrations of ABA in inoculated fruit suggest that ABA might be associated with

the defense system in grape berries. Environmental stress regulates ABA

biosynthesis in plants. For instance, the expression of NCED in Arabidopsis (Iuchi et

al. 2001), cowpea (Vigna unguiculata L.) (Iuchi et al., 2000), and avocado (Persea

americana L.) (Chernys et al., 2000) were stimulated by drought stress. In this study,

inoculation also induced the expression of VvNCED1. Therefore, it is possible that

the increase in ABA concentrations in PDJ+ inoc+ were dependent on the increased



46

expression of VvNCED1 gene. Moreover, it is thought that the increase of PA was

induced by the VvCYP707A gene encoding the ABA 8′-hydroxylase. In addition,

PDJ treatment increased the ABA concentrations in apples (Malus sylvestris L.)

(Kondo et al., 2000). These results suggest cross-talk between jasmonate and ABA,

including VvNCED1 and VvCYP707A1.

Synergistic and antagonistic effects have been reported in the interaction

between the ABA and JA signaling pathways (Moons et al., 1997; Staswick et al.,

1992). For example, high ABA levels strongly reduced the transcript levels of JA- or

ethylene-responsive defense genes in Arabidopsis inoculated by Fusarium

oxysporum, whereas those in ABA-deficient mutants increased (Anderson et al.

2004). On the other hand, ABA stimulated biosynthesis of JA and the JA-dependent

defense gene in aba2-12 biosynthetic defective mutants in Arabidopsis against

Pythium irregular (Adie et al., 2007). In my study, PDJ application stimulated

endogenous ABA and JA concentrations, resulting in a decrease of lesion diameter

by pathogen infection. Therefore, the defense mechanism observed in grape berries

may depend on the synergistic effect of JA and ABA.

In this study, aldehydes and alcohols were primarily detected in abundance

during storage among all treatments, as they were in previous research (Hadi et al.,

2013), showing that volatile compounds in grape berries predominantly consist of

short chain aldehydes and alcohols. (E)-2-hexenal was the most abundant volatile



47

compound in ‘Riesling’ and ‘Cabernet Sauvignon’ grapes, and showed a significant

increase after véraison (Kalua et al., 2010). It has been shown that trans-2-hexenal,

carvacrol, trans-cinnamaldehyde, and citral provided consistent fungicidal activity

against Penicillium expansum in pears (cv. Conference) (Neri et al., 2006). In my

study, (E)-2-hexenal was the major volatile. The plant defense response on C6

aldehydes ((E)-2-hexenal and hexenal in our study) have been shown. For example,

they are the predominant wound-inducible volatiles that mediate indirect defense

responses by attracting the natural enemies against plant invaders (Kessler et al.,

2004; Farag et al., 2005). In showing that aldehyde concentrations in PDJ+ inoc+ were

higher than in PDJ− inoc+, this study corroborates these reports. Previous research

showed that PDJ application at the pre-climacteric stage increased the production of

esters in apples (Kondo and Matheis, 2006). Ester formation in grapes needs a supply

of substrate (alcohols) and the ester-forming enzyme, alcohol acyltransferase (AAT)

(Wang and Luca, 2005). As the ester concentration significantly increased in PDJ+

inoc+, PDJ application might have influenced the accumulation of esters by the

stimulating activity of AAT. The terpenes or terpenoids constitute the largest class of

secondary products that appear to play important defensive roles in plants

(Gershenzon et al., 1992). A significant increase of terpenes 6 days after inoculation

was detected in PDJ+ inoc+.

Ethanol has been considered germistatic against fruit and vegetable decay



48

microorganisms (Penicillium digitatum and Colletotrichum musae in an in vitro

experiment) (Utama et al., 2002). In my study, ethanol was the most-identified

compound in the alcohol class, and it was derived from fermentation, which

transforms to ethanol through the action of the enzyme alcohol dehydrogenase

(ADH) (William et al. 2008). ADH enzyme activity and HvADH1 were stimulated

by the inoculation of Blumeria graminis in barley (Hordeum vulgare L.) (Pathuri et

al., 2011). Therefore, ethanol production may also be a signal that plants are

resistant to pathogen infection. In my study, although alcohol concentrations

increased in PDJ+ inoc+ compared to PDJ− inoc+, there were no significant

differences with the untreated control. The aspect of aroma volatile emission in

plant defense mechanism may be different among plants.

In summary, endogenous ABA and JA concentrations increased in

inoculated ‘Kyoho’ grape berries. PDJ application before inoculation increased

ABA concentration, as well as the expression of the VvNCED1 gene. The defense

mechanism in grape berries against pathogenic infection might depend on the

synergistic effect of JA and ABA.

Chapter 3 α-Ketol linolenic acid (KODA) application affects endogenous abscisic acid, jasmonic acid

and aroma volatiles in grapes infected by a pathogen (Glomerella cingulata)

49

CHAPTER 3

α-KETOL LINOLENIC ACID (KODA) APPLICATION

AFFECTS ENDOGENOUS ABSCISIC ACID, JASMONIC

ACID, AND AROMA VOLATILES IN GRAPE BERRIES

INFECTED BY A PATHOGEN

(GLOMERELLA CINGULATA)



50

3.1 INTRODUCTION

G. cingulata is a plant pathogenic fungus that causes diseases as bitter rot

and anthracnose in many fruit and vegetable species. It has been shown that plant

hormones stimulate physiological response particularly under environmental stress

such as drought, salt and disease (Yamaguchi-Shinozaki and Shinozaki, 1993;

Albacete et al., 2008; Denancé et al., 2013). KODA: [9,10-ketol-octadecadienoic

acid or 9-hydroxy-10-oxo-12(Z), 15(Z)-octadecadienoic acid] was identified as a


KODA reacted as a flower-inducing compound in violet (Pharbitis nil), carnation

(Dianthus caryophyllus L.), and apple (Malus domestica Borkh.) (Kittikorn et al.,

2010; Suzuki et al., 2003; Yokoyama et al., 2005).

KODA is formed from 9-hydroperoxy-10(E), 12(Z),

15(Z)-octadecatrienoic acid (9-HPOT) generated from linolenic acid via

9-lipoxygenase (9-LOX) (Vick and Zimmerman, 1987). JA, which its regulatory

function in defensing fungal pathogen was well demonstrated, is synthesized from

linolenic acid by 13-hydroperoxy-9(Z), 11(E), 15(Z)-octadecatrienoic acid

(13-HPOT) by 13-LOX (Turner et al., 2002; Vick and Zimmerman 1987). In

oxylipin pathway, both KODA and JA are metabolized via LOX and AOS, known as

AOS pathway (Creelman and Mullet, 1997; Yamaguchi et al., 2001). The other is the



51

fatty acid HPL pathway that produces C6-aldehydes and C12-oxo acids (Hatanaka et

al., 1987). Volatile C6-aldehydes, (E)-2-hexenal and (Z)-3-hexenal enhance

resistance against a necrotrophic pathogen (Botrytis cinerea) in Arabidopsis

(Kishimoto et al., 2006). In view of these achievements, KODA might influence the

infection of pathogen was also involved in our study, which is absolutely unclear.

ABA, as a regulator in ripening grape berries, has been shown to act

complex role to response against environmental stress such as drought via stomatal

closure and pathogen attack by interacting with other plant hormones (Coombe and

Hale, 1973; Mohr and Cahill, 2001; Yamaguchi-Shinozaki and Shinozaki, 1993). In

the ABA biosynthetic pathway of higher plant, the NCED is a key upstream enzyme

that cleaves 11, 12 double bonds of C40 carotenoids and produces xanthoxin (Qin and

Zeevaart, 1999). Then, ABA primarily catabolizes to 8′ -hydroxy ABA by ABA

8′-hydroxylase, and subsequently isomerizes to PA (Nambara and Marion-Poll,

2005). SA was also key signal molecules in the activation of plant defense responses

as well as JA (Delaney et al., 1994). SA had a negative effect on trichome

production and consistently reduced the effect of JA in Arabidopsis, suggesting

negative cross-talk between the JA and SA-dependent defense pathways (Traw and

Bergelson, 2003). Nevertheless, any clues in interaction between JA and SA have not

been acquired in grape berries after infection of G. cingulata.

It is possible that plant defense in response to microbial attack is regulated



52

through a complex network of signaling pathways that might involve ABA, JA, SA,

and C6-aldehydes, which would be discussed in our research.



53

3.2 MATERIALS AND METHODS

3.2.1. Plant material

Three 8-year-old ‘Kyoho’ [Vitis labrusca × V. vinifera] grapevines grafted

onto ‘Teleki-kober 5BB’ rootstocks [V. berlandieri × V.riparia hibrids] were

harvested at the véraison period (50 days after full bloom [DAFB]). The vines had

been cultivated in an open field at Chiba University, located at 35 °N Lat., 140 °E

Long., and at an altitude of 37 m. Two times of 25ppm GA treatment were applied

for the development and seedless of grape berries (First time: at full blood date;

Second time: 10 days after full bloom). Berries were selected uniformly in size and

color and rinsed with tap water, then sterilized by 0.5% sodium hypochlorite for 3

min and washed with distilled water prior to KODA treatment. The fruits were

randomly divided into three groups, 800 berries of each. The first and second groups

of fruits were immersed in the distilled water containing 0.1% (v/v) surfactant

Approach BI (50% polyoxyethylene hexitan fatty acid ester; Kao, Osaka, Japan) for

5 min. The third group, the fruits were dipped into 0.1 mM KODA solution (Shiseido,

Co., Ltd, Tokyo, Japan), containing 0.1% (v/v) Approach BI for 5 min. After air-dry,

all of the berries were wounded with the needle of a syringe to a depth of 5 mm.

Fruits in the second and third groups were inoculated with G. cingulata.



54

3.2.2. Fungal strain, culture, and inoculation.

The G. cingulate (MAFF, 239927) applied in our research was incubated

on potato dextrose agar at 25°C for 7 days. The conidia were collected with distilled

water after the surface of the medium was scraped. Density of the conidia suspension

was adjusted to 106 conidia/mL with distilled water using a Thoma’s hemacytometer

(EKDS Co., Tokyo, Japan).

A drop of suspension with spores was dripped on the wounded surfaces of

each fruit in the second and third groups, hereafter referred to as KODA− inoc+ and

KODA+ inoc+, respectively. The control fruits were treated with suspension without

spores by the same way, hereafter referred to as the control.

All the berries after treatment were stored in a controlled room at 25°C

with 95% relative humidity. Two hundred berries from each treatment (three

replications of 66-67 berries) were sampled at 3, 6, 9, and 12 days after inoculation.

Two hundred berries (three replications of 66-67 berries) were collected immediately

after harvest prior to treatment (day 0). After lesion diameter and ethylene

production were analyzed, the peel was sampled and frozen with liquid N2, then

stored at −80°C immediately.

3.2.3 Quantitative analysis of ABA and PA

The measurement of ABA and PA followed the method described in 2.2.3.



55

3.2.4 Jasmonic acid analysis

The analysis of JA was done by GC-MS-SIM described in 2.2.4.

3.2.5. Volatile compound analysis

Aroma volatile compound in frozen skin samples were extracted and

measured followed 2.2.5.

3.2.6 Measurement of O2− radical-scavenging activity

The analysis of O2− radical-scavenging activity were measured as previous

method described by Kondo et al. (2005). One gram of sample (three replications)

were homogenized with 10 mL 13.7 mol/L ethanol, filtered and evaporated to the

aqueous phase, and added to 10 mL of distilled water.

3.2.7 RNA extraction, cDNA synthesis, and quantitative real-time RT-PCR

analysis

Total RNA was extracted by a cetyltrimethylammonium bromide

(CTAB)-based method from skin sample (1 g FW; three replications) previously

reported by Kondo et al. (2012). cDNA synthesis followed the instruction manual of

ReverTra Ace® qPCR RT Master Mix (Code No. FSQ-201) (Toyobo co., LTD.,

Osaka, Japan). Quantitative PCR was performed on StepOnePlus™ system (Applied



56

Biosystems, SMFC, CA, USA). The primers listed in Table 3.1 were used for Q-PCR.

Primers of the VvCYP707A1 gene were according to a previous report (Kondo et al.

2014). Primers for the VvNCED1 gene were constructed based on the sequences

reported by Sun et al. (2010). Besides, VvLOX and VvAOS involved in oxylipin

pathway were designed as described by Ramírez-Suero et al. (2014). The relative

expression level was determined with the VvUbiquitin as an internal control gene by

a relative standard curve method (Fujita et al. 2007).

Tables 3.1 Primers used for Quantitative real-time RT-PCR.

Gene Forward/reverse primer (5′ – 3′ ) Reference

VvNCED1 (F) GGTGGTGAGCCTCTGTTCCT Sun et al. (2010)

(R) CTGTAAATTCGTGGCGTTCACT

VvCYP707A1 (F) GAAACATTCACCACAGTCCAGA Kondo et al.

(2014) (R) AGCAAAAGGGCCATACTGAATA

VvAOS (F) GCCTGGCTTAATCACGACAT

Ramírez-Suero et

al. (2014) (R) CACCTTCGTCCAGAACATGA

VvLOX (F) CCCTTCTTGGCATCTCCCTTA

Ramírez-Suero et

al. (2014) (R) TGTTGTGTCCAGGGTCCATTC

VvUbiquitin (F) TCTGAGGCTTCGTGGTGGTA Fujita et al.

(2007) (R) AGGCGTGCATAACATTTGCG



57

3.2.8 Statistical analysis

The each data was presented as the mean values of the three replications ±

the standard error (SE), subjected to analysis of variance procedures, and separated

by Turkey-Kramer test at P ≤ 0.05 using the SAS statistical analysis package

(version 8.2, SAS Institute, Cary, NC, USA). The lesion diameter in Fig. 3.1 was

evaluated using t-test on each day after treatment (**, P ≤ 0.01).



58

3.3 RESULTS

3.3.1. Lesion diameter

The diameters of the lesions in grape samples infected by G. cingulata

were exhibited in Fig. 3.1. Lesion diameter in KODA+ inoc+ samples were

significantly suppressed than those in KODA− inoc+ from 6 days, although reverse

result was presented at 3 days after inoculation.

Fig. 3.1. Lesion diameter during storage in ‘Kyoho’ grape berries of pathogen

inoculation without KODA application and pathogen inoculation with KODA

application. KODA solution was applied 24 h prior to inoculation. Data are the

means from three replications of 50 berries. Asterisks indicate significant differences

by using t-test on each day after treatment (**, P ≤ 0.01).

0

5

10

15

20

25

0 3 6 9 12

KODA+inoc+ KODA+inoc+

Lesi

on d

iam

eter

(mm

)


**

**

****

KODA+ inoc+ KODA− inoc+



59

3.3.2. Endogenous abscisic acid (ABA), phaseic acid (PA) and expression of

VvNCED1 and VvCYP707A1

ABA levels in inoculated fruit increased significantly at 3 days and

reduced since 6 days after infection (Fig. 3.2). Moreover, the ABA concentrations

in KODA+ inoc+ were higher than those in KODA− inoc+ at 6 and 9 days after

inoculation. PA concentrations also increased after inoculation, especially were

highest in PDJ+ inoc+ at 6 and 9 days after inoculation. The expression levels of

VvNCED1 in KODA+ inoc+ were highest at 6 days after inoculation, compared to

KODA− inoc+ and the untreated control, which is accordance with the variation of

ABA concentration. The expressions of VvCYP707A1 in KODA+ inoc+ were highest

at 6 days after inoculation, which is consistent with PA levels.

3.3.3 Endogenous jasmonic acid (JA), expression of VvLOX and VvAOS,

ethylene production, and the changes in the O2− radical scavenging activities

JA concentrations in KODA+ inoc+ were higher than those in untreated

control and KODA− inoc+ at 9 days after inoculation (Fig. 3.3). The expression of

VvLOX and VvAOS were up-regulated significantly in KODA+ inoc+ than those in

KODA− inoc+ and untreated control samples at 6, 9, and 12 days after inoculation.

Ethylene production did not show significant differences among all the treatments

(data not shown). The O2− scavenging activities, presented as half maximal (50%)



60

effective concentration (EC50), which was defined as the concentration of substrate

that caused a 50% loss in O2− scavenging activities. Low EC50 values exhibit high

antioxidant activity. The EC50 values in KODA+ inoc+ were lowest at 6 and 9 days

after inoculation (Fig. 3.4).



61

Fig. 3.2. Endogenous (A) ABA and (B) PA concentrations, and quantitative real

time RT-PCR analysis of (C) VvNCED1 and (D) VvCYP707A1 in ‘Kyoho’ grape

skins after pathogen inoculation and KODA application. KODA solution was applied

24 h prior to inoculation. Data are the means ± SE of three replications. Different

letters indicate significant differences by Tukey-Kramer test at P ≤ 0.05. ns, not

significant.



62

Fig. 3.3 Quantitative real time RT-PCR analysis of (A) VvLOX and (B) VvAOS, and

endogenous (C) JA concentrations in ‘Kyoho’ grape skins after pathogen inoculation

and KODA application. KODA solution was applied 24 h prior to inoculation. Data

are the means ± SE of three replications. Different letters indicate significant

differences by Tukey-Kramer test at P ≤ 0.05.

0

50

100

150

200

250

300

350

0 3 6 9 12

JA (n

mol

/kg)

Days after inoculation (d)�

ns�a�

ns�

a�

b�ab�

b�

b�

(C)�



63

Fig. 3.4. Changes in O2− radical scavenging activity in ‘Kyoho’ grape skins of

untreated control (n), pathogen inoculation without KODA application (●), and

pathogen inoculation with KODA application (▲). KODA solution was applied 24 h

prior to inoculation. Data are the means ± SE of three replications. Different letters

indicate significant differences by Tukey-Kramer test at P ≤ 0.05.



64

3.3.4 Aroma volatiles

There were 67 kinds of aroma volatiles detected in grape skins, including

17 aldehydes, 26 alcohols, 18 esters, 2 terpenes and other trace of compounds (Table

3.2). Before inoculation (day 0), the totals of aroma volatiles were 152.6 mg kg-1, in

which quantities of aldehydes (78.1%) were highest, followed by alcohols (8.9%),

esters (11.1%), terpenes and ketone (1.0%). Compounds of aldehydes were primarily

comprised of C6-aldehydes including (E)-2-hexenal (73.4 mg kg-1), hexanal (36.7

mg kg-1), and cis-3-hexenal (6.8 mg kg-1) in ‘Kyoho’ grapes. The total of aroma

volatiles were 165.5 mg kg-1 in KODA+ inoc+,164.8 mg kg-1 in KODA− inoc+ and

194.1 mg kg-1 in the untreated control at 12 days after inoculation, respectively. The

total aroma volatiles reached a maximum in KODA+ inoc+ (260.4 mg kg-1) 6 days

after inoculation. Aldehyde concentrations in KODA+ inoc+ were significantly higher

than those in KODA− inoc+ and the untreated control at 6 and 9 days after inoculation

(Fig. 3.5A). The alcohol and ester concentrations in KODA+ inoc+ were significantly

higher than those in KODA− inoc+ and the untreated control at 3 and 6 days after

inoculation (Fig. 3.5B and C). Methyl salicylate (Me-SA) concentrations in KODA+

inoc+ were higher than those in other treatments at 6 and 9 days after inoculation (Fig.

3.5C). In addition, the concentrations of terpenes (α-Farnesene and its oxidation

product 6-methyl-5-hepten-2-one) in KODA+ inoc+ were highest after inoculation

(Fig. 3.5D).



65

Table 3.2. Primal aroma volatile compounds in ‘Kyoho’ grape skins after pathogen inoculation and KODA applicationa.

Concentrations (mg kg-1)

Control KODA−

inoc+

KODA+

inoc+

KIb Compounds 0 3 6 9 12 3 6 9 12 3 6 9 12

Alcohol

835 ethanol 3.0±0.4 12.9±0.5 10.9±1.9 15.2±0.3 26.3±4.6 5.8 ±1.0 9.5 ±1.6 33.4±3.

4 47.0±10.

0 6.8±2.2 14.8±1.4 41.6±4.4 47.5±4.8

1055 1-penten-3-ol trc 0.4±0.0 0.2±0.1 0.3±0.0 0.7±0.2 tr 0.2±0.0 1.4±0.6 0.8±0.1 0.4±0.1 NDd 0.4±0.2 1.6±0.0

1099

2-methyl-1-

butanol

1.0±0.3 0.6±0.2 0.9±0.0 1.1±0.1 1.1±0.1 0.9±0.1 1.1±0.2 1.0±0.3 1.3±0.2 0.8±0.1 1.4±0.1 0.8±0.1 1.5±0.1

1211 (Z)-2-penten-1-ol 0.7±0.1 0.7±0.0 0.4±0.0 0.9±0.0 1.0±0.3 0.7±0.1 0.7±0.2 1.3±0.2 0.7±0.2 0.5±0.1 1.0±0.1 0.8±0.2 0.9±0.3

1258 1-hexanol 0.8±0.1 1.2±0.0 0.6±0.1 0.8±0.1 0.6±0.0 1.2±0.2 1.1±0.2 0.6±0.1 0.9±0.1 0.8±0.0 2.1±0.2 1.6±0.1 0.9±0.1

1278 (Z)-3-hexen-1-

ol

0.8±0.1 0.6±0.0 0.5±0.1 ND 0.3±0.1 0.7±0.1 0.7±0.1 ND 0.4±0.2 0.9±0.0 1.0±0.1 0.9±0.2 0.2±0.1

1380 2-ethylhexanol 2.5±0.5 3.8±0.1 3.0±0.4 7.0±0.4 5.6±0.4 4.8±0.8 3.7±0.6 6.2±1.1 6.1±1.0 6.3±1.1 9.3±1.5 6.3±1.2 8.2±2.0

1801 Phenylethyl alcohol 0.4±0.1 0.6±0.0 0.5±0.0 1.6±0.2 1.9±0.2 0.6±0.1 0.7±0.1 1.5±0.2 2.0±0.1 0.7±0.1 1.9±0.1 0.7±0.2 2.7±0.4

Aldehyde

975 hexanal 36.7±6.7 44.6±0.4 40.7±4.0 40.0±2.4 37.0±1.8 39.9±8.3 39.0±6.0 29.4±2.

0 28.3±4.0 51.8±0.7 66.3±2.1 51.8±4.2 39.9±6.0

1035 cis-3-hexenal 6.8±1.8 6.2±0.6 3.1±0.3 1.2±0.4 1.8±0.2 2.8±0.2 2.8±0.5 2.0±0.1 0.6±0.3 2.9±0.8 5.0±0.2 2.9±0.2 2.6±0.2

1093 (Z)-2-hexenal ND 1.4±0.1 0.8±0.0 0.3±0.0 0.7±0.1 1.0±0.2 1.2±0.2 ND 0.3±0.1 1.1±0.1 1.5±0.1 1.1±0.0 0.6±0.1

1109 (E)-2-hexenal 73.4±11.7 66.7±2.1 68.0±9.1 62.1±5.9 55.6±1.

2 69.4±11.2

70.6±11.2

50.7±5.7 38.2±3.6 81.1±1.9 124.4±8.

5 81.1.8±4

.3 57.1±7.3

1288 nonanal 0.7±0.1 0.6±0.0 0.9±0.1 0.6±0.1 0.6±0.1 0.5±0.0 0.6±0.1 0.6±0.0 0.4±0.0 0.8±0.1 1.0±0.1 0.8±0.0 0.8±0.2

1539 Benzeneacetal

-dehyde

0.4±0.1 0.3±0.0 0.4±0.1 0.8±0.1 0.7±0.1 0.4±0.1 0.4±0.1 0.6±0.1 0.7±0.0 0.3±0.1 0.9±0.1 0.3±0.1 1.0±0.1

Ester

1019 hexyl butanoate 0.5±0.1 0.2±0.2 0.8±0.1 1.2±0.4 0.7±0.1 0.8±0.2 0.8±0.1 0.7±0.3 1.0±0.4 0.7±0.2 0.4±0.3 1.0±0.2 1.7±0.1

1228 (E)-2-hexenyl

acetate

tr tr ND 1.4±0.4 1.8±0.3 tr ND 0.7±0.6 2.5±0.6 0.7±0.3 0.3±0.0 1.3±0.2 1.8±0.4

1242 ethyl 2-hexenoate

ND ND ND 1.7±0.2 1.7±0.1 ND ND tr 2.2±0.2 tr tr 1.5±0.1 2.2±0.4

1304 3-heptene-1-yl acetate 2.1±0.4 1.1±0.3 tr 5.9±3.2 13.5±4.

7 1.4±0.9 0.3±0.1 7.8±4.8 20.9±7.5 7.8±5.2 2.2±2.4 5.9±2.1 10.7±4.0

1683 methyl salicylate

ND 0.6±0.0 0.3±0.1 0.3±0.1 0.3±0.0 1.1±0.1 0.4±0.2 0.5±0.1 0.2±0.0 0.5±0.1 1.2±0.3 1.0±0.1 0.4±0.1

1743 ethyl

(E,Z)-2,4-decadienoate

tr 1.0±0.0 2.0±0.5 0.8±0.2 0.7±0.1 1.3±0.2 0.8±0.2 2.0±0.2 0.6±0.1 2.0±0.6 1.7±0.1 0.9±0.2 0.7±0.3

Terpene

1456 α-Farnesene 0.4±0.1 0.6±0.1 0.4±0.0 0.6±0.1 0.7±0.0 0.7±0.1 0.6±0.1 0.5±0.1 0.5±0.1 0.8±0.1 1.1±0.1 0.8±0.1 0.6±0.1

1234

6-methyl-5-hepten-2-one 0.3±0.1 0.3±0.0 0.3±0.1 0.6±0.2 0.7±0.0 0.3±0.1 0.2±0.0 0.6±0.1 1.0±0.2 0.6±0.1 0.5±0.1 0.6±0.2 0.9±0.2

a Data are the means ± SE of three replications. b n-Alkanes were analyzed under the same conditions to calculate Kovats Index (KI) for the volatile compounds. c tr = relative concentration less than

0.2 mg kg-1

. d ND = relative concentration less than 0.1 mg kg-1

.



66

Fig. 3.5. The concentration of volatile compounds [(A) Aldehydes concentrations; (B)

Alcohol concentrations; (C) Ester concentrations; (D) Terpene concentrations] in

‘Kyoho’ grapes of untreated control (n), pathogen inoculation without KODA

application (●) and pathogen inoculation with KODA application (▲). KODA

solution was applied 24 h prior to inoculation. Data are the means ± SE of three

replications. Different letters indicate significant differences by Tukey-Kramer test at

P ≤ 0.05.



67

3.4 DISCUSSION

It has been shown that mechanical injury to leaf tissue in potato plants

(Solanum tuberosum) caused an increase in ABA and JA which were also observed

in our study (Dammann et al., 1997). The JA or ABA initiates the accumulation of

wound-inducible gene proteinase inhibitor II (pin2) in tomato and potato plants,

suggesting that the presence of a complex network for regulating the effects of the

plant hormones ABA and JA on gene expression upon wounding (Pena-Cortes et al.,

1995).

KODA application did not retard the pathogen spreading on the agar

medium (data not shown), which suggests that KODA treatment may increase the

tolerant activity by inducing second metabolite against pathogen infection in grape

berries. Allene oxide synthase (AOS) is a cytochrome P-450 (CYP74A) that

catalyzes the first step in the conversion of 13-hydroperoxy linolenic acid to

jasmonic acid and 9-hydroperoxy linolenic acid to KODA (Itoh et al., 2002). In our

study, KODA application induced accumulation of JA by activating the VvLOX and

VvAOS expression. It has been shown that pathogen-induced modulation of signaling

via phytohormones contributes to virulence (Robert-Seilaniantz et al., 2011). For

example, ABA is not only important for mediating abiotic stress responses but also

plays a multifaceted and pivotal role in plant immunity (Cao et al., 2011).



68

Meta-analysis of transcriptome profiles confirmed the role of JA in activation of P.

irregulare–induced defenses and ABA as an important regulator of defense gene

expression, which indicated the synergetic interaction of ABA and JA (Adie et al.,

2007). It has been shown that ABA may suppress SA biosynthesis and SA-mediated

defense responses (Audenaert et al., 2002; Thaler and Bostock, 2004). Whereas,

ABA-mediated stress signals regulated SA biosynthesis by inducing the SA

biosynthetic enzyme gene SID2 in Arabidopsis (Seo and Park, 2010), which shows

ABA signaling might act synergistically with SA signaling in triggering plant

immune response. Me-SA, which is a volatile ester converted from SA, were higher

in KODA+ inoc+ than those in KODA− inoc+ and the untreated control. Rojo et al.

(2003) and Takahashi et al. (2004) showed the antagonistic interaction between SA

and JA signaling pathway. However, Schenk et al. (2000) and Mur et al. (2006)

revealed the synergetic action of SA and JA in response to pathogens, which is in

accordance with our result. Volatile C6-aldehydes such as (E)-2-hexenal, and

(Z)-3-hexenal are important in defense against microbial pathogen and insect attacks

(Engelberth et al., 2004; Kishimoto et al., 2006). The activities of the key enzymes,

LOX and HPL in production of C6-aldehydes were determined in many species such

as strawberry (Fragaria × ananassa Duch.) and soybean (Glycine max L.) (Myung

et al., 2006; Zhuang et al., 1992). In my study, VvLOX encoded LOX enzyme was

induced in KODA+ inoc+, which suggest that C6 -aldehydes were accumulated by



69

activation of VvLOX in grape. Chalcone synthase (CHS), caffeic

acid-O-methyltransferase (COMT), diacylglycerol kinase1 (DGK1),

glutathione-S-transferase1 (GST1) and lipoxygenase2 (LOX2), which are induced by

jasmonate application, are induced with C6 -aldehydes against Botrytis cinerea in

Arabidopsis. Therefore, the interaction of KODA, JA and C6-aldehydes were

involved in oxylipin pathway (Kishimoto et al., 2005). C6-aldehyses can be

transformed to the corresponding alcohols and esters through the activity of ADH

and alcohol acyltransferase (AAT), respectively (D’Auria et al., 2007; Hamberg et

al., 1999). It has been shown that ADHs are dependent medium-chain

dehydrogenases that are involved in the response to a wide range of stresses,

including anaerobiosis and pathogen (Chase, 2000; Proels et al., 2011).

α-Farnesene is emitted by a number of plant tissues in response to herbivory,

wounding, pathogen and general defense. For instance, tobacco plants challenged

with Pseudomonas syringae bacteria increase the production of α-farnesene and

MeSA (Huang et al., 2003), which accords with our research. In this study, a

complex crosstalk of phytohormones against pathogen infection in grape berries

were preliminarily profiled by dissecting endogenous phytohormones and their

correlative genes. Not only JA and ABA, but also C6-aldehydes and terpenes induced

by KODA application may be resistant substances against pathogen interaction in

grape berries.



70

In summary, KODA application may play a role of resistance against

pathogen infection in grape berries. ABA, JA, and some aroma volatiles may be

associated with the resistance against pathogenic infection in grapes treated by

KODA.

Chapter 4 General conclusion

71

CHAPTER 4

GENERAL CONCLUSION


72

GENERAL CONCLUSION

In this study, the roles of JA and KODA that are the substances involved in

oxylipin pathway, on plant defense against fungal pathogen in grapes were

investigated. KODA may act a role in resistance to development of pathogen, which

was firstly demonstrated.

The level of endogenous JA was induced against to invasion of pathogen,

and showed higher concentration by the application of PDJ. The concentrations of

endogenous ABA also presented higher after inoculation and PDJ treatment, which

may be attributed in the increased expression of upstream enzyme gene VvNCED1

and downstream enzyme gene VvCYP707A1 in ABA biosynthetic pathway.

Synergistic and antagonistic effects have been reported in the interaction between the

ABA and JA signaling pathways (Moons et al., 1997; Staswick et al., 1992). A

cooperative function was exhibited between JA and ABA in our study. Aldehydes

and alcohols were mainly identified in large quantities during storage among all

groups, showing that volatile compounds in grapes predominantly consist of short

chain aldehydes and alcohols. (E)-2-hexenal was the most abundant volatile

compound identified in our study. It has been shown that t C6 aldehydes

((E)-2-hexenal and hexenal in our study) defensed against G. cingulate in grapes, in

keeping with previous report (Neri et al., 2006). Ester formation in grape berries


73

needs a supply of substrate (alcohols) and the ester-forming enzyme, AAT (Wang

and Luca, 2005). As the ester concentration significantly increased in PDJ treatment

with inoculation, PDJ application might have influenced the accumulation of esters

by the stimulating activity of AAT. The terpenes or terpenoids constitute the largest

class of secondary products that appear to play important defensive roles in plants

(Gershenzon et al., 1992). A significant increase of terpenes was detected 6 days

after inoculation in PDJ with inoculation. Ethanol has been considered germistatic

against fruit and vegetable decay microorganisms (Penicillium digitatum and

Colletotrichum musae in an in vitro experiment) (Utama et al., 2002). The aspect of

aroma volatile emission in plant defense mechanism may be different among plants.

The effect of KODA application on defensing pathogen in grape was

investigated in chapter 3. The JA and ABA were stimulated and accumulated after

KODA treatment with inoculation, suggesting that the presence of a complex

network between JA and ABA for regulating the effects of resistance to pathogen,

following previous research (Adie et al., 2007). KODA application did not retard the

pathogen spreading on the agar medium, which suggests that KODA treatment may

increase the tolerant activity by inducing second metabolite against pathogen

infection in grape berries. KODA application induced accumulation of JA by

activating the VvLOX and VvAOS expression. Me-SA, which is a volatile ester

converted from SA, were higher in KODA+ inoc+ than those in KODA− inoc+ and the


74

untreated control. ABA-mediated stress signals regulated SA biosynthesis by

inducing the SA biosynthetic enzyme gene SID2 in Arabidopsis (Seo and Park,

2010), which shows ABA signaling might act synergistically with SA signaling in

triggering plant immune response. Rojo et al. (2003) and Takahashi et al. (2004)

showed the antagonistic interaction between SA and JA signaling pathway. However,

Schenk et al. (2000) and Mur et al. (2006) revealed the synergetic action of SA and

JA in response to pathogens, which is in accordance with my result. Defense

responses involved in different signaling pathway are usually determined by

plant-pathogen interaction (Jones and Dangl, 2006). The interaction of KODA, JA,

and C6-aldehydes were involved in oxylipin pathway (Kishimoto et al., 2005).

Volatile C6 -aldehydes, JA were induced subjected to KODA application. JA and

C6-aldehydes are important in defense against microbial pathogen and insect attacks

(Li et al., 2005; Kishimoto et al., 2006). α-Farnesene is emitted by a number of plant

tissues in response to herbivory, wounding, pathogen and general defense, which

accords with this research (Huang et al., 2003). In my study, a complex crosstalk of

phytohormones against pathogen infection in grape berries were preliminarily

profiled by dissecting endogenous phytohormones and their correlative genes.

Summary

75

SUMMARY

The effects of the application of the jasmonic acid (JA) derivative n-propyl

dihydrojasmonate (PDJ) on lesion diameter, endogenous abscisic acid (ABA),

phaseic acid (PA), JA, aroma volatiles, and antioxidant activity were investigated in

grape berries infected by the pathogen Glomerella cingulata. The berries were

immersed in 0.4 mM PDJ solution before inoculation with the pathogen and stored at

25 °C for 12 days. Lesion diameters from the pathogen decreased upon PDJ

application. Endogenous ABA and JA concentrations increased in inoculated ‘Kyoho’

grape berries (Vitis labrusca × V. Vinifera). PDJ application before inoculation

increased ABA and PA concentrations, perhaps through the activation of VvNCED1

and VvCYP707A1 genes. The results suggest that the synergistic effect of JA and

ABA may play a role in the defence mechanism against pathogen infection in grape

berries. In addition, PDJ application generally increased the production of esters and

terpenes. These volatiles may also be associated with resistance to pathogen

infection.

Effects of α-ketol linolenic acid (KODA) application on endogenous ABA,

JA, and aroma volatiles were investigated in ‘Kyoho’ grape berries infected by a

pathogen (G. cingulata). The expressions of 9-cis epoxycaroteoid dioxigenase

(VvNCED1), ABA 8’-hydrixylase (VvCYP707A1), lipoxygenase (VvLOX), and allene

Summary

76

oxide synthase (VvAOS) were also examined. The grape berries were dipped in 0.1

mM KODA solution before inoculation with pathogen and stored at 25°C for 12 days.

The development of infection was significantly suppressed upon KODA treatment.

Endogenous ABA, JA, and phaseic acid (PA) were induced in inoculated berries.

KODA application before inoculation increased endogenous ABA, PA, and JA

through the activation of VvNCED1, VvCYP707A1, and VvAOS genes, respectively.

In addition, terpenes, methyl salicylate (Me-SA) and C6-aldehydes such as

(E)-2-hexenal and cis-3-hexenal associated with fungal resistance also increased in

KODA treated-fruit during storage. These results suggest that the synergistic effect

of JA, ABA, and some aroma volatiles induced by KODA application may be

responsible for the resistance against pathogen infection in grape berries.

Acknowlegement

77

ACKNOWLEGEMENT

It is a genuine pleasure to express my deepest sense of thanks and gratitude

to my advisor Professor Satoru Kondo. His timely advice, meticulous scrutiny and

scientific approach which helped me to a very great extent to accomplish my work. I

also owe a deep sense of gratitude to Professor Hitoshi Ohara, Senior Assistant

Professor Katsuya Ohkawa and Assistant professor Takanori Saito for their constant

inspirations, guidance, patience, encouragement and useful advices through my

research period. I am extremely thankful to Professor Masahiro Shishido, field of

biological environment in Chiba University, providing me valuable suggestions and

fungus applied in this research. I acknowledge with thanks the kindness of Assistant

Professor Hiromi Ikeura, Organization for the Strategic Coordination of Research

and Intellectual Properties in Meiji University, supporting extremely great extent

technical help in aroma volatiles analysis. I also extended my appreciation to

Professor Kazumitsu Miyoshi, field of Plant culture, Professor Masahiro Shishido

and Professor Hitoshi Ohara for their continuous guidance, comments, and

suggestions to complete this thesis.

I would like to express my thanks to all the members of Professor Kondo’s

Laboratory for their continuous encouragement, helpful cooperation, good friendship

and pleasant surroundings throughout the period of my doctor’s program.

Acknowlegement

78

Finally, I am very grateful for the love and support from my family and

friends, without their inspiration and dedication, this task would not have been

possible.

References

79

REFERENCES

References

80

REFERENCES

Abeles F.B., Margan P.W., Saltveit M.E. (1992) Ethylene in plant biology.

Academic Press, San Diego, California. pp. 414.

Adie B.A.T., Pérez-Pérez J., Pérez-Pérez M.M., Godoy M., Sánchez-Serrano J.J.,

Schmelz E.A., Solano R. (2007) ABA is an essential signal for plant resistance

to pathogens affecting JA biosynthesis and the activation of defenses in

Arabidopsis. Plant Cell 19: 1665-1681.

Afitlhile M.M., Fukushige H., Nishimura M., Hildebrand D.F. (2005) A defect in

glyoxysomal fatty acid beta-oxidation reduces jasmonic acid accumulation in

Arabidopsis. Plant Physiol. Bioch. 43: 603-609.

Akacha N.B., Boubaker O., Gargouri M. (2005) Production of hexenol in a

two-enzyme system: Kinetic study and modelling. Biotechnol. Lett. 27:

1875-1878.

Albacete A., Ghanem M.E., Martínez-Andújar C., Acosta M., Sánchez-Bravo J.,

Martínez V., Lutts S., Dodd I.C., Pérez-Alfocea F. (2008) Hormonal changes in

relation to biomass partitioning and shoot growth impairment in salinized

tomato (Solanum lycopersicum L.) plants. J. Exp. Bot. 59: 4119-4131.

Alvarez M. E. (2000) Salicylic acid in the machinery of hypersensitive cell death and

disease resistance. Plant Mol. Biol. 44: 429-442.

Anderson J.P., Badruzsaufari E., Schenk P.M., Manners J.M., Desmond O.J., Ehlert

C., Maclean D.J., Ebert P.R., Kazan K. (2004) Antagonistic interaction between

abscisic acid and jasmonate-ethylene signaling pathways modulates defense

gene expression and disease resistance in Arabidopsis. Plant Cell 16:3460-3479.

References

81

Audenaert K., De Meyer G.B., Höfte M.M. (2002) Abscisic acid determines basal

susceptibility of tomato to B. cinerea and suppresses salicylic acid dependent

signaling mechanisms. Plant Physiol. 128: 491-501.

Bate N.J., Rothstein S.J. (1998). C6-volatiles derived from the lipoxygenase pathway

induce a subset of defense-related genes. Plant J. 16: 561-569.

Bent A.F., Innes R.W., Ecker J.R., Staskawicz B.J. (1992) Disease development in

ethylene-insensitive Arabidopsis thaliana infected with virulent and avirulent

Pseudomonas and Xanthomonas pathogens. Mol. Plant-Microbe Interact. 5:

372-378.

Berger R.G. (2007) Flavours and Fragrances-Chemistry, Bioprocessing and

Sustainability. Springer Science & Business Media: Berlin, German.

Bleecker A.B., Kende H. (2000) Ethylene: a gaseous signal molecule in plants.

Annu .Rev. Cell Dev. Biol. 16: 1-18.

Bohlmann J., Gilbert Meyer-Gauen G., Croteau R. (1998) Plant terpenoid synthases:

molecular biology and phylogenetic analysis. Proc. Natl. Acad. Sci. 95:

4126-4133.

Cao F.Y., Yoshioka K., Desveaux D. (2011) The roles of ABA in plant-pathogen

interactions. J. plant Res. 124: 489-499.

Cao H., Bowling S.A., Gordon S., Dong X. (1994) Characterization of an

Arabidopsis mutant that is nonresponsive to inducers of systemic acquired

resistance. Plant Cell 6: 1583-1592.

Chan H.W.S. (1987) Autoxidation of Unsaturated Lipids. Academic Press: London,

UK.

Chase T.J. (2000) Alcohol dehydrogenases: identification and names for gene

families. Plant Mol. Rep. 17: 333-350.

References

82

Chernys J.T., Zeevaart J.A. (2000) Characterization of the 9-cis-epoxycarotenoid

dioxygenase gene family and the regulation of abscisic acid biosynthesis in

avocado. Plant Physiol. 124: 343-353.

Cho S.M., Kang B.R., Kim J.J., Kim Y.C. (2012) Induced systemic drought and salt

tolerance by pseudomonas chlororaphis O6 root colonization is mediated by

ABA-independent stomatal closure. J. Plant Pathol. 28: 202-206.

Christensen P., Ramming D., Andris H. (1983) Seed trace development of

‘Fiesta’raisins. Am. J. Enol. Viticul. 34: 257-259.

Coombe B.G., Hale C.R. (1973) The hormone content of ripening grape berries and

the effects of growth substance treatments. Plant Physiol. 51: 629-634.

Coombe B.G. (1976) The development of fleshy fruits. Ann. Rev. Plant Physiol. 27:

507-28.

Coombe B.G., Bishop G.R. (1980) Development of the grape berry. II. Changes in

diameter and deformability during veráison. Aust. J. Grape Wine Res. 31:

499-509.

Coquoz J.L., Buchala A., Meuwly P. Métraux, J.P. (1995) Arachidonic acid induces

local but not systemic synthesis of salicylic acid and confers systemic resistance

in potato plants to Phytophthora infestans and Alternaria solani. Phytopathol.

85: 1219-1224.

Creelman R.A., Mullet J.E. (1997) Biosynthesis and action of jasmonates in plants.

Annu. Rev. Plant Physiol. Plant Mol. Biol. 48: 355-381.

Cruz Castillo M., Martinez C., Buchala A., Métraux J.P., Leon, J. (2004)

Gene-specific involvement of beta-oxidation in wound-activated responses in

Arabidopsis. Plant Physiol. 135: 85-94.

Dammann C., Rojo E., Sánchez-Serrano J.J. (1997) Abscisic acid and jasmonic acid

References

83

activate wound-inducible genes in potato through separate, organ-specific signal

transduction pathways. Plant J. 11: 773-782.

Dangl J.L., Jones J.D. (2011) Plant pathogens and integrated defense responses to

infection. Nature 411: 826-833.

D’Auria J.C., Pichersky E., Schaub A., Hansel A., Gershenzon J. (2007)

Characterization of a BAHD acyltransferase responsible for producing the green

leaf volatile (Z)-3-hexen-1-yl acetate in Arabidopsis thaliana. Plant J. 49:

194-207.

De Laat C.M.M., Van Loon L.C. (1983) The relationship between stimulated

ethylene production and symptom expression in virus-infected tobacco leaves.

Physiol. Plant Pathol. 22: 261-273.

Delaney T., Uknes S., Vernooij B., Friedrich L., Weymann K., Negrotto D., Gaffney

T., Gut-Rella M., Kessmann H., Ward E., and Ryals J. (1994) A central role of

salicylic acid in plant disease resistance. Science 266: 1247-1250.

Denancé N., Sánchez-Vallet A., Goffner D., Molina A. (2013) Disease resistance or

growth: the role of plant hormones in balancing immune responses and fitness

costs. Front. Plant Sci. 4: 1-12.

De Pooter H.L., Montens J.P., Dirinck J., Willaert G.A., Schamp N.M. (1983)

Treatment of Golden Delicious apple with aldehydes and carboxylic acids:

Effect on the headspace composition. J. Agric. Food Chem. 37: 813-818.

Dieguez S.C., Lois L.C., Gomez E.F., De Ia Pena M.L.G. (2003) Aromatic

composition of the Vitis vinifera grape Albariño. LWT-Food Sci. Technol. 36:

585-590.

Dong X. (1998) SA, JA, ethylene, and disease resistance in plants. Curr. Opin. Plant

Biol. 1: 316-323.

References

84

El Hadi M.A.M., Zhang F.J., Wu F.F., Zhou C.H., Tao J. (2013) Advances in fruit

aroma volatile research. Molecules 18: 8200-8229.

Engelberth J., Alborn H.T., Schmelz E.A., Tumlinson J.H. (2004) Airborne signals

prime plants against insect herbivore attack. Plant Bio. 101: 1781-1785.

Fa ̈ldt J., Martin D., Miller B., Rawat S., Bohlmann J. (2003) Traumatic resin

defense in Norway spruce (Picea abies): methyl jasmonate-induced terpene

synthase gene expression, and cDNA cloning and functional characterization of

(+)-3-carene synthase. Plant Mol. Biol. 51:119-133.

Fall R., Karl T., Hansel A., Jordan A., Lindiger W. (1999) Volatile organic

compounds emitted after leaf wounding: On-line analysis by

proton-transfer-reaction mass spectrometry. J. Geophys. 104: 963-974.

Fan J., Hill L., Crooks C., Doerner P., Lamb C. (2009) Abscisic acid has a key role

in modulating diverse plant-pathogen interactions. Plant Physiol. 150:

1750-1761.

Farag M.S., Fokar M., Zhang H.A., Allen R.D., Pare P.W. (2005) (Z)-3-hexenol

induces defense genes and downstream metabolites in maize. Planta

220: 900-909.

Feussner I., Wasternack C. (2002) The lipoxygenase pathway. Annu. Rev. Plant

Physiol. 53: 275-297.

Feys B. J., Parker J. E. (2000) Interplay of signaling pathways in plant disease

resistance. Trends Genet. 16: 449-455.

Fobert P.R., Despres C. (2005) Redox control of systemic acquired resistance. Curr.

Opin. Plant Biol. 8: 378-382.

References

85

Franceschi V.R., Krekling T., Christiansen E. (2002) Application of methyl

jasmonate on Picea abies (Pinaceae) stems induces defense-related responses in

phloem and xylem. Am. J. Bot. 89: 578-586.

Fraser R.S.S. (1982) Are ‘pathogenesis-related’ proteins involved in acquired

systemic resistance of tobacco plants to tobacco mosaic virus? J. Gen. Virol. 58:

305-313.

Fujita A, Soma N., Goto-Yamamoto N., Mizuno A., Kiso K., Hashizume K. (2007)

Effect of shading on proanthocyanidin biosynthesis in the grape berry. J. Japan.

Soc. Hort. Sci. 76: 112-119.

Gentile I.C., Matta C. (1975) Production of and some effects of ethylene in relation

to Fusarium wilt of tomato. Physiol. Plant Pathol. 5: 27-35.

Gershenzon J., McCaskill D., Rajaonarivony J.I.M., Mihaliak C., Karp F., Croteau R.

(1992) Isolation of secretory cells from plant glandular trichomes and their use

in biosynthetic studies of monoterpenes and other gland products. Anal.

Biochem. 200: 130-138.

Glazebrook J. (2001) Genes controlling expression of defense responses in

Arabidopsis-2001 status. Curr. Opin. Plant Biol. 4: 301-308.

Goff S.A., Klee H.J. (2006) Plant volatile compounds: Sensory cues for health and

nutritional value. Science 311: 815-819.

Goto M., Yaguchi Y., Hyodo H. (1980). Ethylene production in citrus leaves infected

with Xanthomonas citri and its relation to defoliation. Physiol. Plant Pathol. 16:

343-350.

Grossmann K., Scheltrup F., Kwiatowski J., Caspar G. (1996) Induction of abscisic

acid is a common effect of auxin hericides in susceptible plants. Plant

Physiol. 149: 475-478.

References

86

Hadi M.A.M.E., Zhang F.J., Wu F.F., Zhou C.H., Tao J. (2013) Advances in Fruit

Aroma Volatile Research. Molecules. 18: 8200-8229.

Hamberg M., Hubner Y., Bruhlmann F., Schwab W. (2003) Alternative pathway for

the formation of 4,5-dihydroxy-2,3-pentanedione, the proposed precursor of

4-hydroxy-5-methyl-3(2H)-furanone as well as autoinducer-2, and its detection

as natural constituent of tomato fruit. Biochim. Biophys. Acta 1623: 109-119.

Hammond-Kosack K.E., Jones J.D.G. (1996) Resistance gene-dependent plant

defense responses. Plant Cell 8:1773-1791.

Hardie W.J., O’Brien T.P., Jaudzems V.G. (1996) Morphology, anatomy and

development of the pericarp after anthesis in grape Vitis vinifera L. Austral. J.

Grape Wine Res. 2: 97-142.

Harris J.M., Kriedemann P.E., Possingham J.V. (1968) Anatomical aspects of grape

berry development. Vitis 7: 106-19.

Hatanaka A., Kajiwara T., Sekiya J. (1987) Biosynthesis pathway for C6-aldehydes

formation from linolenic acid in green leaves. Chem. Phys. Lipids 44: 341-361.

Heiden A.C., Kobel K., Langebartels C. (2003) Emissions of oxygenated volatile

organic compounds from plants Part I: Emissions from lipoxygenase activity. J.

Atmos. Chem. 45: 143-172.

Hopkins W.G., Hüner N.P.A. (2008) Introduction to Plant Physiology, 4th Edition.

pp. 528. John Wiley and Sons Ltd. UK.

Huang J., Cardoza Y.J., Schmelz E.A., Raina R., Engelberth J., Tumlinson J.H.

(2003) Differential volatile emissions and salicylic acid levels from tobacco

plants in response to different strains of Pseudomonas syringae. Planta 217:

767-775.

Itoh A., Schilmiller A.L., McCaig B.C., Howe G.A. (2002) Identification of a

References

87

jasmonate-regulated allene oxide synthase that metabolizes 9-hydroperoxides of

linoleic and linolenic acids. J. Biol. Chem. 277: 46051-46058.

Iuchi S., Kobayashi M., Taji T., Naramoto M., Seki M., Kato T., Tabata S., Kakubari

Y., Yamaguchi-Shinozaki K., Shinozaki K. (2001) Regulation of drought

tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key

enzyme in abscisic acid biosynthesis in Arabidopsis. Plant J. 27: 325-333.

Iuchi S., Kobayashi M., Yamaguchi-Shinozaki K., Shinozaki K. (2000) A

stress-inducible gene for 9-cis-epoxycarotenoid dioxygenase involved in

abscisic acid biosynthesis under water stress in drought-tolerant cowpea. Plant

Physiol. 123: 553-562.

Johnson P.R., Ecker J.R. (1998) The ethylene gas signal transduction pathway: a

molecular perspective. Annu. Rev. Genet. 32: 227-254.

Jones J.D., Dangl J.L. (2006) The plant immune system. Nature 444, 323-329.

Kalua C.M., Boss P.K. (2010) Comparison of major volatile compounds from

Riesling and Cabernet Sauvignon grapes (Vitis vinifera L.) from fruitset to

harvest, Aust. J. Grape Wine Res. 16: 337-348.

Kennedy J. (2002) Understanding grape berry development. Pract. Winery Vineyard

4: 1-5.

Kessler A., Halitschke R., Baldwin I.T. (2004) Silencing the jasmonate cascade:

induced plant defenses and insect populations. Science 305: 665-668.

Kishimoto K., Matsui K., Ozawa R., Takabayashi J. (2005) Volatile C6-aldehydes

and Allo-onimene activate defense genes and induce resistance against Botrytis

cinerea in Arabidopsis thaliana. Plant Cell Physiol. 46: 1093-1102.

Kishimoto K., Matsui K., Ozawa R., Takabayashi J. (2006) ETR1-, JAR1- and

PAD2-dependent signaling pathways are involved in C6-aldehyde-induced

References

88

defense responses of Arabidopsis. Plant Sci.: Int. J. Exp. Plant Biol.

171: 415-423.

Kishimoto K., Matsui K., Ozawa, R., Takabayashi J. (2006) Components of

C6-aldehyde-induced resistance in Arabidopsis thaliana against a necrotrophic

fungal pathogen, Botrytis cinerea. Plant Sci. 170: 715-723.

Kittikorn M., Shiraishi N., Okawa K., Ohara H., Yokoyama M., Ifuku O., Yoshida S.,

Kondo S. (2010) Effect of fruit load on 9,10-ketol-octadecadienoic acid

(KODA), GA and jasmonic acid concentrations in apple buds. Sci. Hort. 124:

225-230.

Kondo S., Mattheis J. (2006) Aroma volatile biosynthesis in apples at harvest or after

harvest affected by jasmonate. International Conference on Managing Quality in

Chains-The Integrated View on Fruits and Vegetables Quality 712: 381-388.

Kondo S., Kittikorn M., Kanlayanarat S. (2005) Preharvest antioxidant activities of

tropical fruit and the effect of low temperature storage on antioxidants and

jasmonates. Postharvest Biol. Technol. 36: 309-318.

Kondo S., Sugaya S., Sugawa S., Ninomiya M., Kittikorn M., Okawa K., Ohara

H., Ueno K., Todoroki Y., Mizutani M., Hirai N. (2012) Dehydration tolerance

in apple seedlings is affected by an inhibitor of ABA 8'-hydroxylase CYP707A.

J. Plant Physiol. 169: 234-241.

Kondo S., Tomiyama A., Seto H. (2000) Changes of endogenous jasmonic acid and

methyl jasmonate in apples and sweet cherries during fruit development. J. Am.

Soc. Hortic. Sci. 125: 282-287.

Kondo S., Tomiyama, H., Rodyoung A., Okawa K., Ohara H., Sugaya S. (2014)

Abscisic acid metabolism and anthocyanin synthesis in grape skin are affected

by light emitting diode (LED) irradiation at night. J. Plant Physiol. 171:

References

89

823-929.

Kondo S., Yamada H., Setha S. (2007) Effect of jasmonates differed at fruit ripening

stages on 1-aminocyclopropane-1-carboxylate (ACC) synthase and ACC

oxidase gene expression in pears. J. Am. Soc. Hortic. Sci. 132: 120-125.

Lavee S. and Nir G. (1986) Grape. In CRC handbook of fruit set and development.

pp. 167-191. Boca Raton: CRC Press.

Lea A.G.H. (1995) Apple juice. In Production and Packaging of Non-Carbonated

Fruit Juices and Fruit Beverages, 3rd ed. pp. 153-196. Springer: Berlin,

Germany.

Li C., Schilmiller A.L., Liu G., Lee G.I., Jayanty S., Sageman C., Vrebalov J.,

Giovannoni J.J., Yagi K., Kobayashi Y., Howe G.A. (2005) Role of α-oxidation

in jasmonate biosynthesis and systemic wound signaling in tomato. Plant Cell

17: 971-986.

Lodeman E.G. (1890) Some grape troubles of western New York. Ripe rot. Cornell

Univ. Agr. Exp. Sta. Bul. 76: 448-1894.

Maffei M.E. (2010) Changes in biosynthesis of aroma volatile compounds during

on-tree maturation of “Pink Lady” apples. South Afr. J. Bot. 76: 612-631.

Martin D., Tholl D., Gershenzon J., Bohlmann J. (2002) Methyl jasmonate induces

traumatic resin ducts, terpenoid resin biosynthesis, and terpenoid accumulation

in developing xylem of Norway spruce stems. Plant Physiol. 129: 1003-1018.

Martin D.M., Gershenzon J., Bohlmann J. (2003) Induction of volatile terpene

biosynthesis and diurnal emission by methyl jasmonate in foliage of Norway

spruce. Plant Physiol. 132: 1586-1599.

Matsui K. (2006) Green leaf volatiles: Hydroperoxide lyase pathway of oxylipin

metabolism. Curr. Opin. Plant Biol. 9: 274-280.

References

90

Moons A., Prinsen E., Bauw G., Montagu V.M. (1997) Antagonistic effects of

abscisic acid and jasmonates on salt stress-inducible transcripts in rice roots.

Plant Cell. 9: 2243-2259.

Mohr P.G., Cahill D.M. (2001) Relative roles of glyceollin, lignin and the

hypersensitive response and the influence of ABA in compatible and

incompatible interactions of soybeans with Phytophthora sojae. Physiol. Mol.

Plant Pathol. 58: 31-41.

Mur L.A.J., Kenton P., Atzorn R., Miersch O., Wasternack C. (2006) The outcomes

of concentration-specific interactions between salicylate and jasmonate

signaling include synergy, antagonism, and oxidative stress leading to cell

death. Plant Physiol. 140: 249-262.

Myung K., Hamilton-Kemp T.R., Archbold D.D. (2006) Biosynthesis of

trans-2-hexenal in response to wounding in strawberry fruit. J. Agric. Food

Chem. 54: 1442-1448.

Nambara E., Marion-Poll A. (2005) Abscisic acid biosynthesis and catabolism. Annu.

Rev. Plant Biol. 56: 165-185.

Neri F., Mari M., Brigati S. (2006) Control of Penicillium expansum by plant volatile

compounds. Plant Physiol. 55: 100-105.

Nimitkeatkai H., Shishido M., Okawa K., Ohara H., Ban Y., Kita M., Moriguchi T.,

Ikeura H., Hayata Y., Kondo S. (2011) Effect of jasmonates on ethylene

biosynthesis and aroma volatile emission in Japanese apricot infected by a

pathogen (Colletotrichum gloeosporioides). J. Agri. Food chem. 59: 6423-6429.

Ohkawa K., Ohara H., Kurita Y., Fukuda T., Khan Z.U., Matsui H. (2006) Thinning

effect of jasmonic acid derivative, n-propyl dihydrojasmonate on Japanese pear.

J. Jpn. Soc. Hortic. Sci. 75: 129-134.

References

91

Park J.H., Halitschke R., Kim H.B., Baldwin I.T., Feldmann K.A., Feyereisen R.

(2002) A knock-out mutation in allene oxide synthase results in male sterility

and defective wound signal transduction in Arabidopsis due to a block in

jasmonic acid biosynthesis. Plant J. 31: 1-12.

Pathuri I.P., Reitberger I.E., Proels R.K. (2011) Alcohol dehydrogenase 1 of barley

modulates susceptibility to the parasitic fungus Blumeria graminisf.sp. hordei. J.

Exp. Bot. 62: 3449-3457.

Pegg G.F., Cronshaw D.K. (1976). Ethylene production in tomato plants infected

with Verticillium alboatrum. Physiol. Plant Pathol. 8: 279-295.

Pena-Cortes H., Fisahn J., Willmitzer L. (1995) Signals involved in wound-induced

proteinase inhibitor II gene expression in tomato and potato plants. Proc. Natl.

Acad. Sci. U.S.A. 92: 4106-4113.

Pratt C. (1971) Reproductive anatomy in cultivated grapes: A review. Am. J. Enol.

Viticul. 22: 93-109.

Proels R.K., Westermeier W., Hückelhoven R. (2011) Infection of barley with the

parasitic fungus Blumeria graminis f. sp hordei results in the induction of

HvADH1 and HvADH2. Plant signal. Behav. 6: 1584-1587.

Qin X.Q., Zeevaart J.A.D. (1999) The 9-cis-epoxycarotenoid cleavage reaction is the

key regulatory step of abscisic acid biosynthesis in water-stressed bean. Proc.

Natl. Acad. Sci. U.S.A. 96: 15354-15361.

Rairdan G.J., Delaney T.P. (2002) Role of salicylic acid and NIM1/ NPR1 in

race-specific resistance in Arabidopsis. Genetics 161: 803-811.

Ramírez-Suero M., Bénard-Gellon M., Chong J., Laloue H., Stempien E.,

Abou-Mansour E., Fontaine F., Larignon P., Mazet-Kieffer F., Farine S.,

Bertsch C. (2014) Extracellular compounds produced by fungi associated with

References

92

Botryosphaeria dieback induce differential defence gene expression patterns and

necrosis in Vitis vinifera cv. Chardonnay cells. Protoplasma 251: 1417-1426.

Reineccius G. (2006) Flavor Chemistry and Technology, 2nd ed. CRC Press: Boca

Raton, FL. USA.

Ribnicky D.M., Shulaev V.V., Raskin I.I. (1998) Intermediates of salicylic acid

biosynthesis in tobacco. Plant Physiol. 118: 565-572.

Robert-Seilaniantz A., Navarro L., Bari R., Jones J.D.G. (2007) Pathological

hormone imbalances. Curr. Opin. Plant Biol. 10: 372-379.

Robert-Seilaniantz A., Grant M., Jones J.D.G. (2011) Hormone crosstalk in plant

disease and defense: more than just jasmonate-salicylate antagonism. Annu.

Rev. Phytopathol. 49: 317-343.

Rojo E., Solano R., Sanchez-Serrano J.J. (2003) Interactions between signaling

compounds involved in plant defense. J. Plant Growth Regul. 22: 82-98.

Rosahl S., Feussner I. (2004) Oxylipins, Plant Lipids: Biology, Utilization and

Manipulation. pp. 329-454.

Sanz C., Olias J.M., Perez A.G. (1997) Aroma biochemistry of fruits and vegetables.

In Phytochemistry of Fruit and Vegetables; Oxford University Press Inc.: New

York, NY, USA. pp. 121-155.

Schneider K., Kienow L., Schmelzer E., Colby T., Bartsch M., Miersch O.,

Wasternack C., Kombrink E., Stuible, H P. (2005) A new type of peroxisomal

acyl-coenzyme A synthetase from Arabidopsis thaliana has the catalytic

capacity to activate biosynthetic precursors of jasmonic acid. J. Biol. Chem. 280:

13962 -13972.

Schwab W., Schreier P. (2002) Enzymic formation of flavor volatiles from lipids. In

Lipid Biotechnology. Marcel Dekker, NY. USA. 293-318.

References

93

Schreier P. (1984) Chromatographic Studies of Biogenesis of Plant Volatiles. Alfred

Hüthig Verlag GmbH, Heidelberg, Germany.

Seo P.J., Park C. (2010) MYB96-mediated abscisic acid signals induce pathogen

resistance response by promoting salicylic acid biosynthesis in Arabidopsis.

New Phytologist. 186: 471-483.

Shenk P.M., Kazan K., Wilson I., Anderson J.P., Richmond T., Somerville S.C.,

Manners J.M. (2000) Coordinated plant defense responses in Arabidopsis

revealed by microarray analysis. Proc. Natl. Acad. Sci. U.S.A. 97:

11655-11660.

Southworth E.A. (1981) Ripe rot of grapes and apples. J. Mycology 6: 164-173.

Spanu P., Boller T. (1989) Ethylene biosynthesis in tomato plants infected by

Phytophthora infestans. J. Plant Physiol. 134: 533-537.

Spartz A.K., Gray W.M. (2008) Plant hormone receptors: new perceptions. Genes

Dev. 612: 625-1738.

Staswick P.E., Su W., Howell S.H. (1992) Methyl jasmonate inhibition of root

growth and induction of leaf protein are decreased in an Arabidopsis thaliana

mutant. Proc. Natl. Acad. Sci. U.S.A. 89: 6837-6840.

Staskawicz B.J., Mudgett M.B., Dangl J.L., Galan J.E. (2001) Common and

contrasting themes of plant and animal diseases. Science 292: 2285-2289.

Stelmach B. A., Muller A., Hennig P., Gebhardt S., Schubert-Zsilavecz M., Weiler

E.W. (2001) A novel class of oxylipins,

sn1-O-(12-oxophytodienoyl)-sn2-O-(hexadecatrienoyl)-monogalactosyl

diglyceride, from Arabidopsis thaliana. J. Biol. Chem. 276: 12832-12838.

Stumpe M., Feussner I. (2006) Formation of oxylipins by CYP74 enzymes.

Phytochem. Rev. 5: 347-357. Proc. Natl. Acad. Sci. U.S.A. 97: 11655-11660.

References

94

Song M.S., Kim D.G., Lee S.H. (2005) Isolation and characterization of a jasmonic

acid carboxyl methyltransferase gene from hot pepper (Capsicum annuum L.). J.

Plant Biol. 48: 292-297.

Sun L., Zhang M., Ren J., Qi J., Zhang G., Leng P. (2010) Reciprocity between

abscisic acid and ethylene at the onset of berry ripening and after harvest. BMC

Plant Biol. 10: 257-268.

Suzuki M., Yamaguchi S., Iida T., Hashimoto I., Teranishi H., Mizoguchi M., Yano

F., Todoroki Y., Watanabe N., Yokoyama M. (2003) Endogenous (α-ketol

linolenic acid levels in short day-induced cotyledons are closely related to

flower induction in Pharbitis nil. Plant Cell Physiol. 44: 35-43.

Taiz L., Zeiger E. (2002) Plant Physiology, 3rd Edtion. Sinauer Associates,

Sunderland, MA. pp. 690.

Takahashi H., Kanayama Y., Zheng M.S., Kusana T., Hase S., Ikegami M., Shah J.

(2004) Antagonistic interactions between the SA and JA signaling pathways in

Arabidopsis modulate expression of defense genes and gene-for-gene resistance

to cucumber mosaic virus. Plant Cell Physiol. 45: 803-809.

Thaler S.J., Bostock R.M. (2004) Interactions between abscisic-acidmediated

responses and plant resistance to pathogens and insects. Ecology 85: 48-58.

Thomma B.P., Penninckx I.A., Cammue B.P., Broekaert W.F. (2001) The

complexity of disease signaling in Arabidopsis. Curr. Opin. Immunol. 13:

63-68.

Turner J.G., Ellis C., Devoto A. (2002) The jasmonate signal pathway. Plant Cell 14:

153-164.

Tuteja N., Sopory S.K. (2008) Chemical signaling under abiotic stress environment

in plants. Plant Signal. Beh. 3: 525-536.

References

95

Uhlig B.A., Clingeleffer P.R. (1998) Ripening characteristics of the fruit from

Vitis vinifera L. drying cultivars sultana and Merbein seedless under furrow

irrigation. Am. J. Enol. Vitic. 49: 375-382.

Utama I.M.S., Wills R.B.H., Ben-yehoshua S., Kuek A.C. (2002) In vitro efficacy of

plant volatiles for inhibiting the growth of fruit and vegetable decay

microorganisms. J. Agric. Food Chem. 50: 6371-6377.

Veesschauwer D.D., Yang Y., Cruz C.V., Höfte M. (2010) Abscisic acid-induced

resistance against the brown spot pathogen Cochliobolus miyabeanus in rice

involves MAP kinase-mediated repression of ethylene signaling. Plant Physiol.

152: 2036-2052.

Vick B.A., Zimmerman D.C. (1984) Biosynthesis of jasmonic acid by several plant

species. Plant Physiol. 75: 458–461.

Vikram A., Prithiviraj B., Hamzehzarghani H., Kushalappa A.C. (2004) Volatile

metabolite profiling to discriminate diseases of McIntosh apple inoculated with

fungal pathogens. J. Sci. Food Agr. 84: 1333-1340.

Von Malek B., van der Graaff E., Schneitz K., Keller B. (2002) The Arabidopsis

male-sterile mutant dde2-2 is defective in the allene oxide synthase gene

encoding one of the key enzymes of the jasmonic acid biosynthesis pathway.

Planta 216: 187-192.

Wang J.H., Luca V.D. (2005) The biosynthesis and regulation of biosynthesis of

Concord grape fruit esters, including ‘foxy’ methylanthranilate. J. Plant. 44:

606-619.

Weir B.S., Johnston P.R., Damm U. (2012) The Colletotrichum gloeosporioides

species complex. Stud. Mycol. 73: 115-180.

Whenham R.J., Fraser R.S.S., Brown L.P., Payne J.A. (1986) Tobacco mosaic

References

96

virus-induced increase in abscisic acid concentration in tobacco leaves:

intracellular location in light and dark green areas, and relationship to symptom

development. Planta 168: 592-598.

Wildermuth M.C., Dewdney J., Wu G., Ausubel F.M. (2001) Iso-chorismate

synthase is required to synthesize salicylic acid for plant defence. Nature

414:562-565.

Yamaguchi-Shinozaki K. and Shinozaki K. (1993) The plant hormone abscisic acid

mediates the drought-induced expression but not the seed-specific expression of

rd22, a gene response to dehydration stress in Arabidopsis thaliana. Mol. Gen.

Genet. 238: 17-25.

Yamaguchi S., Yokoyama M., Iida T., Okai M., Tanaka O., Takimoto A. (2001)

Identification of a component that induces flowering of Lemna in the products

of the reaction between α-ketol linolenic acid (FIF) and norepinephrine. Plant

Cell Physiol. 42: 1201-1209.

Yokoyama M., Yamaguchi S., Inomata S., Komatsu K., Yoshida S., Iida T.,

Yokokawa Y., Yamaguchi M., Kaihara S., Takimoto A. (2000) Stress-induced

factor involved in flower formation of Lemna is an α-ketol derivative of

linolenic acid. Plant Cell Physiol. 41: 110-113.

Yokoyama M., Yamaguchi S., Iida T., Suda A., Saeda T., Miwa T., Ujihara K.,

Nishio J. (2005) Transient accumulation of (α-ketol linolenic acid (KODA) in

immature flower buds of some ornamental plants. Plant Biotech. 22: 201-205.

Ziosi V., Bonghi C., Bregoli A.M., Trainotti L., Biondi S., Sutthiwal S., Kondo S.,

Costa G., Torrigiani P. (2008) Jasmonate-induced transcriptional changes

suggest a negative interference with the ripening syndrome in peach fruit. J. Exp.

Bot. 59: 563-573.

References

97

Zhuang H., Thomas R., Hamilton-Kemp T.R., Andersen R.A., Hildebrand D.F.

(1992) Developmental change in C6-aldehyde formation by soybean leaves.

Plant Physiol. 100: 80-87.

Effects of oxylipin on pathogen infection,...

Documents

Transcript of Effects of oxylipin on pathogen infection,...