This article was downloaded by: [University of Central Florida]On: 30 September 2013, At: 03:02Publisher: RoutledgeInforma Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,37-41 Mortimer Street, London W1T 3JH, UK

Nutrition and CancerPublication details, including instructions for authors and subscription information:http://www.tandfonline.com/loi/hnuc20

Effects of Lactobacillus Rhamnosus GG on the CellGrowth and Polyamine Metabolism in HGC-27 HumanGastric Cancer CellsFrancesco Russo a , Antonella Orlando a , Michele Linsalata a , Aldo Cavallini a & CaterinaMessa aa Laboratory of Biochemistry, Scientific Institute for Digestive Diseases, IRCCS “Saverio deBellis,”, Castellana G., BA, ItalyPublished online: 05 Dec 2007.

To cite this article: Francesco Russo , Antonella Orlando , Michele Linsalata , Aldo Cavallini & Caterina Messa (2007) Effectsof Lactobacillus Rhamnosus GG on the Cell Growth and Polyamine Metabolism in HGC-27 Human Gastric Cancer Cells,Nutrition and Cancer, 59:1, 106-114, DOI: 10.1080/01635580701365084

To link to this article: http://dx.doi.org/10.1080/01635580701365084

PLEASE SCROLL DOWN FOR ARTICLE

Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) containedin the publications on our platform. However, Taylor & Francis, our agents, and our licensors make norepresentations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of theContent. Any opinions and views expressed in this publication are the opinions and views of the authors, andare not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon andshould be independently verified with primary sources of information. Taylor and Francis shall not be liable forany losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoeveror howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use ofthe Content.

This article may be used for research, teaching, and private study purposes. Any substantial or systematicreproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in anyform to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions

NUTRITION AND CANCER, 59(1), 106–114Copyright C© 2007, Lawrence Erlbaum Associates, Inc.

Effects of Lactobacillus Rhamnosus GG on the Cell Growthand Polyamine Metabolism in HGC-27

Human Gastric Cancer Cells

Francesco Russo, Antonella Orlando, Michele Linsalata, Aldo Cavallini, and Caterina Messa

Abstract: Previous in vivo studies have suggested thatlactobacilli can exert anti-proliferative effects on the gas-tric epithelium. However, few data are available on theirmechanisms of action. The aim of this study was to in-vestigate the effects of increasing concentrations of Lacto-bacillus rhamnosus strain GG (L. GG) homogenate on cellgrowth and proliferation [by 3-(4,5 di-methylthiazol-2-yl)–2,5-diphenyltetrazolium bromide, [3H]-thymidine incorpo-ration and polyamine biosynthesis] and apoptosis processes(by Bax/Bcl-2 mRNA expression) in HGC-27 human gas-tric cancer cells. To verify which bacterial fraction wasinvolved in the antiproliferative and proapoptotic effects,the cytoplasm and cell wall extracts were tested separately.HGC-27 cells were sensitive to the apoptotic induction andgrowth inhibition by increased concentrations of bacterialhomogenate. HGC-27 cells were resistant to the bacterial cellwall fractions, whereas increasing cytoplasm fraction con-centrations induced evident antiproliferative and proapop-totic actions. These data suggest that cytoplasm extractscould be responsible for L. GG action on HGC-27 cell pro-liferation.

Introduction

Probiotics are nonpathogenic organisms that have beenused in food from ancient times and are normal residentsof the gastrointestinal tract of human beings, also provid-ing health benefits for their hosts (1). Among probiotics,Lactobacillus species are probably the best studied microor-ganisms, and data from literature indicate a possible use forthese bacteria in the therapeutic management of differentdiseases such as antibiotic-associated diarrhea (2), inflam-matory bowel disease (3), or irritable bowel syndrome (4).Different lines of evidence also suggest that the consump-tion of lactobacilli may decrease cancer risk (5). Indeed,there is no direct experimental data for cancer suppressionin humans as a result of lactobacilli administration, although

All authors are affiliated with the Laboratory of Biochemistry, Scientific Institute for Digestive Diseases, IRCCS “Saverio de Bellis,” Castellana G. (BA),Italy.

significant indirect and mechanistic evidences are providedby in vitro and laboratory animal studies, essentially on thecolonic mucosa (6,7).

The specific mechanisms by which lactobacilli exert thisinfluence might include inhibition of genotoxicity of knowncarcinogens, suppression of carcinogen-induced preneoplas-tic lesions and tumors in laboratory animals (8), modulationof cellular mediated immuno responses, and regulation ofseveral cytokines (9,10). Additionally, their metabolic char-acteristics can probably exert a key role in preventing cancerinitiation and progression (11) as well as in controlling cellgrowth mechanisms (7).

In spite of the large amount of data about protective role ofprobiotics in contrasting colon cancer, little is still known onthe role played by lactobacilli in interfering the neoplastictransformation of gastric mucosa. Previous in vivo studiesfrom our group (12) showed that some lactobacillus strainscan really exert an antiproliferative effect in the stomach.High oral doses of L. brevis CD-2 proved to significantlydecrease the polyamine levels and ornithine decarboxylase(ODC) activity in preneoplastic conditions characterized bya hyperproliferative state such as the gastric mucosa infectedby Helicobacter pylori (13,14).

Polyamines, putrescine, spermidine, and spermine areubiquitous short-chain aliphatic amines that play an im-portant role in cell proliferation and differentiation (15).They can be considered reliable markers of proliferationbecause abnormal hyperproliferative cells, such as in neo-plastic and preneoplastic tissue, exhibit very high require-ments for polyamines to sustain cell growth through elevatedDNA, RNA, and protein synthesis (16). The metabolism ofpolyamines begins with the ODC, a rate-limiting enzyme thatis highly regulated in all of the cells and responds to a widevariety of growth-promoting stimuli (17).

In this framework, the objectives of this study were, first,to investigate in vitro the influence of increasing concentra-tions of homogenate from Lactobacillus rhamnosus strainGG (ATCC 53103) (L. GG) on the cell proliferation and

Dow

nloa

ded

by [

Uni

vers

ity o

f C

entr

al F

lori

da]

at 0

3:02

30

Sept

embe

r 20

13

polyamine biosynthesis in human gastric cancer (HGC)-27cell line, and second, to elucidate the role of this probioticin modulating gastric cancer cell growth by evaluating itseffects on mRNAs expression of Bcl-2 and Bcl2-associatedX protein (Bax) apoptosis-related proteins. Finally, to exam-ine which cellular fraction could be metabolically active inaffecting cell growth and proliferative processes, the sameseries of experiments were conducted fractionating the ho-mogenate into cytoplasm and cell wall extracts.

Materials and Methods

Cell Culture Conditions

Human gastric cancer cell line HGC-27 was obtained fromthe Interlab Cell Line Collection (ICLC; IST, Genoa, Italy).Cells were routinely cultured in Dulbecco Modified Ea-gle Medium (DMEM) supplemented with 10% fetal bovineserum (FBS), 1% nonessential amino acids, 2 mM glutamine,100 U/ml penicillin, 100 µg/ml streptomycin, in monolayerculture, and incubated at 37◦C in a humidified atmospherecontaining 5% CO2 in air. At confluence, the grown cellswere harvested by means of trypsinization and serially sub-cultured with a 1 : 4 split ratio. All cell culture componentswere purchased from Sigma-Aldrich (Milan, Italy).

Preparation of Homogenate, Cytoplasm and Cell WallExtracts of L. rhamnosus GG

The L. GG was incubated in Lactobacillus MRS broth at37◦C over night and then diluted in MRS broth and incubatedat 37◦C to reach the log phase with the density determined as0.5 at A600. L. GG was precipitated from MRS broth (1,000g for 15 min at room temperature) and washed twice withphosphate-buffered saline (PBS), pH 7.4.

The content of bacterial cells was released by sonicationwith an Ultrasonic 1000 sonicator (B. Braun Biotech Inter-national Gmbh, Melsungen, Germany) on ice at 50 watts for1 min at 30-s intervals until the cells were disrupted. The de-gree of cell breakage was estimated, and the cell number wascalculated by using light microscopy; the number of rupturedcells was determined by counting the intact cells before andafter sonication and subtracting the number before sonicationfrom the number after sonication. Preparation of sonicatedbacteria was then suspended in PBS (pH 7.4) reaching aconcentration of 108 cells/ml. Finally, the preparation wascentrifuged at 1,000 g for 30 min at 4◦C, and the supernatantobtained, which was used as a homogenate, was stored at–70◦C until it was used.

To obtain cell wall extracts in the pellet fraction andcytoplasm extracts in the supernatant fraction, an aliquotof the homogenate (corresponding to a concentration of108 cells/ml) was centrifuged at 35,000 g for 20 min at 4◦C.The cell wall extract was prepared from the pellet by suspen-sion in PBS (pH 7.4) so that an amount equal to the amountof the supernatant was obtained. The samples were stored at–70◦C until they were used.

To evaluate the proliferative properties of bacteria at dif-ferent concentrations, a set of decreasing concentrations wasprepared starting from the initial concentration (1 : 1, corre-sponding to 108 cells/ml). Based on the number of rupturedcells per 1 ml of preparation, dilutions 1 : 2, 1 : 5, 1 : 10, and1 : 100 (corresponding to 5 × 107 cells/ml, 2 × 107 cells/ml,1 × 107 cells/ml, and 1 × 106 cells/ml, respectively) wereprepared from the homogenate. In the same fashion, cell wallextracts and cytoplasm extracts were diluted 1 : 2, 1 : 5, 1 : 10,and 1 : 100. All of the preparations were filtered (Millex-GV;pore size, 0.22 µm; Nihon Millipore Kogyo Inc., Yonezawa,Japan) and added to cell cultures.

In a preliminary subset of experiments, the dilutions 1 :10 and 1 : 100 were tested for their proliferative effect by3-(4,5 di-methylthiazol-2-yl)–2,5-diphenyltetrazolium bro-mide (MTT), and then they were excluded from any subse-quent analysis due to the lack of any response on the HGC-27cell line (data not shown).

Lactobacillus rhamnosus GG Treatment

In the experiments investigating the effects of L. GG oncell proliferation, HGC-27 cells (25th–30th passage) wereseeded at a density of 2 × 105 cells/5 ml of DMEM containing10% FBS in 60 mm tissue culture dishes (Corning CostarCo, Milan, Italy). After 24 h, to allow for attachment, themedium was removed, and DMEM containing the differentconcentrations of bacteria homogenate, cell wall extracts,and cytoplasm extracts was added to cells.

In detail, 3 sets of experiments were prepared. In thefirst set, HGC-27 cells were incubated with the bacteria ho-mogenate concentrations (1 : 5, 1 : 2, and 1 : 1). The other 2sets of experiments were performed by incubating HGC-27cells with cytoplasm extracts and cell wall extracts (1 : 5, 1: 2, and 1 : 1). In these experimental conditions, the HGC-27 cells were allowed to grow for 24 h and 48 h and thenprocessed for the subsequent analyses.

Each experiment included an untreated control and a con-trol with the equivalent concentration of PBS as had beenused for adding bacteria homogenate and extracts. Tripli-cate cultures were set up for each L. GG concentration (ei-ther from homogenate or cytoplasm extracts and cell wallextracts) and for control; each experiment was repeated 4times. Cell viability, determined using the trypan blue exclu-sion test, always exceeded 90%.

Assessment of Cell Proliferation

After HGC-27 cells had been cultured for 24 h and 48 hwith different concentrations of L. GG homogenate (1 : 5,1 : 2, and 1 : 1) as well as cytoplasm extracts and the cor-responding cell wall extracts, the proliferative response wasestimated by colorimetric MTT test and the [3H]-thymidineincorporation in cell DNA.

To determine cell growth by colorimetric test, MTT stocksolution (5 mg/ml in medium) was added to each dishat a volume of one-tenth the original culture volume and

Vol. 59, No. 1 107

Dow

nloa

ded

by [

Uni

vers

ity o

f C

entr

al F

lori

da]

at 0

3:02

30

Sept

embe

r 20

13

incubated for 2 h at 37◦C in humidified CO2. At the end ofthe incubation period, the medium was removed, and the blueformazan crystals were solubilized with acidic isopropanol(0.1 N HCl in absolute isopropanol). MTT conversion toformazan by metabolically viable cells was monitored byspectrophotometer at an optical density of 570 nm.

To determine DNA synthesis, 0.3 µCi/ml of [methyl-3H]–thymidine (85.50 Ci/mmol; NEN Life Science Products Inc.,Boston, MA) was added to triplicate dishes in the last 12 h ofL. GG treatment. After incubation, the medium was aspiredto remove unincorporated [3H]-thymidine, and the cells weremaintained with 0.33 N NaOH for 30 min. To precipitateand hydrolyze the DNA, the resulting cells were harvestedby collection onto tube glass containing 40% trichloroaceticacid (TCA) with 1.2 N HCl and centrifuged at 3,000 g for15 min. The precipitated DNA was redissolved in 0.33 NNaOH, and then 250 µl were transferred into vials containing3 ml of scintillation fluid. Incorporation of [3H]-thymidine inDNA was determined by scintillation quantitation in a Rack-beta counter (model 1219; LKB-Pharmacia, Turku, Finland).

ODC Activity

ODC activity was measured with a radiometric techniquethat estimated the amount of 14CO2 liberated from DL-[1-14C]-ornithine (specific activity, 56.0 mCi/mmol; New Eng-land Nuclear, Mohza, Italy) (18).

The cell culture pellet (2–4 × 106 cells) was homogenizedin 0.6 ml ice-cold Tris-HCl (15 mM, pH 7.5) containing2.5 mM dithiothreitol, 40 µM pyridoxal-5̃-phosphate, and100 µM ethylene diamine tetra acetate and then centrifugedat 30,000 g for 30 min at 4◦C.

An aliquot of supernatant (200 µl) was added to a glasstest tube containing 0.05 µCi DL-[1-14C]-ornithine and39 nmol DL-ornithine.

After incubation for 60 min at 37◦C, the reaction wasstopped by adding TCA to a final concentration of 50%.14CO2 liberated from DL-[1-14C]-ornithine was trapped onfilter paper pretreated with 40 µl NaOH (2N), which wassuspended in a center well above the reaction mixture.

Radioactivity on the filter papers was determined by aliquid scintillation counter (Model 1219 Rackbeta; LKB-Pharmacia, Uppsala, Sweden).

ODC activity was expressed as pmolCO2/h/mg of protein.Enzymatic activity was found to be linear within the rangeof 50–600 µg of protein (r2 = 0.99). The intraassay andinterassay variation coefficients (CV%) were 6% and 8%,respectively.

Polyamine Analysis

For the evaluation of the polyamine levels after differ-ent L. GG treatments, each cell culture pellet was homoge-nized in 700 µl of 0.9% sodium chloride mixed with 5 µl(174 nmol/ml) of an internal standard (1,10-Diaminodecane).

To precipitate the proteins, 50 µl of perchloric acid 3Mwere added to the homogenate. After 30 min of incuba-tion in ice, the homogenate was centrifuged for 15 min at7,000 g. The supernatant was filtered (Millex-HV13 poresize 0.45 mm; Millipore, Bedford, MA) and lyophilized.The residue was dissolved in 250 µl of HCl (0.1 N).Aliquots (100 µl) were reacted with dansyl chloride, andthe dansyl-polyamine derivatives were determined by high-performance liquid chromatography as previously described(19). Polyamine levels were expressed as concentration val-ues in nmol/mg of protein.

Bax and Bcl-2 mRNA Expression

After treatment of HGC-27 cells with increasing concen-trations of L. GG homogenate as well as with wall and cyto-plasm extracts, the Bax and Bcl-2 mRNAs were evaluated.

The total RNA extraction, the reverse transcription, andreal-time polymerase chain reaction (PCR) methods havebeen described previously (20).

In brief, 2 µg of total RNA, obtained by phenol-chloroform-ethanol method and spectrophotometricallyquantitated, were reverse transcribed for Bax and Bcl-2 mR-NAs in the same tube. Because the amounts of cDNAs pro-duced must correctly reflect the input amounts of the mRNAs,the reverse transcription of 2 gene targets was performed inthe same tube.

Two aliquots of same reverse transcriptase solution wereseparately amplified by real-time PCR.

The primer sequences were5’- GTGGAGGAGCTCTTCAGGGA -3’ (forward

primer) and 5’- AGGCACCCAGGGTGATGCAA -3’ (re-verse primer) for Bcl-2;

5’- CAGGATGCGTCCACCAAGAA -3’ (forward) and5’- GCTCCCGGAGGAAGTCCAAT -3’ (reverse) for Bax.

The absolute quantitative analysis for each mRNA targetwas determined by the external standard curve method usinga fragment of the human β-actin (Positive control, Clontech-Takara Bio Europe, Saint-Germain-en-Laye, France). Therelative gene expression was reported as Bax/Bcl-2 mRNAratio of the absolute values.

Statistical Analysis

Due to the non-normal distribution of the data, nonpara-metric tests were performed. For the proliferative character-istics, ODC activity, and polyamine levels of HGC-27 cells,the significance of differences between the groups was de-termined by Kruskal–Wallis analysis of variance and Dunn’sMultiple Comparison Test. Differences were considered sig-nificant at P < 0.05. All data are expressed as median andthe range. A specific statistical package for exact nonpara-metric inference package (StataCorp. 2005; Stata StatisticalSoftware: Release 9, College Station, TX) was used.

108 Nutrition and Cancer 2007

Dow

nloa

ded

by [

Uni

vers

ity o

f C

entr

al F

lori

da]

at 0

3:02

30

Sept

embe

r 20

13

Figure 1. A: Effects of increasing concentrations of Lactobacillus rhamnosus strain GG (L. GG) homogenate on the conversion of 3-(4,5 di-methylthiazol-2-yl)–2,5-diphenyltetrazolium bromide (MTT) tetrazolium salt in human gastric cancer (HGC)-27 cells after 24 h and 48 h of treatment, respectively. B:Effects of increasing concentrations of L. GG homogenate on the incorporation of [3H]-thymidine in DNA of HGC-27 cells. L. GG bacteria homogenate wasadministered at 1 : 5, 1 : 2, and 1 : 1 concentrations. All data represent the results of 4 different experiments (median value and the range). For each time (24 hand 48 h) and L. GG concentration, median values not sharing a common superscript differ significantly (P < 0.05, Kruskal–Wallis analysis of variance andDunn’s Multiple Comparison Test).

Results

Effects of Lactobacillus GG on HGC-27 CellsProliferation

Exposure of HGC-27 cell line to increasing concentrationsof L. GG homogenate (1 : 5, 1 : 2, and 1 : 1) showed an evidentantiproliferative action after both 24 h and 48 h of treatment.

Figure 1A shows the effects of increasing concentrationsof L. GG homogenate on the conversion of MTT tetrazoliumin HGC-27 cells after 24 h and 48 h of treatment, respec-tively. After 24 h, concentrations equal to or higher than 1: 2 of L. GG homogenate caused a significant reduction inconversion of the MTT tetrazolium salt compared with theuntreated control cells (P < 0.01). Besides, the 1 : 1 concen-tration (corresponding to 108 cells/ml) of L. GG homogenatereduced significantly the MTT conversion in HGC-27 cellscompared to the MTT conversion of cells treated with 1 : 5concentration (P < 0.01). The reduction was quite similaralso after 48 h of treatment.

The effects of increasing concentrations of L. GG ho-mogenate on the incorporation of [3H]-thymidine in DNAof HGC-27 cells are shown in Fig. 1B. After 24 h, concen-trations equal to or higher than 1 : 2 of L. GG homogenatecaused a significant reduction in [3H]-thymidine incorpo-ration in DNA of cells compared with the untreated con-trol cells (P < 0.05). The 1 : 1 concentration of L. GGhomogenate reduced significantly also the [3H]-thymidineincorporation in DNA of HGC-27 cells compared to DNAincorporation of cells treated with 1 : 5 concentration (P <

0.05). This behavior was similar to that for MTT. Finally,after 48 h, the reduction in the [3H]-thymidine incorpora-tion was significant (P < 0.05) with homogenate concentra-tions equal to or higher than 1 : 2 concentration compared tocontrol.

The effects of cytoplasm and cell wall extracts from L.GG on cell proliferation were also investigated. Figure 2reports the effects of increasing concentration of cyto-plasm extracts from L. GG on MTT conversion (Fig. 2A)and [3H]-thymidine incorporation (Fig. 2B) after 24 h and48 h of treatment, respectively. After 24 h of treatment, cyto-plasm extracts did not exert effects on both MTT conversionand [3H]-thymidine incorporation. By opposite, after 48 hof treatment, cells treated with 1 : 1 concentration of cyto-plasm extracts reduced significantly both MTT conversionand [3H]-thymidine incorporation compared to control cellsand cells treated with 1 : 5 concentration (P < 0.05). Wallextracts did not exert any proliferative effect on HGC-27 cellline after 24 h and 48 h of treatment (data not shown).

Effects of Lactobacillus GG on Polyamine Biosynthesis

The effects of L. GG homogenate on the ODC activitywere studied at increasing concentrations (1 : 5, 1 : 2, and1 : 1) for 24 h and 48 h, respectively.

After 24 h, administration of L. GG homogenate at 1 : 1concentration reduced significantly ODC activity comparedto that in untreated cells (P < 0.001) (Fig. 3A). After 48 h,the decrease in cells treated with 1 : 1 concentration wassignificant not only in comparison to untreated control cells(P < 0.01) but also compared to 1 : 5 concentration cells(P < 0.01).

HGC-27 cells treated for 24 h with 1 : 1 concentration of L.GG cytoplasm extracts (Fig. 3B) showed a significant reduc-tion (P < 0.01) in the ODC activity compared to untreatedcells. After 48 h of treatment, the reduction in the enzymaticactivity was significant (P < 0.01) for cells treated with 1 :1 concentration compared to both untreated cells and cellstreated with 1 : 5 concentration of L. GG cytoplasm extracts.

Vol. 59, No. 1 109

Dow

nloa

ded

by [

Uni

vers

ity o

f C

entr

al F

lori

da]

at 0

3:02

30

Sept

embe

r 20

13

Figure 2. A: Effects of increasing concentrations of cytoplasm extracts from Lactobacillus rhamnosus strain GG (L. GG) on 3-(4,5 di-methylthiazol-2-yl)–2,5-diphenyltetrazolium bromide (MTT) conversion after 24 h and 48 h of treatment. B: Effects of increasing concentrations of cytoplasm extracts from L. GGon [3H]-thymidine incorporation after 24 h and 48 h of treatment. L. GG bacteria cytoplasm extracts were administered at 1 : 5, 1 : 2, and 1 : 1 concentrations.All data represent the results of 4 different experiments (median value and the range). For each time (24 h and 48 h) and L. GG concentration, median valuesnot sharing a common superscript differ significantly (P < 0.05, Kruskal–Wallis analysis of variance and Dunn’s Multiple Comparison Test).

No effect was shown by any of the concentrations used forL. GG wall extracts after either 24 or 48 h of treatment (datanot shown).

As concerns the polyamine profile, the administration ofincreasing concentrations of L. GG homogenate (namely,1 : 5, 1 : 2, and 1 : 1) after 24 h and 48 h led to a decrease ofthe single and total polyamine contents in the HGC-27 cells(Table 1). After 24 h of treatment, the decrease was signifi-cant (P < 0.05) at 1 : 1 concentration for spermidine, sper-mine, and the total polyamine content compared to untreatedcontrol cells. After 48 h of treatment, it caused a significant(P < 0.01) reduction in all the single as well as the totalpolyamine content in cells treated with 1 : 1 concentration ofL. GG homogenate compared either to untreated control cellsor cells treated with 1 : 5 L. GG homogenate concentration.

Figure 3. A: Effects of increasing concentrations of Lactobacillus rhamnosus strain GG (L. GG) homogenate on the ornithine decarboxylase (ODC) activityin human gastric cancer (HGC)-27 cells after 24 h and 48 h of treatment, respectively. B: Effects of increasing concentrations of L. GG cytoplasm extracts onthe ODC activity of HGC-27 cells. Both L. GG bacteria homogenate and cytoplasm extracts were administered at 1 : 5, 1 : 2, and 1 : 1 concentrations. Alldata represent the results of 4 different experiments (median value and the range). For each time (24 h and 48 h) and L. GG concentration, median values notsharing a common superscript differ significantly (P < 0.05, Kruskal–Wallis analysis of variance and Dunn’s Multiple Comparison Test).

As for the proliferative assays, the effects of cytoplasmand cell wall extracts from L. GG were also investigatedon the polyamine profile (Table 2). After 24 h of treatmentwith cytoplasm extracts at 1 : 1 concentration, a significant(P < 0.05) reduction was induced in the spermine and totalpolyamine content compared to untreated control cells. Af-ter 48 h, cytoplasm extracts at 1 : 1 concentration reducedsignificantly (P < 0.05) the spermidine, spermine, and thetotal polyamine content compared to untreated control cells.Also 1 : 2 concentration of L. GG cytoplasm extracts re-duced significantly (P < 0.05) the total polyamine contentcompared to control cells. Finally, as far as wall extracts wasconcerned, no effect on the total and single polyamine con-tent was evident for none of the concentrations used (datanot shown).

110 Nutrition and Cancer 2007

Dow

nloa

ded

by [

Uni

vers

ity o

f C

entr

al F

lori

da]

at 0

3:02

30

Sept

embe

r 20

13

Table 1. Polyamine Profile in HGC-27 Cells After 24h and 48h of Exposure toLactobacillus GG Homogenatea

Concentration Putrescine Spermidine Spermine Total

Control 0.3 (0.2–0.3) 9.6 (3.75–10.0) 14.2 (8.6–15.6) 24.1 (12.6–25.4)24 h 1 : 5 0.3 (0.2–0.3) 8.15 (3.4–8.8) 12.4 (5.1–14.0) 20.4 (8.7–22.6)

1 : 2 0.3 (0.1–0.31) 6.4 (0.38–9.0) 12.5 (5.3–15.0) 18.7 (7.9–24.1)1 : 1 0.3 (0.10–0.3) 5.3b (2.2–8.0) 8.4b (5.2–11.8) 14.2b (7.5–20.1)

Control 0.6 (0.5–0.7) 9.7 (8.5–10.0) 15.05 (14.3–17.1) 25.4 (24.6–26.2)48 h 1 : 5 0.6 (0.5–0.7) 9.9 (9.8–10.9) 14.75 (13.8–15.2) 25.6 (24.2–26.0)

1 : 2 0.5 (0.4–0.7) 8.8 (7.5–10.0) 13.5 (13.1–14.6) 22.9 (21.8–23.7)1 : 1 0.5c,d (0.5–0.7) 7.5c,d (6.4–7.9) 12.2c,d (11.8–12.8) 20.2c,d (19.2–20.9)

a: Data are in median values and the range in parentheses (Kruskal–Wallis test with Dunn’s Multiple ComparisonTest). Polyamines are in nmol/mg protein.b: 1 : 1 versus Control, P < 0.05 (after 24 h of treatment).c: 1 : 1 versus Control, P < 0.01 (after 48 h of treatment).d: 1 : 1 versus 1 : 5, P < 0.01 (after 48 h of treatment).

Effects of Lactobacillus GG on Bax and Bcl-2 mRNAExpression

To examine the effects of L. GG on the apoptotic pathwayin human HGC-27 gastric cancer cells, mRNA expression ofthe apoptosis-related protein Bax and Bcl-2 was evaluatedand expressed as Bax/Bcl-2 mRNA ratio.

Figure 4A shows the effects of L. GG homogenate ad-ministration on the Bax/Bcl-2 ratio after 24 h and 48 h oftreatment. Both periods of treatment with L. GG homogenateat 1 : 1 concentration increased significantly (P < 0.05) theBax/Bcl-2 ratio compared to untreated cells and cells treatedwith 1 : 5 L. GG homogenate concentration.

HGC-27 cells treated for 24 h with 1 : 1 concentrationof L. GG cytoplasm extracts showed (Fig. 4B) a significantincrease (P < 0.05) in the Bax/Bcl-2 ratio compared to un-treated cells. After 48 h of treatment, the value of the Bax/Bcl-2 ratio in cells treated with 1 : 1 concentration was signif-icantly higher than that in untreated cells and cells treatedwith 1 : 5 concentration of L. GG cytoplasm extracts. P

Table 2. Polyamine Profile in HGC-27 Cells After 24 h and 48 h of Exposure toLactobacillus GG Cytoplasm Extractsa

Concentration Putrescine Spermidine Spermine Total

Control 0.3 (0.2–0.3) 9.6 (3.7–10.0) 14.2 (8.6–15.6) 24.1 (12.6–25.4)24 h 1 : 5 0.3 (0.1–0.4) 9.40 (2.8–10.0) 11.7 (7.8–14.5) 21.3 (11.9–24.5)

1 : 2 0.1 (0.06–0.2) 9.2 (2.8–9.5) 14.0 (5.8–15.0) 23.6 (8.7–24.1)1 : 1 0.3 (0.05–0.5) 3.7 (2.5–7.6) 6.4b (5.7–12.2) 10.1b (8.9–20.1)

Control 0.5 (0.5–0.7) 9.7 (8.5–10.0) 15.0 (14.3–17.1) 25.4 (24.6–26.2)48 h 1 : 5 0.4 (0.1–0.6) 9.2 (5.3–10.2) 14.0 (9.3–15.9) 24.4 (14.7–24.8)

1 : 2 0.4 (0.1–0.7) 7.8 (4.5–10.0) 13.5 (8.3–14.6) 22.3d (12.9–24.2)1 : 1 0.2 (0.1–0.4) 6.0c (4.4–8.6) 10.2c (6.7–13.8) 16.8c (10.8–22.8)

a: Data are in median values and the range in parentheses (Kruskal–Wallis test with Dunn’s MultipleComparison Test). Polyamines are in nmol/mg protein.b: 1 : 1 versus Control, P < 0.05 (after 24 h of treatment).c: 1 : 1 versus Control, P < 0.05 (after 48 h of treatment).d: 1 : 2 versus Control, P < 0.05 (after 48 h of treatment).

value was <0.05. By opposite, no effect was shown by anyof the concentrations used for L. GG wall extracts after either24 or 48 h of treatment (data not shown).

Discussion

In recent years, much attention has been paid to the benefi-cial effects of probiotics in the gastrointestinal tract. Amongthem, Lactobacillus species are probably the best studiedmicroorganisms, and data from literature have clearly sug-gested that their ingestion could even reduce the risk of sometumours as well as inhibit their growth (21).

A number of studies have been carried out in vitro aswell as in animal models and humans on the effects ofprobiotics on cell proliferation. The vast majority of studiesin this area have dealt with protective effects against coloncancer. This can be considered a consequence of the “natu-ral” environment for these microorganisms in the luminalcontent of the colon where probiotics may explicate in full all

Vol. 59, No. 1 111

Dow

nloa

ded

by [

Uni

vers

ity o

f C

entr

al F

lori

da]

at 0

3:02

30

Sept

embe

r 20

13

Figure 4. A: Effects of increasing concentrations of Lactobacillus rhamnosus strain GG (L. GG) homogenate on the Bcl-2 and Bcl-2-associated X protein(Bax) mRNA expression in HGC-27 cells after 24 h and 48 h of treatment. B: Effects of increasing concentrations of L. GG cytoplasm extracts on the Bax andBcl-2 mRNA expression in HGC-27 cells after 24 h and 48 h of treatment. For each time (24 h and 48 h) and L. GG concentration, median values not sharing acommon superscript differ significantly (P < 0.01, Kruskal–Wallis analysis of variance and Dunn’s Multiple Comparison Test). All data represent the resultsof 4 different experiments (median value and range) and are expressed as Bax/Bcl-2 mRNA ratio.

their metabolic properties (22). By opposite, there have beenfew investigations on their possible effects on gastric mu-cosa cells, mainly due to the hostile acidic environment ofthe stomach. Because not all probiotic bacteria have similartherapeutic effects and ability to survive at low pH, Lac-tobacillus rhamnosus GG was chosen for this study. Thisprobiotic is a human strain with the ability to resist gastricacid and bile and to adhere to mucosa of human intestine(23).

The main finding of this study is that L. GG can affectproliferation rates of HGC-27 cells as demonstrated by thesignificant reduction in MTT conversion, [3H]–thimidyneincorporation, and the single and total polyamine content.Particularly, HGC-27 cells showed a significant antiprolif-erative effect with the highest L. GG homogenate concen-trations (namely, 1 : 1 and 1 : 2). Similarly, in our previoushuman in vivo studies performed in patients with H. pyloriinfection, administration of another lactobacillus strain, L.brevis, caused a significant decrease in the polyamine con-tent of gastric mucosa independently of the presence of H.pylori (14).

Polyamines are reliable indicators of cell proliferationshowing different properties, being able to stabilize chro-matin and nuclear enzymes. This is postulated to be due totheir ability to form complexes with organic polyanions suchas groups of proteins and DNA. Stabilization of the chroma-tine structure by polyamines may be a mechanism by whichthese molecules affect nuclear processes including cell divi-sion and apoptosis (24).

L. GG administration on HGC-27 cells also induced asignificant reduction of ODC activity that may account forthe observed variations in the single and total polyamine con-tent. ODC is a key-regulator in the polyamine metabolism,being now considered as a true oncogene (25). This enzymeinfluences mainly putrescine and spermidine levels, which

are more involved in cell proliferation than spermine; thelatter is implicated essentially in the cell differentiation andneoplastic transformation, with different processes involvedin maintaining its critical levels (26). Our findings are inagreement with other data from literature about the relation-ship between polyamine biosynthesis and probiotic actionduring carcinogenesis and tumor growth. ODC activity, cellproliferation, as well as expression of the ras-p21 oncoproteinwere significantly inhibited by administration of Bifidobac-terium longum cultures in rats with azoxymethane-inducedcolon cancer (27).

The rates of cell proliferation and cell death may de-termine the speed of neoplastic growth (28), and L. GGhas been demonstrated to prevent cytokine-induced apopto-sis in mouse or intestinal cell lines. Culture of L. GG withhuman intestinal epithelial cells can promote their survivalthrough the activation of the antiapoptotic Akt/protein kinaseB and inhibition of the proapoptotic p38 mitogen-activatedprotein kinase (29). Therefore, to determine whether L. GGhomogenate could induce apoptosis in HGC-27 cells, we ex-amined the Bcl-2 (apoptosis suppressor) and Bax (apoptosisinducer) mRNA levels expressed as Bax/Bcl-2 mRNA ratio.Our data show that L. GG homogenate possesses a proapop-totic action because a significant increase in the Bax/Bcl-2mRNA ratio occurred at the highest concentration.

Although the precise mechanism of inhibition of cell pro-liferation by administration of L. GG is not fully elucidated,it is likely that these effects might proceed through metabolicalterations exerted by different components of bacterial cells.It is known that whole cells, heat-killed cells, cell wall, andcytoplasm extracts of lactobacilli can show various func-tions. However, the majority of reports on antitumor activityand immunomodulatory effects of these probiotics have beenfocused on the whole cells or its membrane components,peptidoglycans, and a little attention has been paid for the

112 Nutrition and Cancer 2007

Dow

nloa

ded

by [

Uni

vers

ity o

f C

entr

al F

lori

da]

at 0

3:02

30

Sept

embe

r 20

13

cytoplasm soluble fractions (30). Our findings let us supposethat the responsible bacterial component for the proliferativeeffects in HGC-27 cells may be located in the cytoplasm. As amatter of fact, in all the sets of experiments investigating cellproliferation and apoptosis, the cell wall extracts proved to beineffective, whereas the cytoplasm fraction showed a signif-icant antiproliferative and proapoptotic action. In particular,the inhibitory effect exerted on the HGC-27 cell prolifera-tion by cytoplasm extracts was evident for the polyaminemetabolism after 24 h, whereas a significant inhibition for[3H]-thymidine incorporation and the MTT test occurredonly after 48 h of treatment. Probably, the shorter time ofexposition to cytoplasm extracts may be sufficient to pro-duce inhibition in the biosynthesis of polyamines, which arenecessary for cells to initiate their proliferative processes. Infact, the polyamine synthesis represents an early event duringG1 phase of cell cycle (16).

It was proved that the inhibitory action on cell prolifera-tion exerted by L. GG cytoplasm extracts is decreased but notcancelled following inactivation of proteases by heat treat-ment (31). Consequently, it may be postulated that the majormediator of the reductive effect on proliferation could be theamount of heat-stable bacterial products released from cells.

Previous studies have demonstrated that some Lactobacil-lus strains possess antimicrobial activity (32,33). In a similarmanner, the cytoplasmic substances from L. GG showing an-tiproliferative and proapoptotic action might be resistant toenzymatic degradation, heat inactivation, and low pH condi-tions.

However, the activity of probiotic strains in vitro maynot translate completely into similar in vivo behavior (34),and the normal environmental gastric conditions might affectthe response to probiotics in a more complex manner thanthat in a simple cell line model. In this connection, furtherstudies are needed to deeper investigate the biochemical andmetabolic properties of these substances in terms of prolifer-ation and apoptosis in different gastric cell lines as well as invivo. Naturally, conditions for an appropriate administrationof probiotics (e.g., high doses, prolonged periods of admin-istration) have to be considered. Recently, Valeur et al. (35)reported that after administration of 4 × 108 L. reuteri tohealthy volunteers, it was possible to detect this strain adher-ing to epithelial cells from corpus and antral gastric biopsiesusing fluorescent in situ hybridization. In our previous work(14), high oral doses of L. brevis (1 tablet containing 20 ×109 lyophilized bacteria per os 9 times a day for 3 wk) wereadministered to H. pylori positive patients before a significanteffect on polyamine metabolism could be observed.

Finally, apart from the demonstration of an active role incell proliferation played by L. GG homogenate and its cyto-plasm extracts, our data suggest a possible use of probiotichomogenate as components in functional foods as previouslyhypothesized by others (31). The effects on proliferation ofL. GG can be ascribed not only to live microorganisms butalso to nonviable ones. This may result in longer shelf lifeand easier storage of functional foods whose properties haveto be studied further.

Acknowledgments and Notes

F. Russo and A. Orlando equally contributed to the work. The authorswould like to thank Dr. Luigi Palese (Department of Medical Biochem-istry and Medical Biology, University of Bari) for his precious collabo-ration in the bacterial homogenate preparation. Address correspondanceto Francesco Russo, M.D., Laboratory of Biochemistry, IRCCS “Saveriode Bellis” I-70013 Castellana Grotte (BA), Italy. Phone: +390804960315.FAX: +390804960313. E-mail: francesco.russo@irccsdebellis.it.

Submitted 22 December 2006; accepted in final form 27 February 2007.

References

1. Salminen S, Bouley C, Boutron-Ruault MC, Cummings JH, Franck A, etal.: Functional food science and gastrointestinal physiology and func-tion. Br J Nutr 80, S147–S171, 1998.

2. Cremonini F, Di Caro S, Nista EC, Bartolozzi F, Capelli G, et al.: Meta-analysis: the effect of probiotic administration on antibiotic-associateddiarrhoea. Aliment Pharmacol Ther 16, 1461–1467, 2002.

3. Hart AC, Stagg AJ, and Komm MA: Use of probiotics in the treatment ofinflammatory bowel disease. J Clin Gastroenterol 36, 111–119, 2003.

4. O’Sullivan MP and O’Morain CA: Bacterial supplementation in the ir-ritable bowel syndrome: a randomised double-blind placebo-controlledcrossover study. Dig Liver Dis 32, 294–301, 2000.

5. Lin DC: Probiotics as functional foods. Nutr Clin Pract 18, 497–506,2003.

6. Reddy BS: Possible mechanisms by which pro- and prebiotics influencecolon carcinogenesis and tumor growth. J Nutr 129, S1478–S1482, 1999.

7. Reddy BS: Prevention of colon cancer by pre- and probiotics: evidencefrom laboratory studies. Br J Nutr 80, 219–223, 1998.

8. Madsen KL: The use of probiotics in gastrointestinal disease. Can JGastroenterol 15, 817–822, 2001.

9. Biancone L, Monteleone I, Del Vecchio Blanco G, Vavassori P, andPallone F: Resident bacterial flora and immune system. Dig Liver Dis34, S37–S43, 2002.

10. Erickson KL and Hubbard NE: Probiotic immunomodulation in healthand disease. J Nutr 130, 403–409, 2000.

11. Linsalata M, Russo F, Berloco P, Valentini AM, Caruso ML, et al.: Effectsof probiotic bacteria (VSL#3) on the polyamine biosynthesis and cellproliferation of normal colonic mucosa of rats. In Vivo 19, 989–995,2005.

12. Linsalata M, Russo F, Berloco P, Caruso ML, Di Matteo G, et al.: TheInfluence of Lactobacillus brevis on ornithine decarboxylase activityand polyamine profiles in Helicobacter pylori-infected gastric mucosa.Helicobacter 9, 165–172, 2004.

13. Ierardi E, Francavilla A, Balzano T, Traversa A, Principi M, et al.: Effectof Helicobacter pylori eradication on gastric epithelial proliferation:relationship with ras oncogenes p21 expression. Ital J GastroenterolHepatol 29, 214–219, 1997.

14. Linsalata M, Russo F, Notarnicola M, Berloco P, and Di Leo A:Polyamine profile in human gastric mucosa infected by Helicobacterpylori. Ital J Gastroenterol Hepatol 30, 484–489, 1998.

15. Tabor CW and Tabor H: Polyamines. Annu Rev Biochem 53, 749–790,1984.

16. Pegg AE and McCann PP: Polyamines metabolism and function. Am JPhysiol 243, C212–C221, 1982.

17. Linsalata M, Russo F, Cavallini A, Berloco P, and Di Leo A: Polyamines,diamine oxidase and ornithine decarboxylase activity in colorectal can-cer and in normal surrounding mucosa. Dis Colon Rectum 36, 662–667,1993.

18. Garewal HS, Sloan D, Sampliner RE, and Fennerty B: Ornithine decar-boxylase assay in human colorectal mucosa: methodological issues ofimportance to quality control. Int J Cancer 52, 355–358, 1992.

19. Messa C, Pricci M, Linsalata M, Russo F, and Di Leo A: Inhibitoryeffect 17β-estradiol growth polyamine metabolism a human gastric

Vol. 59, No. 1 113

Dow

nloa

ded

by [

Uni

vers

ity o

f C

entr

al F

lori

da]

at 0

3:02

30

Sept

embe

r 20

13

carcinoma cell line (HGC-27). Scand J Gastroenterol 34, 79–84,1999.

20. Linsalata M, Giannini R, Notarnicola M, and Cavallini A: Peroxi-some proliferator-activated receptor gamma and spermidine/spermineN1-acetyltransferase gene expressions are significantly correlated in hu-man colorectal cancer. BMC Cancer 6, 191–197, 2006.

21. Burns AJ and Rowland IR: Anti-carcinogenicity of probiotics and pre-biotics. Curr Issues Intest Microbiol 1, 13–24, 2000.

22. Santosa S, Farnworth E, and Jones PJ: Probiotics and their potentialhealth claims. Nutr Rev 64, 265–274, 2006.

23. Conway PL, Gorbach SL, and Goldin BR: Survival of lactic acid bacteriain the human stomach and adhesion to intestinal cells. J Dairy Sci 70,1–12, 1987.

24. Thomas T and Thomas TJ: Polyamines in cell growth and cell death:molecular mechanisms and therapeutic applications. Cell Mol Life Sci58, 244–258, 2001.

25. Auvinen M, Paasinen A, Andersson LC, and Holtta E: Ornithine decar-boxylase activity is critical for cell transformation. Nature 360, 355–358,1992.

26. Deloyer P, Peulen O, and Dandrifosse G: Dietary polyamines and non–neoplastic growth and disease. Eur J Gastroenterol Hepatol 3, 1027–1032, 2001.

27. Singh J, Rivenson A, Tomita M, Shimamura S, Ishibashi N, et al.:Bifidobacterium longum, a lactic acid–producing intestinal bacterium,inhibits colon cancer and modulates the intestinal biomarkers of coloncarcinogenesis. Carcinogenesis 18, 833–841, 1997.

28. Carlson DA and Ribeiro JM: Apoptosis and disease. Lancet 341, 1251–1254, 1993.

29. Yan F and Polk DBJ: Probiotic bacterium prevents cytokine-inducedapoptosis in intestinal epithelial cells. Biol Chem 277, 50959–50965,2002.

30. Lee JW, Shin JG, Kim EH, Kang HE, Yim IB, et al.: Immunomodulatoryand antitumor effects in vivo by the cytoplasmic fraction of Lactobacilluscasei and Bifidobacterium longum. J Vet Sci 5, 41–48, 2004.

31. Pessi T, Sutas Y, Saxelin M, Kallioinen H, and Isolauri E: Antiprolif-erative effects of homogenates derived from five strains of candidateprobiotic bacteria. Appl Environ Microbiol 65, 4725–4728, 1999.

32. Bernet-Camard MF, Lievin V, Brassart D, Neeser JR, Servin AL, et al.:The human Lactobacillus acidophilus strain LA1 secretes a nonbacteri-ocin antibacterial substance(s) active in vitro and in vivo. Appl EnvironMicrobiol 63, 2747–2753, 1997.

33. Zamfir M, Callewaert R, Cornea PC, Savu L, Vatafu I, et al.: Purifi-cation and characterization of a bacteriocin produced by Lactobacillusacidophilus IBB 801.J. Appl Microbiol 87, 923–931, 1999.

34. Ibnou-Zekri N, Blum S, Schiffrin EJ, and von der Weid T: Divergentpatterns of colonization and immune response elicited from two intesti-nal Lactobacillus strains that display similar properties in vitro. InfectImmun 71, 428–436, 2003.

35. Valeur N, Engel P, Carbajal N, Connolly N, and Ladefoged K: Coloniza-tion and immunomodulation by Lactobacillus reuteri ATCC 55730 inthe human gastrointestinal tract. Appl Environ Microbiol 70, 1176–1181,2004.

114 Nutrition and Cancer 2007

Dow

nloa

ded

by [

Uni

vers

ity o

f C

entr

al F

lori

da]

at 0

3:02

30

Sept

embe

r 20

13