Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

CBA-08890; No of Pages 10

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A

j ourna l homepage: www.e lsev ie r.com/ locate /cbpa

ARTICLE IN PRESS

Effect of heat stress on the porcine small intestine: A morphological and geneexpression study

Jin Yu a, Peng Yin b, Fenghua Liu a,c,⁎, Guilin Cheng a,c, Kaijun Guo a, An Lu a, Xiaoyu Zhu b,Weili Luan a, Jianqin Xu b,⁎a Department of Animal Science and Technology, Beijing University of Agriculture, Beijing 102206, PR Chinab College of Veterinary Medicine, China Agricultural University, Beijing 100193, PR Chinac Beijing Key Laboratory of TCVM, Beijing University of Agriculture, Beijing 102206, PR China

⁎ Corresponding authors. Liu is to be contacted at No. 7PR China. Tel./fax: +86 10 80794699. Xu, No. 2, Yuan100193, PR China. Tel.: +86 10 62733017; fax: +86 10 6

E-mail addresses: liufenghua1209@126.com (F. Liu),

1095-6433/$ – see front matter. Crown Copyright © 20doi:10.1016/j.cbpa.2010.01.008

Please cite this article as: Yu, J., et al., EffectBiochem. Physiol. A (2010), doi:10.1016/j.c

a b s t r a c t

a r t i c l e i n f o

Article history:Received 26 November 2009Received in revised form 13 January 2010Accepted 14 January 2010Available online xxxx

Keywords:Heat stressMorphologyGene expressionElectron microscopeMicroarraySmall intestinePig

With the presence of global warming, the occurrence of extreme heat is becomingmore common, especially duringthe summer, increasing pig susceptibility to severe heat stress. The aim of the current study was to investigatechanges inmorphology and gene expression in the pig small intestine in response to heat stress. Forty eight Chineseexperimental mini pigs (Sus scrofa) were subjected to 40 °C for 5 h each day for 10 successive days. Pigs wereeuthanized at 1, 3, 6, and 10 days after heat treatment and sections of the small intestine epithelial tissue wereexcised formorphological examinationandmicroarrayanalyses. Afterheat treatment, thepig rectal temperature, thebody surface temperature and serum cortisol levels were all significantly increased. The duodenum and jejunumdisplayed significant damage, most severe after 3 days of treatment. Microarray analysis found 93 genes to be up-regulated and 110 genes to be down-regulated in response to heat stress. Subsequent bioinformatic analysis(includinggeneontologyandKEGGpathwayanalysis) revealed thegenesaltered in response toheat stress related tounfolded protein, regulation of translation initiation, regulation of cell proliferation, cell migration and antioxidantregulation. Heat stress caused significant damage to the pig small intestine and altered gene expression in the pigjejunum. The results of the bioinformatic analysis from the present studywill be beneficial to further investigate theunderlying mechanisms involved in heat stress-induced damage in the pig small intestine.

Crown Copyright © 2010 Published by Elsevier Inc. All rights reserved.

1. Introduction

With the presence of global warming, heat stress is now a primaryfactor influencing animal health and growth, especially during thesummer months (Leon et al., 2005). Across the United States heat stressis estimated to be responsible for a loss of between $1.69 and $2.36 billionto livestock industries (St-Pierre et al., 2003). The gastrointestinal (GI)tract of the pig possesses a large surface area, providing a regulatorybarrier to which the pig is exposed to a large assortment of nutrients,microbes and exogenous toxins. The intestine permits the exchange ofbeneficial nutrients into the systemic circulation, while simultaneouslypreventing penetration of pathogenic organisms and toxic compounds(Cario et al., 2002; Hirata et al., 2007). Thus, maintaining the integrity ofthe epithelium lining the gastrointestinal tract is of great importance,ensuring its absorptive and protective functions are not compromised(Leon et al., 2005). Extreme heat stress can damage the pig gastrointes-tinal tract epithelium resulting in low animal yield and performance, aswell as increasing morbidity and mortality (Liu et al., 2009).

, Beinong Road, Beijing, 102206,mingyuan West Road, Beijing,2734111.jianqinxucau@126.com (J. Xu).

10 Published by Elsevier Inc. All rig

of heat stress on the porcinebpa.2010.01.008

To investigate the effect of heat stress on the porcine small intestine,the current study placed Chinese mini pigs in an artificial climatechamber for 10 days, simulating the surge in the heat experiencedduring summer. Morphological changes in the porcine small intestinewere examined by light and electron microscopes. Gene expressionprofiling byDNAmicroarray has recently been established, enabling thecomparison of thousands of genes simultaneously (Trevino et al., 2007).This methodwas employed to ascertain whole gene expression profilesof the pig small intestine using an Affymetrix DNA microarray. Weexecuted a gene ontology analysis (including molecular function,biological processes, cellular components and KEGG pathway) ongenes displaying a differential expression between treatments, provid-ing insight into the potential mechanisms underlying heat stress-induced injury in the pig small intestine.

2. Materials and methods

2.1. Animals

All experimental protocols were approved by the Committee forthe Care and Use of Experimental Animals at Beijing University ofAgriculture.

hts reserved.

small intestine: A morphological and gene expression study, Comp.

Table 1The villus height and crypt depth of the pig small intestine.

Day Villus height(μm) Crypt depth (μm)

Control Heat treatment Control Heat treatment

Duodenum 1 328.0±16.2 299.1±16.4* 206.8±18.6 208.0±23.73 331.1±14.7 295.7±15.7* 213.0±17.3 192.8±16.36 329.2±16.8 297.5±9.7* 203.2±17.2 193.2±19.2

10 327.0±17.5 317.5±17.1 211.5±20.5 208.8±15.1Jejunum 1 331.7±13.4 261.3±17.5** 208.2±17.0 174.6±12.1**

3 337.0±18.6 261.8±14.3*** 203.4±15.6 165.2±16.3**6 332.0±13.5 297.3±13.6** 212.7±20.2 186.0±20.6

10 333.4±20.3 317.2±16.8 209.6±14.5 196.0±18.8Ileum 1 298.8±22.7 289.0±19.4 202.3±18.4 182.7±18.5

3 305.7±17.1 276.4±16.0** 204.5±15.8 180.7±19.16 301.2±15.8 296.2±20.3 205.8±21.5 178.2±20.4

10 308.5±18.3. 292.0±14.2 201.0±20.4 203.0±17.2

Notice: Different from control,*P<0.05, **P<0.01, ***P<0.001. Values are means±SE,n=6.

Fig. 1. Pig rectal temperature before (B) and after (A) heat treatment (5 h at 40 °C). Pigrectal temperature was significantly elevated following heat treatment (P<0.05).Values represent the mean±SE, n=6 pigs for each group. *P<0.05 before versus afterheat stress.

2 J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

ARTICLE IN PRESS

Forty eightmale, two-month oldChinesemini pigs (bodymass7.6±0.5 kg) were purchased from the Changping Experimental Pig Farm,Chinese Agricultural University. Pigs were randomly assigned to eithercontrol or heat treated groups (24 pigs per treatment group) accountingfor body weight and litter origin. The two groups were raised in anartificial climate chamber (light, 7:00–19:00 h, humidity 60%) with freeaccess to food and water. Routine immunizations were performed.

2.2. Treatments and sampling

Both control and heat treated groups were initially housed for fivedays at 23 °C. Animals in the heat treated groupwere then subjected to40 °C for 5 h, from 04:00 to 09:00 h, before the temperature waslowered back to 26 °C. Heat-treated animals underwent this protocolfor ten consecutive days, while control animals were maintained at23 °C only. Rectal and body surface temperatureswere detected beforeand after each exposure using infrared and contact thermometers(Fluke 561, USA). Six pigs were randomly selected from each group at1, 3, 6 and 10 days. Pigs were electrically stunned using a head-onlyelectric stun tong (Xingye Butchery Machinery Co. Ltd, Changde,Hunan Province, PR China) and subsequently exsanguinated. Bloodsamples were collected and centrifuged at 3000 g for 10 min, and thesera stored at −20 °C until required. Sections of the duodenum,jejunum and ileum were rapidly excised and washed with physiolog-ical saline. All intestinal segments were divided into three parts: 1) a1 cm length section was fixed in 10% neutral formalin for paraffinembedding; 2) a 1 mm2 sample was fixed in 4% glutaraldehyde forelectron microscopy; 3) a 3 cm length section was minced andseparated into three sample tubes, snap frozen in liquid nitrogen andstored at −80 °C until required.

2.3. Morphological examination and serum cortisol analysis

Formalin-fixed samples were embedded in paraffin and sectionedin transverse (5 μm thick). After deparaffinization and dehydration,the sections of the duodenum, jejunum and ileum were stained withhematoxylin and eosin. The structure of the mucosa was observedusing a BH2 Olympus microscope (Olympus, Tokyo, Japan) andanalyzed using an image analysis system (Olympus 6.0, Tokyo, Japan).Using 40× magnification,

Villi height and crypt depth of at least five well-oriented villi weremeasured and recorded. Intestinal epithelial cells were examined byelectronmicroscopy. Small pieces of the intestine were fixed for 1 h in4% glutaraldehyde in 0.1-M cacodylate buffer (pH 7.4). Tissue sectionswere then washed in the same buffer and fixed for 1 h in cold 1%osmium tetroxide in cacodylate buffer. After dehydration in gradedethanol solutions, the preparations were embedded in Araldite (EPON812, Emicron, Shanghai, China). Ultra-thin sections were stained withsaturated uranyl acetate in 50% ethanol and lead citrate, andexamined by transmission electron microscopy (JEM, 1230, JEOL,Tokyo, Japan). Serum cortisol concentration was determined using anI125 cortisol radioimmunoassay kit, according to the manufacturer'sinstructions (Beijing Chemclin Biotech Co., Ltd, China).

2.4. Total RNA isolation and reverse transcription (RT)

Total RNA was isolated from the pig small intestine using a phenoland guanidine isothiocyanate-based TRIzol reagent (Invitrogen, USA.)according to the manufacturer's instructions. The concentration andpurity of isolated RNA was assessed by a spectrophotometry(SmartSpec plus, BIO-RAD, USA) based on the OD260/OD280 ratio.Total RNA was reverse transcribed as follows: 2.0 μg RNA isolatedfrom each tissue sample was added to 25 μL reaction solutioncontaining 2.0 μL oligo-dT18, 5.0 μL dNTPs, 1.0 μL RNase inhibitor,1.0 μL M-MLV transcriptase, 5.0 μL M-MLV RT reaction buffer(Promega, USA) and RNase-free water. The reverse-transcription

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcineBiochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008

procedure was performed based on manufacturer's instructions(Promega, USA); in brief, 70 °C for 5 min followed by 42 °C for 2 h.The RT products (cDNA) were then stored at −20 °C for PCR.

2.5. DNA microarray

2.5.1. RNA extraction and target labelingTotal RNA was isolated from the pig jejunum by TRIzol reagent

(Invitrogen Life Technologies, P/N 15596-018) and an RNeasy Mini Kit(QIAGEN, P/N74104) according to themanufacturer's instructions. RNAintegrity of each samplewas documented using a RNA 6000 LabChip Kitand an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA,USA). RNA was only processed when it had a 28 S/18 S rRNA ratio of≥1.8. RNA was purified using a QIAGEN RNeasy® Mini Kit (#74106,QIAGEN) and amplified using a Low RNA Input Linear Amplification kit(#5184-3523, Agilent, USA). Each RNA sample was annealed with aprimer containing polydT and T7 polymerase promoters. Reversetranscriptase produced single and double-stranded cDNAs. T7 RNApolymerase then created cRNA from the double-stranded cDNA byincorporating cyanine-3-labeled cytidine 5-triphosphate. The quality ofthe labeled cRNA was again verified and the absolute concentrationdetermined by spectrophotometry (ND1000, Nanodrop).

2.5.2. Hybridization, scanning and feature extractionThe cRNA was hybridized to arrays; equal amounts of cRNA were

hybridized using a Gene Expression Hybridization Kit (#5188-5242,Agilent, USA). Hybridization was performed at 60 °C for 17 h onAffymetrixWhole Porcine GenomeArrays (#ATH1-121501, Affymetrix,

small intestine: A morphological and gene expression study, Comp.

Fig. 2. Pig body surface temperature before (B) and after (A) heat stress. Body surface temperature was significantly increased after heat treatment (40 °C for 5 h). Values representthe mean±SE, n=6 pigs for each group. *P<0.05 before versus after heat stress.

3J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

ARTICLE IN PRESS

USA). Arrays were washed using a Gene Expression Wash Buffer Kit(#5188-5327, Agilent) before the stabilization and drying solution wasapplied (#5185-5979, Agilent). Arrays were scanned on a Microarray

Fig. 3. Heat-induced changes in serum corticosterone levels. Cortisol levels of heat-stressed animals were significantly higher than control animals on the 1st, 3rd, 6th and10th day after initial heat stress. Values represent the mean±SE, n=6 pigs for eachgroup. *P<0.05 heat-stressed versus control.

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcineBiochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008

Scanner (Affymetrix® GeneChip® Scanner 3000, USA) and the datacompiled with the Affymetrix Feature Extraction Software (AffymetrixGeneChip Operating Software Version 1.4). The processes involvinginitial RNA amplification through to the final output data were allperformed by a private contractor (CapitalBio Co., Ltd, China).

2.5.3. Microarray data analysisArray normalization and error detection analysis were carried out

usingAffymetrixGeneChipOperatingSoftwareVersion1.4 (Affymetrix).First, values of poor intensity and lowdependabilitywere removedusinga “filter on flags” feature, where standardized software algorithmsdetermined which spots were “present”, “marginal”, or “absent.” Spotswere considered “present” only where the output was uniform, notsaturated, and significant above background. Spots that satisfied themain requirements but were calculated to be outliers relative to thetypical values for the other genes were considered “marginal.” Filterswere set to retain only the values that were found to be present ormarginal for further analysis. Data were normalized by the algorithmssupplied with the feature extraction software. After normalization, onefinal quality-control filter was applied, where genes showing excessivebiological variability were discarded. Bioinformatic analysis includingmolecular function, biological processes, cellular components and KEGGpathway were conducted using a Molecule Annotation System (http://bioinfo.capitalbio.com/mas/).

small intestine: A morphological and gene expression study, Comp.

Fig. 4. Photomicrographs of hematoxylin- and eosin-stained sections of the pig small intestine from heat treated and control animals after 3 days of treatment (200×magnification). A and B)Control andheat treatedduodenums, respectively;C andD)control andheat treated jejunums respectively; E andF) control andheat treated ileums, respectively. Severedamage to the intestinalvilli is apparent, with desquamation at the tips of the intestinal villi and exposure of the lamina propria. Abnormal microstructures are indicated with arrowheads. Scale bar 100 μm.

4 J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

ARTICLE IN PRESS

2.6. Validation of HSP90, HSP70, HSP27, EGF and EGFR mRNA in the pigjejunum by real-time PCR

Expression of HSP70, HSP90, HSP27, EGF and EGFR were quantita-tively determined using real-time PCR. Quantitative PCR analysis wascarried out using the DNA Engine Mx3000P® fluorescence detectionsystem against a double-stranded DNA-specific fluorescent dye(Stratagene, USA) according to optimized PCR protocols. β-actinwas amplified in parallel with the target genes providing a control.The cDNA was subjected to real-time RT-PCR using the primer pairslisted in Table 1. The PCR reaction system (20 μL) contained 10 μL ofSYBR Green qPCR mix, 0.3 μL of reference dye, 1 μL of each primer(both 10 μmol/L), and 1 μL of cDNA template. Cycling conditions were94 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 56 °C for 30 sand 72 °C for 40 s. Dissociation began with a step of 95 °C for 1 min,

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcineBiochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008

and then the melting curve from 55 to 95 °C at 0.2 °C/s was monitoredcontinuously by measuring fluorescence. Expression levels weredetermined using the threshold cycle (CT) method as described bythemanufacturer of the detection system. This methodwas applied toeach gene by calculating the expression 2−ΔΔCT, where ΔΔCT is thesum of: [CTgene−CTβ-actin](Heat-stressed)− [CTgene−CTβ-actin](Control).

2.7. Statistical analysis

All results are presented as the mean±SD. Statistical analysis wasperformed by independent-sample T-tests using SPSS 12.0. A P-valueof <0.05 was considered significant. Microarray analysis wasconducted using a Molecule Annotation System (http://bioinfo.capitalbio.com/mas/).

small intestine: A morphological and gene expression study, Comp.

Table 2List of the differentially expressed genes.

Probe set ID Fold change Representative public ID Gene title

Ssc.15939.1.A1_x_at 90.24 AF248302.1 Clone PVA3A Ig heavy chain variable VDJ regionSsc.22483.1.A1_at 44.96 CF795103 Transcribed locusSsc.15988.1.S1_at 6.41 NM_213818.1 Elafin family member proteinSsc.11197.1.S1_at 5.22 CK461732 Heat shock protein 27 kDaSsc.12191.3.A1_at 5.04 BQ604703 90-kDa heat shock protein (hsp90)RPTR-Ssc-ECOLOXL_at 4.41 RPTR-Ssc-ECOLOXL –

Ssc.22953.1.A1_at 4.25 BX671488 –

Ssc.114.1.S1_at 4.15 X68213.1 Heat shock protein 72 (pot.) mRNASsc.12191.2.A1_at 4.12 BQ600020 90-kDa heat shock protein (hsp90)Ssc.18563.1.A1_at 4.01 U15459.1 Clone pvg7a Ig heavy chain variable VDJ regionSsc.4617.1.S1_at 3.72 NM_214394.1 Vitamin D3 25-hydroxylaseSsc.268.1.S1_at 3.48 NM_214075.1 25-hydroxyvitamin D3-24-hydroxylaseSsc.428.10.A1_at 3.43 AB087975.1 T-cell receptor alpha chain mRNA C-region, 3′ end of cdsSsc.5145.1.S1_a_at 3.26 NM_213766.1 Heat shock protein 70.2Ssc.13780.11.S1_x_at 2.63 AB105382.1 MHC class I PD7 mRNA, partial 3′ UTRSsc.14511.1.S1_at 2.49 Y15010.1 CMP-N-acetylneuraminate monooxygenaseSsc.15947.1.A1_at 2.44 AF248278.1 Clone 6 immunoglobulin heavy chainSsc.26799.1.S1_at 2.39 CN166265 Clone Clu_10353.scr.msk.p1.Contig1, mRNA sequenceSsc.496.1.S1_at 2.39 AJ236927.1 Hypothetical protein (5′; clone 2C2)Ssc.286.1.S1_s_at 2.38 NM_213817.1 Inflammatory response protein 6Ssc.23513.1.S1_at 2.37 BP168084 MRNA, clone:THY010204E06, expressed in thymusSsc.23287.1.A1_at 2.35 BX672495 –

Ssc.23986.1.S1_at 2.35 CK451737 MRNA, clone:SPL010080F09, expressed in spleenSsc.15885.1.S1_at 2.34 NM_213804.1 RNA helicaseSsc.18554.1.S1_x_at 2.30 AB105380.1 SLA-1 mRNA for MHC class I antigen, partial cds, allele:SLA-1*02Ssc.13769.1.S1_at 2.27 M81327.1 LactoferrinSsc.16335.1.S2_at 2.26 X62984.1 Lipoprotein lipaseSsc.12072.1.S1_a_at 2.25 BI181608 MRNA, clone:UTR010033A11, expressed in uterusSsc.3968.1.S1_at 2.23 NM_213947.1 Epididymal secretory protein E4RPTR-Ssc-ECOLOXL_x_at 2.21 RPTR-Ssc-ECOLOXL –

Ssc.17799.1.A1_at 2.12 AB087930.1 TCR-a mRNA for T-cell receptor alpha chain, partial cds, clone:PPA151Ssc.27304.1.S1_at 2.11 BI327092 Thymosin beta-4 (LOC733606), mRNASsc.18773.1.A1_at 2.09 CF363138 Clone rski0137_l13.y1.abd, mRNA sequenceSsc.21.1.S1_s_at 2.06 AF319661.1 RNA helicaseSsc.21283.1.S1_at 2.01 BI118474 MRNA, clone:LVRM10044E04, expressed in liverSsc.24.1.S1_at 2.01 NM_001001535.1 Muscle-specific intermediate filament desminSsc.10974.1.S1_at −2.00 NM_213931.1 Arachidonate 12-lipoxygenaseSsc.16234.1.A1_at −2.01 CB472702 HaptocorrinSsc.26113.2.S1_at −2.07 BX914409 MRNA, clone:LNG010058C07, expressed in lungSsc.315.1.S1_at −2.09 NM_214108.1 DipeptidaseSsc.206.1.S1_at −2.11 NM_214420.1 Cytochrome P450 2C49Ssc.29175.1.A1_at −2.13 CO951217 MHC class I PD7 mRNA, partial 3′ UTRSsc.18553.1.S1_at −2.13 AB105383.1 SLA-2 mRNA for MHC class I antigen, partial cds, allele:SLA-2*03Ssc.16051.1.S1_at −2.16 AJ681165 Cellular disintegrin precursorSsc.10654.1.A1_at −2.20 BQ597543 MRNA, clone:PBL010089E08, expressed in peripheral blood mononuclear cellSsc.203.1.S1_at −2.21 NM_214422.1 cytochrome P450 3A39Ssc.22959.1.S1_at −2.21 BX676168 MRNA, clone:LVR010098C08, expressed in liverSsc.26321.1.S1_s_at −2.23 U35733.1 Cytochrome P450 2C34 /// cytochrome P450 2C35 /// cytochrome P450 2C36 /// cytochrome P450 2C49Ssc.10015.1.A1_at −2.27 CK465404 Vascular endothelial growth factorRPTR-Ssc-AF292560-1_s_at −2.30 RPTR-Ssc-AF292560-1 –

Ssc.17770.1.S1_at −2.30 AF334739.1 Clone 2-4 immunoglobulin kappa light chain VJ regionSsc.710.1.S1_at −2.32 M31496.1 SecretinSsc.11267.1.S1_at −2.33 NM_214413.1 Cytochrome P450 2B22Ssc.15949.1.A1_at −2.35 AF248274.1 Clone 2 immunoglobulin heavy chainSsc.11791.1.S1_at −2.38 NM_213967.1 Scavenger receptor class B member 1Ssc.14073.2.S1_at −2.39 AJ683636 MRNA, clone:LVRM10122H12, expressed in liverSsc.26326.1.A1_at −2.44 AB052266.1 Cytochrome P450 3A46Ssc.714.1.S1_at −2.45 NM_214235.1 MotilinSsc.14551.1.S1_at −2.52 NM_213906.1 Amelogenin 173ASsc.11171.1.S1_at −2.73 CN167008 MRNA, clone:THY010088A06, expressed in thymusSsc.15996.1.S1_at −2.87 AJ399510.1 Apolipoprotein B (apoB gene), editing regionSsc.55.1.S1_at −3.01 NM_214007.1 Epidermal growth factor receptorSsc.15949.1.S1_at −3.20 AF248274.1 Clone 2 immunoglobulin heavy chainSsc.87.1.S1_at −3.37 NM_214020.1 Epidermal growth factorSsc.14073.1.S1_at −3.38 CN159960 MRNA, clone:LVRM10122H12, expressed in liverSsc.29911.1.A1_at −3.43 CO939399 MRNA, clone:TCH010025F03, expressed in tracheaSsc.16213.1.S1_x_at −3.45 L36579.1 MHC class II SLA-DRB2-2D mRNA, exon 2Ssc.5204.1.S1_at −3.46 CK463412 Clone rnco1933b_j2.y1.abd, mRNA sequenceSsc.645.1.S1_at −3.47 NM_213859.1 Stefin A1Ssc.18948.1.S1_at −4.06 CB475095 Serum amyloid A2 (LOC733603), mRNASsc.15995.2.S1_at −4.68 AF233358.1 Slow delayed rectifier K+ channelSsc.16212.1.S1_x_at −5.14 L36575.1 MHC class II SLA-DRB2-2D mRNA, exon 2 /// MHC class II SLA-DRB2-2A mRNA, exon 2Ssc.16203.1.S1_x_at −8.70 Z81295.1 Hn-RNA, clone h5155Ssc.16169.1.S1_x_at −9.74 CB338040 –

Ssc.27875.1.A1_at −29.12 CO988835 Transcribed locus

5J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

ARTICLE IN PRESS

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp.Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008

Fig. 5.Morphological alterations in the ultrastructure of the porcine jejunal epithelium following 3 days of heat treatment (50,000× magnification). A and B) control jejunum; C andD) heat treated jejunum. Microvillus height was significantly shorter in the heat treated jejunum compared with the control (2013±18 nm versus 2232±30 nm, respectively).Three days of heat treatment caused the internal cristae of mitochondria to become swollen and shortened, increased the number of mitochondria and secondary lysosomes present,as well as alter tight junction morphology (indicated by arrows).

6 J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

ARTICLE IN PRESS

3. Results

3.1. Rectal temperature, body surface temperature and serum cortisolconcentration

Pig rectal and body surface temperatures were significantlyelevated after 5 h of chronic heat exposure (Figs. 1 and 2). Serumcortisol concentration of heat treated pigs was also significantlyhigher than that of the control group (Fig. 3).

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcineBiochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008

3.2. Morphological analysis

Heat treatment clearly caused marked damage to the pig smallintestine, found to be most severe in the jejunum after 3 days of heattreatment. Desquamation of mucosal epithelium was exhibited at thetips of the intestinal villi, exposing the lamina propria (Fig. 4). Villiheight and crypt depth was shorter in the heat treatment groupcompared to control animals (Table 2), most evident in the jejunumafter 3 days of heat treatment.

small intestine: A morphological and gene expression study, Comp.

Table 3Primers used for real-time PCR.

Description Accessionnumber

Primer sequence Product(bp)

β-actin NM_031144 Forward: TTGTCCCTGTATGCCTCTGG 218Reverse: ATGTCACGCACGATTTCCC

HSP70 M29506 Forward: GTGGCTCTACCCGCATCCC 114Reverse: GCACAGCAGCACCATAGGC

HSP90 NM_213973 Forward: CGCTGAGAAAGTGACCGTTATC 126Reverse: ACCTTTGTTCCACGACCCATAG

HSP27 NM_001007518 Forward: AGGAGCGGCAGGATGAG 101Reverse: GGACAGGGAGGAGGAGAC

EGF NM_214020 Forward : CAGTAACCTGGGAATGTGGC 231Reverse : GGGCTGTATGGGCAAAGTAT

EGFR NM_214007 Forward : GCCTTAGCCGTCTTATCCAA 299Reverse : TGGGCACAGATGACTTTGGT

Table 5Biological process analysis result of the differentially expressed genes.

Biological process Total P-value Q value

GO:0006986 response to unfolded protein 5 0.000000 0.000000GO:0030334 regulation of cell migration 1 0.000000 0.000000GO:0006457 protein folding 5 0.000000 0.000000GO:0006413 translational initiation 1 5.85E-4 3.6E-4GO:0006118 electron transport 8 0.005031 0.002991GO:0006879 iron ion homeostasis 1 0.014016 0.008035GO:0006826 iron ion transport 1 0.020764 0.011876GO:0007173 epidermal growth factor receptor signal.. 2 0.020980 0.011971GO:0006824 cobalt ion transport 1 0.039577 0.022423GO:0046327 glycerol biosynthesis from pyruvate 1 0.040751 0.023034GO:0050730 regulation of peptidyl-tyrosine phospho.. 2 0.080068 0.045047GO:0048595 eye morphogenesis (sensu Mammalia) 1 0.135553 0.075778GO:0050679 positive regulation of epithelial cell .. 1 0.149207 0.083314GO:0009168 purine ribonucleosidemonophosphate bio..

1 0.156470 0.087219

GO:0030324 lung development 1 0.195823 0.108404GO:0006813 potassium ion transport 1 0.219127 0.121097GO:0046685 response to arsenic 2 0.354286 0.194676GO:0045187 regulation of circadian sleep/wake cycl.. 2 0.355078 0.194889GO:0008293 torso signaling pathway 2 0.410344 0.222943GO:0007098 centrosome cycle 2 0.413952 0.224650GO:0008595 determination of anterior/posterior axi.. 2 0.431667 0.234001GO:0046777 protein amino acid autophosphorylation 1 0.433061 0.234494GO:0009408 response to heat 3 0.453834 0.245055GO:0048754 branching morphogenesis of a tube 1 0.471393 0.254110GO:0030855 epithelial cell differentiation 1 0.487382 0.262437GO:0007465 R7 cell fate commitment 2 0.548343 0.294277GO:0008284 positive regulation of cell proliferati.. 2 0.566955 0.303760GO:0042462 eye photoreceptor cell development 1 0.575281 0.307708GO:0006811 ion transport 3 0.580626 0.308711GO:0006983 ER overload response 1 0.580990 0.308711GO:0018108 peptidyl-tyrosine phosphorylation 1 0.585094 0.310550GO:0007229 integrin-mediated signaling pathway 1 0.637633 0.330093GO:0007498 mesoderm development 1 0.642068 0.332033GO:0009615 response to virus 1 0.662201 0.334293GO:0007169 transmembrane receptor protein tyrosine 1 0.719917 0.334293GO:0045103 intermediate filament-based process 1 0.727416 0.334293GO:0016042 lipid catabolism 1 0.793788 0.364448GO:0051084 posttranslational protein folding 1 0.807103 0.366878GO:0051085 chaperone cofactor-dependent protein fo.. 1 0.807103 0.366878GO:0001525 angiogenesis 1 0.844462 0.379772GO:0008360 regulation of cell shape 2 0.853074 0.383288GO:0048514 blood vessel morphogenesis 1 0.879798 0.383943GO:0006094 gluconeogenesis 1 0.889246 0.383943GO:0001568 blood vessel development 1 0.905634 0.383943GO:0006163 purine nucleotide metabolism 1 0.917381 0.383943

7J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

ARTICLE IN PRESS

Ultrastructure examination of the pig jejuna epithelium on day 3revealed that microvilli height in heat-stressed pigs was significantlyshorter than the control (2232 nm±30 versus 2013±28 nm,P<0.05). Jejunal epithelium exhibited an increased number ofmitochondria with shortened internal cristae, increased organelledebris within the lysosomes, and enterocyte tight junction morphol-ogy was found to be altered (Fig. 5).

3.3. Microarray and bioinformatic analysis

Gene expression profiling in the pig jejunum at day 3 wasperformed using cDNA microarrays. 93 genes were found to besignificantly up-regulated and 110 genes down-regulated (T-testP<0.01 and fold change≥2.0) in the heat treated group compared tothe control. Some of the significant genes are listed in Table 3.

To further characterize the types of genes altered in response toheat stress, the 203 genes that were significantly altered in responseto heat stress (P<0.01) were classified into gene ontology (GO) slimterms. GO slim assigns high level terms from each of the three majorgene ontologies: molecular function, biological processes and cellularcomponents.

Molecular function analysis (Table 4) showed GO 0003779 (actinbinding), GO 0004497 (monooxygenase activity), GO 0003743

Table 4Molecular function analysis result of the differentially expressed genes.

Molecular function Total P-value Q value

GO:0003779 actin binding 1 1.6E-5 1.0E-5GO:0004497 monooxygenase activity 6 2.0E-5 1.2E-5GO:0003743 translation initiation factor activity 1 3.12E-4 1.94E-4GO:0030338 CMP-N-acetylneuraminatemonooxygenase a..

1 0.001223 7.49E-4

GO:0005506 iron ion binding 9 0.003643 0.002207GO:0016712 oxidoreductase activity, acting on pair.. 6 0.006979 0.004098GO:0048503 GPI anchor binding 1 0.008528 0.004987GO:0008199 ferric iron binding 1 0.010594 0.006184GO:0020037 heme binding 6 0.010996 0.006364GO:0004465 lipoprotein lipase activity 1 0.013369 0.007678GO:0015087 cobalt ion transporter activity 1 0.024175 0.013770GO:0004000 adenosine deaminase activity 1 0.031314 0.017815GO:0050897 cobalt ion binding 1 0.032498 0.018467GO:0019239 deaminase activity 1 0.038400 0.021795GO:0005249 voltage-gated potassiumchannel activit..

1 0.039577 0.022423

GO:0004613 phosphoenolpyruvatecarboxykinase (GTP)..

1 0.040751 0.023034

GO:0004611 phosphoenolpyruvatecarboxykinase activ..

1 0.044267 0.024978

GO:0005006 epidermal growth factor receptor activi.. 1 0.046603 0.026265

GO:0007010 cytoskeleton organization and biogenesi.. 1 0.921234 0.383943GO:0007283 spermatogenesis 2 0.923033 0.383943GO:0007015 actin filament organization 2 0.929363 0.383943GO:0015671 oxygen transport 1 0.972912 0.383943GO:0009117 nucleotide metabolism 1 0.975677 0.383943GO:0019882 antigen processing and presentation 4 0.979551 0.383943GO:0016477 cell migration 1 0.990376 0.383943GO:0006468 protein amino acid phosphorylation 1 0.990849 0.383943GO:0002474 antigen processing and presentation of .. 1 0.991021 0.383943GO:0019886 antigen processing and presentation of .. 1 0.994540 0.383943GO:0019884 antigen processing and presentation of .. 1 0.994894 0.383943GO:0006916 anti-apoptosis 1 0.996809 0.383943GO:0008283 cell proliferation 2 0.996921 0.383943GO:0007517 muscle development 1 0.996928 0.383943GO:0006461 protein complex assembly 2 0.997131 0.383943GO:0007155 cell adhesion 1 0.997700 0.383943GO:0006629 lipid metabolism 2 0.998455 0.383943GO:0006955 immune response 3 0.999731 0.383943GO:0048002 antigen processing and presentation of .. 1 0.999958 0.383943GO:0006952 defense response 3 0.999970 0.383943GO:0007166 cell surface receptor linked signal tra.. 1 0.999976 0.383943GO:0000074 regulation of progression through cell .. 2 0.999987 0.383943GO:0000902 cell morphogenesis 1 0.999997 0.383943GO:0006950 response to stress 3 1.000000 0.383943GO:0007165 signal transduction 1 1.000000 0.383943GO:0006810 transport 3 1.000000 0.383943GO:0007275 development 1 1.000000 0.383943GO:0030154 cell differentiation 1 1.000000 0.383943

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp.Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008

Table 6Cellular component analysis result of the differentially expressed genes.

Cellular component Total P-value Q value

GO:0043292 contractile fiber 2 0.0 0.0GO:0005626 insoluble fraction 2 0.0 0.0GO:0005625 soluble fraction 1 0.0 0.0GO:0005634 nucleus 3 0.0 0.0GO:0005886 plasma membrane 3 0.0 0.0GO:0030018 Z disc 2 0.0 0.0GO:0030018 Z disc 2 0.0 0.0GO:0016599 caveolar membrane 1 0.15647 0.087219GO:0000299 integral to membrane of membrane fracti.. 1 0.157502 0.087643GO:0030139 endocytic vesicle 1 0.191872 0.106400GO:0042627 chylomicron 1 0.360593 0.197692GO:0005792 microsome 5 0.365918 0.200044GO:0016323 basolateral plasma membrane 1 0.524407 0.281745GO:0005788 endoplasmic reticulum lumen 1 0.578923 0.308711GO:0016282 eukaryotic 43S preinitiation complex 1 0.623782 0.324663GO:0042612 MHC class I protein complex 3 0.695154 0.334293GO:0030424 axon 1 0.710077 0.334293GO:0005887 integral to plasma membrane 2 0.711398 0.334293GO:0005813 centrosome 2 0.711859 0.334293GO:0005737 cytoplasm 7 0.723935 0.334293GO:0005882 intermediate filament 1 0.799071 0.366526GO:0005856 cytoskeleton 3 0.811586 0.366878GO:0031965 nuclear membrane 1 0.834532 0.376006GO:0005783 endoplasmic reticulum 6 0.920480 0.383943GO:0005769 early endosome 1 0.933790 0.383943GO:0042613 MHC class II protein complex 1 0.977664 0.383943GO:0005771 multivesicular body 1 0.993076 0.383943GO:0005768 endosome 1 0.998888 0.383943GO:0005794 Golgi apparatus 1 0.999398 0.383943GO:0005615 extracellular space 6 0.999960 0.383943GO:0009897 external side of plasma membrane 1 0.999975 0.383943GO:0005840 ribosome 1 0.999979 0.383943GO:0005829 cytosol 4 0.999998 0.383943GO:0005622 intracellular 2 1.000000 0.383943GO:0005576 extracellular region 2 1.000000 0.383943GO:0016020 membrane 13 1.000000 0.383943GO:0005739 mitochondrion 3 1.000000 0.383943GO:0016021 integral to membrane 6 1.000000 0.383943

8 J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

ARTICLE IN PRESS

(translation initiation factor activity), GO 0030338 (CMP-N-acetyl-neuraminate monooxygenase), GO 0005506 (iron ion binding), GO0016712 (oxidoreductase activity), and GO 0048503 (GPI anchorbinding).

Biological processes analysis (Table 5) showed GO 0006986(response to unfolded protein), GO 0030334 (regulation of cellmigration), GO 0006457 (protein folding), GO 0006413 (translationalinitiation), and GO 0006118 (electron transport).

Cellular component analysis (Table 6) showed GO 0043292(contractile fiber), GO 0005626 (insoluble fraction), GO 0005625(soluble fraction), GO 0005634 (nucleus), GO 0005886 (plasmamembrane), and GO 0030018 (Z disc).

To define the biological pathways associatedwith heat stress in thepig jejunum, analysis of microarray data was conducted by a MoleculeAnnotation System (http://bioinfo.capitalbio.com/mas/). A KEGGpathway analysis revealed linoleic acid metabolism, MAPK signaling,metabolism of xenobiotics by cytochrome P450, arachidonic acidmetabolism, as well as changes in gap junction and focal adhesionmolecules were all involved in response to heat stress (Table 7,P<0.01).

3.4. Real-time PCR

HSP70, HSP90 and HSP27 mRNA expression was significantly up-regulated, while EGF and EGFR mRNA expression was significantlydown-regulated in the pig jejunum after heat exposure. Heat-inducedchanges in gene expression closely correlated with the correspondingmicroarray data, although the exact fold change differed between thetwo assays (Fig. 6).

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcineBiochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008

4. Discussion

4.1. Assessment of heat stress

In mammals, rectal temperature is used as the best assessment ofheat stress (Srikandakumar et al., 2003; Sinha, 2008). Glucocorticoidsare critical for environmental adaptation, with increased levels ofserum cortisol revealing the occurrence of a stress response (Elezet al., 2000; Mahmoud et al., 2004; Pace et al., 2008). In the presentstudy, pig rectal temperature and serum cortisol levels weresignificantly increased after 5 h of heat stress, consistent withprevious reports (Figs. 1 and 2). Pig body surface temperature wasalso found to be significantly elevated after 5 h of heat stress which israrely reported in heat stress studies (Fig. 3). It is now welldocumented that a strong correlation exists between peripheralblood flow and body surface temperature (Hardy and Soderstrom,1938). Heat stress causes an increase in peripheral blood flow,allowing increased heat dissipation at the skin, observed by anelevated body surface temperature (Marai et al., 2007).

4.2. Heat stress causes marked injury to the pig small intestine

When pigs are exposed to environmental temperatures greaterthan their thermoneutral temperature, compensatory mechanismsare activated to protect vital organs and dissipate internal heat at thebody surface, while reducing blood flow to the GI tract (Kregel et al.,1988; Rowell, 1974). However, shunting of blood flow from the GItract to the periphery can result in intestinal cellular hypoxia (Hallet al., 2001), ATP depletion, acidosis and cellular dysfunction,resulting in necrosis and shedding of intestinal epithelial cells (Gisolfi,2000). In our morphological study, we found that heat treatmentcaused marked damage to the tips of the intestinal villi, inducingepithelial cell shedding, exposing the intestinal mucosa laminapropria, as well as shortening villus height and crypt depth in thesmall intestine. Intestinal damage was found to be most severe in thejejunum after 3 days of heat treatment (Fig. 4). Ultrastructureexamination revealed that the jejunum microvillus height wasshorter, mitochondria were swollen, the number of lysosomes wasincreased and the enterocyte tight junction structure was altered after3 days of heat treatment (Fig. 5). Mitochondrial swelling is a hallmarkof mitochondrial damage, potentially caused by an increase in reactiveoxygen species stimulated in response to heat stress (Heise et al.,2003; Hua et al., 2007). The increased number of lysosomes mayindicate an increase in the amount of denatured protein and damagedorganelles (Sonna et al., 2002).

4.3. Heat stress significantly alters the gene expression profile of the pigjejunum

Heat stress triggers a complex cellular response including alteringgene expression (Sonna et al., 2002; Kültz, 2005). To gain insight intothe molecular mechanisms by which heat stress exerts its complexbiological effects, we performedmicroarray analysis to assess changesin gene expression levels in response to heat stress. The results ofmicroarray found 93 genes to be up-regulated and 110 genes down-regulated in the pig jejunum after 3 days of heat stress (Table 3). Tofurther characterize the types of genes altered, we classified the 203genes into gene ontology (GO) slim terms (Tables 4, 5 and 6). Geneontology analysis revealed that heat stress alters genes regulatingunfolded proteins, the initiation of translation, cell proliferation andcell migration in the pig jejunum. Under conditions of heat stress,denaturation and misaggregation of protein is rapidly increased,which triggers an unfolded protein response. This response charac-teristically includes an increase in HSP expression (Sonna et al., 2002;Keller et al., 2008; Young et al., 2009). The current study determinedHSP70, HSP90 and HSP27 expression were all significantly up-

small intestine: A morphological and gene expression study, Comp.

Table 7Pathway analysis result of the differentially expressed genes.

KEGG Total P-value Q value gene Input symbol Experiment 1

Linoleic acid metabolism 4 7.8E-5 1.17E-4 CYP3A39 Ssc.203.1.S1_at −2.21CYP2C49 Ssc.206.1.S1_at; −2.23

Ssc.26321.1.S1_s_atALOX15 Ssc.10974.1.S1_at −2.0

MAPK signaling pathway 4 2.98E-4 1.63E-4 EGFR Ssc.55.1.S1_at −3.01Hsp27 Ssc.11197.1.S1_at 5.22HSP70.2 Ssc.5145.1.S1_a_at 3.26EGF Ssc.87.1.S1_at −3.37

Metabolism of xenobiotics by cytochrome P450 4 6.02E-4 2.01E-4 CYP2B22 Ssc.11267.1.S1_at −2.33CYP3A39 Ssc.203.1.S1_at −2.21CYP2C49 Ssc.206.1.S1_at; −2.23

Ssc.26321.1.S1_s_atArachidonic acid metabolism 4 0.002249 5.39E-4 CYP2B22 Ssc.11267.1.S1_at −2.33

CYP2C49 Ssc.206.1.S1_at; −2.23Ssc.26321.1.S1_s_at

ALOX15 Ssc.10974.1.S1_at −2.0Gap junction 2 0.002606 5.39E-4 EGFR Ssc.55.1.S1_at −3.01

EGF Ssc.87.1.S1_at −3.37Focal adhesion 3 0.004329 7.64E-4 EGFR Ssc.55.1.S1_at −3.01

VEGFA Ssc.10015.1.A1_at −2.27EGF Ssc.87.1.S1_at −3.37

Antigen processing and presentation 3 0.014765 0.002272 HSP90 Ssc.12191.3.A1_at; 5.04Ssc.12191.2.A1_at

HSP70.2 Ssc.5145.1.S1_a_at 3.26Regulation of actin cytoskeleton 2 0.026589 0.00371 EGFR Ssc.55.1.S1_at −3.01

EGF Ssc.87.1.S1_at −3.37Gamma-hexachlorocyclohexane degradation 1 0.040242 0.005249 CYP3A39 Ssc.203.1.S1_at −2.21Alzheimer's disease 1 0.053302 0.006663 LPL Ssc.16335.1.S2_at 2.26Glycerolipid metabolism 1 0.066189 0.007637 LPL Ssc.16335.1.S2_at 2.26mTOR signaling pathway 1 0.066189 0.007637 VEGFA Ssc.10015.1.A1_at −2.27Cell communication 1 0.066189 0.007637 LOC396725 Ssc.24.1.S1_at 2.01VEGF signaling pathway 1 0.091454 0.009799 Hsp27 Ssc.11197.1.S1_at 5.22Adherens junction 1 0.103836 0.010742 EGFR Ssc.55.1.S1_at −3.01Cytokine–cytokine receptor interaction 2 0.180692 0.017773 EGFR Ssc.55.1.S1_at −3.01

EGF Ssc.87.1.S1_at −3.37Calcium signaling pathway 1 0.338208 0.031707 EGFR Ssc.55.1.S1_at −3.01Neuroactive ligand-receptor interaction 1 0.587815 0.053438 MLN Ssc.714.1.S1_at −2.45

9J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

ARTICLE IN PRESS

regulated after heat stress, consistent with previous reports. Alteringgene expression is an integral part of the cellular response to heatstress as this regulates protein translation, and hence cellularfunction. Heat stress can affect gene transcription via three mechan-

Fig. 6. mRNA expression of HSP90, HSP70, HSP27, EGF and EGFR in the pig jejunumusing real-time PCR.

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcineBiochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008

isms: 1) alter the level of transcription factors; 2) adjust the activity oftranscription factors; and 3) change the cellular location of transcrip-tion factors (Sonna et al., 2002; Hahn et al., 2004). In the currentstudy, genes relating to the regulation of translation were found to besignificantly altered following heat treatment, in agreement withprevious reports. We recently reported that heat stress-induceddamage to the pig small intestine epithelial tissue was rapidlyrepaired within the following few days following heat stress (Liuet al., 2009). The regeneration of the damaged intestine epitheliumencourages crypt cell proliferation and migration (Kaushik and Kaur,2005). Consistent with rapid cellular regeneration, the current studyfound that the expression of genes related to the regulation of cellproliferation and migration was significantly altered after heat stress.

Furthermore, the changes in gene expression following heat stressprovided significant insight into the potential biological pathwaysactivated or inhibited in response to heat stress (Table 7) in the pigsmall intestine. Pathway analysis of genes altered following heattreatment revealed linoleic acid metabolism, MAPK signaling, metab-olism of xenobiotics by cytochrome P450 and arachidonic acidmetabolism to be involved in the response to heat stress.

Linoleic and arachidonic acid are essential for tissue growth anddevelopment, and play a critical role in intestinal epithelial celldifferentiation and tumor development (Hui et al., 1999; Kawajiriet al., 2002). Metabolism of arachidonic and linoleic acid viaprostaglandin H synthases and lipoxygenases generate an array oflipid compounds which serve as potent mediators of severalphysiological and pathophysiological processes (Zeldin, 2001). Ourresults found heat stress to stimulate genes regulating arachidonicacidmetabolism, potentially in response to oxidative stress in order toalleviate the stress response.

small intestine: A morphological and gene expression study, Comp.

10 J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

ARTICLE IN PRESS

Mitogen-activated protein kinase (MAPK) signaling pathways areimportant downstream targets of activated growth factor receptors(such as EGFR and PDGFR) involved in mediating the intracellularresponse to extracellular stimuli. In mammals, three primary MAPKsexist includingextracellular signal-regulatedprotein kinase (ERK), c-JunNH2-terminal kinase (JNK), and p38 MAPK (Anderson, 2006). MAPKsare activated in response to extracellular stresses includingUV radiation,osmotic shock, heat shock and lipopolysaccharides, in addition toactivation by endogenous factors including growth cytokines, autacoidsand neurotransmitters (Muthusamy and Piva, 2010). MAPK signalingregulates a wide range of intracellular activity, including geneexpression, cell differentiation, cell proliferation, cell survival andapoptosis (Sompallae et al., 2008). We previously reported that heatstress significantly injured the pig small intestine epithelial tissue, andthis tissue was rapidly repaired within a few days. Based on our geneexpression analysis, we suggest that heat stress-induced alterations inMAPK signaling may regulate the repair and regeneration of thedamaged intestinal epithelium by encouraging crypt cell proliferationand migration.

In conclusion, the present study investigated the effect of heatstress on morphology and gene expression in the porcine smallintestine. Heat stress was found to cause significant morphologicaldamage to the epithelium of the pig small intestine. Gene expressionprofiling analysis revealed 203 genes to be differentially expressed inresponse to heat stress. Subsequent bioinformatic analysis of thedifferentially expressed genes provides significant insight into thepotential mechanisms underlying heat stress-induced damage as wellas repair/regeneration in porcine small intestines.

Acknowledgments

We are thankful for the help from the members of CAU-BUA TCVMteaching and research team. This work was supported by grants fromthe National Natural Science Foundation of China (No. 30771566),the Beijing Education Committee Programs of Academic InnovationTeam, Beijing Natural Science Foundation (No. 6082007) and theNational Eleventh Five-Year Scientific and Technological Support Plan(No. 2008BADB4B01, 2008BADB4B07).

References

Anderson, D.H., 2006. Role of lipids in the MAPK signaling pathway. Prog. Lipid Res. 45,102–119.

Cario, E., Gerken, G., Podolsky, D.K., 2002. "For whom the bell tolls!" — innate defensemechanisms and survival strategies of the intestinal epithelium against lumenalpathogens. Z. Gastroenterol. 40, 983–990.

Elez, D., Vidovic, S., Matic, G., 2000. The influence of hyperthermic stress on the redoxstate of glucocorticoid receptor. Stress 3, 247–255.

Gisolfi, C.V., 2000. Is the GI system built for exercise? News Physiol. Sci. 15, 114–119.Hahn, J.S., Hu, Z., Thiele, D.J., Iyer, V.R., 2004. Genome-wide analysis of the biology of

stress responses through heat shock transcription factor. Mol. Cell. Biol. 24,5249–5256.

Hall, D.M., Buettner, G.R., Oberley, L.W., Xu, L., Matthes, R.D., Gisolfi, C.V., 2001.Mechanisms of circulatory and intestinal barrier dysfunction during whole bodyhyperthermia. Am. J. Physiol. 280, H509–H521.

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcineBiochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008

Hardy, J.D., Soderstrom, G.F., 1938. Heat loss from the nude body and peripheral bloodflow at temperatures of 22 °C to 35 °C: two figures. J. Nutr. 16, 493–510.

Heise, K., Puntarulo, S., Pörtner, H.O., Abele, D., 2003. Production of reactive oxygenspecies by isolated mitochondria of the Antarctic bivalve Laternula elliptica (Kingand Broderip) under heat stress. Comp. Biochem. Physiol. C Toxicol. Pharmacol.134, 79–90.

Hirata, Y., Broquet, A.H., Menchen, L., Kagnoff, M.F., 2007. Activation of innate immunedefense mechanisms by signaling through RIG-I/IPS-1 in intestinal epithelial cells.J. Immunol. 179, 5425–5432.

Hua, G., Zhang, Q., Fan, Z., 2007. Heat shock protein 75 (TRAP1) antagonizes reactiveoxygen species generation and protects cells from granzyme M-mediatedapoptosis. J. Biol. Chem. 282, 20553–20560.

Hui, R., Kameda, H., Risinger, J.I., Angerman-Stewart, J., Han, B., Barrett, J.C., Eling, T.E.,Glasgow, W.C., 1999. The linoleic acid metabolite, 13-HpODE augments thephosphorylation of EGF receptor and SHP-2 leading to their increased association.Prostaglandins Leukot. Essent. Fatty Acids 61, 137–143.

Kaushik, S., Kaur, J., 2005. Effect of chronic cold stress on intestinal epithelial cellproliferation and inflammation in rats. Stress 8, 191–197.

Kawajiri, H., Hsi, L.C., Kamitani, H., Ikawa, H., Geller, M.,Ward, T., Eling, T.E., Glasgow,W.C.,2002. Arachidonic and linoleic acid metabolism in mouse intestinal tissue: evidencefor novel lipoxygenase activity. Arch. Biochem. Biophys. 398, 51–60.

Keller, J.M., Escara-Wilke, J.F., Keller, E.T., 2008. Heat stress-induced heat shock protein70 expression is dependent on ERK activation in zebrafish (Danio rerio) cells. Comp.Biochem. Physiol. A Mol. Integr. Physiol. 150, 307–314.

Kregel, K.C., Wall, P.T., Gisolfi, C.V., 1988. Peripheral vascular responses to hyperthermiain the rat. J. Appl. Physiol. 64, 2582–2588.

Kültz, D., 2005. Molecular and evolutionary basis of the cellular stress response. Annu.Rev. Physiol. 67, 225–257.

Leon, L.R., DuBose, D.A., Mason, C.W., 2005. Heat stress induces a biphasicthermoregulatory response in mice. Am. J. Physiol. 288, R197–R204.

Liu, F., Yin, J., Du, M., Yan, P., Xu, J., Zhu, X., Yu, J., 2009. Heat-stress-induced damage toporcine small intestinal epithelium associated with downregulation of epithelialgrowth factor signaling. J. Anim. Sci. 87, 1941–1949.

Mahmoud, K.Z., Edens, F.W., Eisen, E.J., Havenstein, G.B., 2004. Ascorbic acid decreasesheat shock protein 70 and plasma corticosterone response in broilers (Gallus gallusdomesticus) subjected to cyclic heat stress. Comp. Biochem. Physiol. B Biochem.Mol. Biol. 137, 35–42.

Marai, I.F.M., El-Darawany, A.A., Fadiel, A., Abdel-Hafez, M.A.M., 2007. Physiologicaltraits as affected by heat stress in sheep. A review. Small Rumin. Res. 71, 1–12.

Muthusamy, V., Piva, T.J., 2010. The UV response of the skin: a review of the MAPK,NFkappaB and TNFalpha signal transduction pathways. Arch. Dermatol. Res. 302(1), 5–17.

Pace, T.W., Gaylord, R.I., Jarvis, E., Girotti, M., Spencer, R.L., 2008. Differentialglucocorticoid effects on stress-induced gene expression in the paraventricularnucleus of the hypothalamus and ACTH secretion in the rat. Stress 12, 400–411.

Rowell, L.B., 1974. Human cardiovascular adjustments to exercise and thermal stress.Physiol. Rev. 54, 75–159.

Sinha, R.K., 2008. Serotonin synthesis inhibition by pre-treatment of p-CPA alters sleep-electrophysiology in an animal model of acute and chronic heat stress. J. Therm.Biol. 33, 261–273.

Sompallae, R., Stavropoulou, V., Houde, M., Masucci, M.G., 2008. The MAPK SignalingCascade is a central hub in the regulation of cell cycle, apoptosis and cytoskeletonremodeling by tripeptidyl-peptidase II. Gene Regul. Syst. Biol. 2, 253–265.

Sonna, L.A., Fujita, J., Gaffin, S.L., Lilly, C.M., 2002. Invited review: effects of heat and coldstress on mammalian gene expression. J. Appl. Physiol. 92, 1725–1742.

Srikandakumar, A., Johnson, E.H., Mahgoub, O., 2003. Effect of heat stress on respiratoryrate, rectal temperature and blood chemistry in Omani and Australian Merinosheep. Small Rumin. Res. 49, 193–198.

St-Pierre, N.R., Cobanov, B., Schnitkey, G., 2003. Economic losses from heat stress by USlivestock industries. J. Dairy Sci. 86, E52–E77.

Trevino, V., Falciani, F., Barrera-Saldana, H.A., 2007. DNA microarrays: a powerfulgenomic tool for biomedical and clinical research. Mol. Med. 13, 527–541.

Young, J.T., Gauley, J., Heikkila, J.J., 2009. Simultaneous exposure of Xenopus A6 kidneyepithelial cells to concurrentmild sodiumarsenite and heat stress results in enhancedhsp30 and hsp70 gene expression and the acquisition of thermotolerance. Comp.Biochem. Physiol. A Mol. Integr. Physiol. 153 (433), 417–424.

Zeldin, D.C., 2001. Epoxygenase pathways of arachidonic acid metabolism. J. Biol. Chem.276, 36059–36062.

small intestine: A morphological and gene expression study, Comp.