Edited- Supplemental Affid2.

1
Republic of the Philippines) , ____________, ----------------)ss SUPPLEMENTAL AFFIDAVIT-COMPLAINT I, ____________, of legal age, married, Filipino Citizen, and a resident of , ____________, after having been duly sworn to in accordance with law hereby states under oath that: 1. I have earlier executed an affidavit-complaint against , ____________,; 2. In my affidavit-complaint, I expressly stated the amount , ____________, as the amount misappropriated by the respondent. For clarity, a breakdown of how said amount was incurred as well as other pertinent details is hereto attached for reference; , ____________, 3. I am executing this affidavit to attest to the truth of the foregoing, to support my complaint for estafa against respondent , ____________, and for all intents and purposes it may legally serve. WHEREFORE, I hereunto set my hand this 7 th day of September , ____________, Philippines. , ____________ Affiant

description

Sample

Transcript of Edited- Supplemental Affid2.

REPUBLIC OF THE PHILIPPINES)

Republic of the Philippines), ____________, ----------------)ss

SUPPLEMENTALAFFIDAVIT-COMPLAINT

I, ____________, of legal age, married, Filipino Citizen, and a resident of , ____________, after having been duly sworn to in accordance with law hereby states under oath that:

1. I have earlier executed an affidavit-complaint against , ____________,;

2. In my affidavit-complaint, I expressly stated the amount , ____________, as the amount misappropriated by the respondent. For clarity, a breakdown of how said amount was incurred as well as other pertinent details is hereto attached for reference;

, ____________,3. I am executing this affidavit to attest to the truth of the foregoing, to support my complaint for estafa against respondent , ____________, and for all intents and purposes it may legally serve.

WHEREFORE, I hereunto set my hand this 7th day of September , ____________, Philippines.

, ____________Affiant


Supplemental Figure Legends May 1 AH edited 20 Gain 0.039 C19MC Amp

Supplemental Figure Legends May 1 AH edited 20 Gain 0.039 C19MC Amp

Document S1. Supplemental Results, Supplemental Experimental ...

Document S1. Supplemental Results, Supplemental Experimental ...

SUPPLEMENTAL AGENDA MATERIAL for Supplemental …

SUPPLEMENTAL AGENDA MATERIAL for Supplemental …

Supplemental Material Supplemental Experimental Procedures ...

Supplemental Material Supplemental Experimental Procedures ...

Supplemental Information - Plant Cell · Supplemental Data. Elliott et al. (2014). Plant Cell 10.1105/tpc.114.123620 1 Supplemental Information Supplemental Figures Supplemental Fig.

Supplemental Information - Plant Cell · Supplemental Data. Elliott et al. (2014). Plant Cell 10.1105/tpc.114.123620 1 Supplemental Information Supplemental Figures Supplemental Fig.

Supplemental Information Supplemental Methods & Materials · 2011-10-06 · Supplemental Information Supplemental Methods & Materials Sample recruitment The primary sources for the

Supplemental Information Supplemental Methods & Materials · 2011-10-06 · Supplemental Information Supplemental Methods & Materials Sample recruitment The primary sources for the

Supplemental Tables Supplemental Table 1 Definition of ...

Supplemental Tables Supplemental Table 1 Definition of ...

Figure Legends for Supplemental Figures Supplemental

Figure Legends for Supplemental Figures Supplemental

SUPPLEMENTARY MATERIAL Supplemental Table S1. · PDF fileSUPPLEMENTARY MATERIAL Supplemental Table S1. Supplemental Table S2. Supplemental Table S3. Supplemental Table S4. References.

SUPPLEMENTARY MATERIAL Supplemental Table S1. · PDF fileSUPPLEMENTARY MATERIAL Supplemental Table S1. Supplemental Table S2. Supplemental Table S3. Supplemental Table S4. References.

Supplemental Data Supplemental Figures Legends …dm5migu4zj3pb.cloudfront.net/manuscripts/42000/42127/JCI42127sd.pdf · Supplemental Data Supplemental Figures Legends Suppl. Figure

Supplemental Data Supplemental Figures Legends …dm5migu4zj3pb.cloudfront.net/manuscripts/42000/42127/JCI42127sd.pdf · Supplemental Data Supplemental Figures Legends Suppl. Figure

Supplemental Figures S1-S8. Supplemental Figure S1.

Supplemental Figures S1-S8. Supplemental Figure S1.

Supplemental Information Bigdeli Supplemental Information ...Supplemental Information Bigdeli 1 Supplemental Information Descriptions of Participating Replication Studies Generation

Supplemental Information Bigdeli Supplemental Information ...Supplemental Information Bigdeli 1 Supplemental Information Descriptions of Participating Replication Studies Generation

SUPPLEMENTAL ONLINE MATERIALS Supplemental Materials …ec.asm.org/content/suppl/2008/02/29/7.3.444.DC1/Rev_Park__Sup_Tex… · SUPPLEMENTAL ONLINE MATERIALS Supplemental Materials

SUPPLEMENTAL ONLINE MATERIALS Supplemental Materials …ec.asm.org/content/suppl/2008/02/29/7.3.444.DC1/Rev_Park__Sup_Tex… · SUPPLEMENTAL ONLINE MATERIALS Supplemental Materials

PYRIDINE AND ITS DERIVATIVES - Startseite · Rudy Abramovitch edited a four-volume supplemental series, which followed the general format of the initial work. These herculean tasks

PYRIDINE AND ITS DERIVATIVES - Startseite · Rudy Abramovitch edited a four-volume supplemental series, which followed the general format of the initial work. These herculean tasks

SUPPLEMENTAL INFORMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES · supplemental information supplemental experimental procedures ... (ch001/ch005) g cccaagctttcatcagcaccacattgatctgac

SUPPLEMENTAL INFORMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES · supplemental information supplemental experimental procedures ... (ch001/ch005) g cccaagctttcatcagcaccacattgatctgac

Supplemental Materials Supplemental Text MATERIALS AND ......Mar 31, 2015  · Supplemental Materials Supplemental Text MATERIALS AND METHODS Database formation Studies containing

Supplemental Materials Supplemental Text MATERIALS AND ......Mar 31, 2015  · Supplemental Materials Supplemental Text MATERIALS AND METHODS Database formation Studies containing

SUPPLEMENTAL DATA Supplemental Materials and …cancerres.aacrjournals.org/content/suppl/2011/11/23/0008-5472.CAN... · SUPPLEMENTAL DATA Supplemental Materials and Methods Cells

SUPPLEMENTAL DATA Supplemental Materials and …cancerres.aacrjournals.org/content/suppl/2011/11/23/0008-5472.CAN... · SUPPLEMENTAL DATA Supplemental Materials and Methods Cells

Biology 210 Chapter 13 The Central Nervous System Edited by John McGill Supplemental Notes by Beth Wyatt Original PowerPoint By: Jack Bagwell Last Updated:

Biology 210 Chapter 13 The Central Nervous System Edited by John McGill Supplemental Notes by Beth Wyatt Original PowerPoint By: Jack Bagwell Last Updated:

Supplemental Figure 1. Supplemental Figure 2 Supplemental Figure 3 A B.

Supplemental Figure 1. Supplemental Figure 2 Supplemental Figure 3 A B.

Supplemental InformationAS ON-KL Edited · Supplemental Data. Stepanova et al. Plant Cell. (2011). 10.1105/tpc.111.088047 !! 2! size of 1000 reiterations and a support threshold of

Supplemental InformationAS ON-KL Edited · Supplemental Data. Stepanova et al. Plant Cell. (2011). 10.1105/tpc.111.088047 !! 2! size of 1000 reiterations and a support threshold of