Ecophysiology Intestinal
Transcript of Ecophysiology Intestinal
-
8/13/2019 Ecophysiology Intestinal
1/171
Microbial Eco-Physiology of the HumanIntestinal Tract:
A Flow Cytometric Approach
-
8/13/2019 Ecophysiology Intestinal
2/171
Promotor: Prof. dr. W. M. de VosHoogleraar Microbiologie
Wageningen Universiteit
Co-promotoren: Dr. T. AbeeUniversitair Hoofddocent bij de leerstoelgroep Levensmiddelen-microbiologie
Wageningen Universiteit
Dr. E. E. VaughanLead ScientistUnilever Research and Development, Vlaardingen
Promotiecommissie : Prof. dr. ir. M. H. ZwieteringWageningen Universiteit
Prof.dr. J. BindelsWageningen Universiteit
Dr. G. W. WellingUniversiteit Groningen
Dr. J. Dor
Institut National de Recherche AgronomiqueCentre de recherche de Jouy-en-Josas, France
Dit onderzoek is uitgevoerd binnen de onderzoekschool VLAG
-
8/13/2019 Ecophysiology Intestinal
3/171
Microbial Eco-Physiology of the Human
Intestinal Tract:
A Flow Cytometric Approach
Kaouther Ben Amor
Proefschrift
Ter verkrijging van de graad van doctor
op gezag van de rector magnificus
van Wageningen Universiteit,
Prof. dr. ir. L. Speelman,in het openbaar te verdedigen
op vrijdag 10 september 2004
des namiddags te vier uur in de Aula
-
8/13/2019 Ecophysiology Intestinal
4/171
This work was carried out at Wageningen University, Department of Agro-Technology andFood Sciences, Laboratory of Food Microbiology and Laboratory of Microbiology.
K. Ben Amor. Microbial Eco-physiology of the human intestinal tract: A flow cytometricapproach. PhD thesis. Wageningen University, The Netherlands, 2004. With summaries inDutch and English.
Key words: gastrointestinal tract, fecal microbiota, probiotics, 16S rRNA, Fluorescent In-SituHybridization (FISH), flow cytometry, cell sorting, fluorescent probes, viability, microbialphysiology, Bifidobacteria, Inflammatory Bowel Disease (IBD).
ISBN:90-8504-042-6
-
8/13/2019 Ecophysiology Intestinal
5/171
TABLE OF CONTENTS
Chapter 1:
General introduction .............................................................................................................................. 1
Chapter 2:Application of flow cytometry in microbiology............................................................................... 21
Chapter 3:Quantification of uncultured Ruminococcus obeum-like bacteria in human fecal
samples with fluorescent in situhybridization and flow cytometry
using 16S ribosomal RNA targeted probes....................................................................................... 49
Chapter 4:
Mucosa-associated bacteria in the human gastrointestinal tract
are uniformly distributes along the colon and differ from
the community recovered from feces ................................................................................................ 67
Chapter 5:
Populations dynamics and diversity of fecal microbiota of patients
with ulcerative colitis participating in a probiotic trial .................................................................... 83
Chapter 6:
Multiparametric flow cytometry and cell sorting for the assessment of viable,
injured, and dead Bifidobacteriumcells during bile salt stress ......................................................... 105
Chapter 7:
Genetic diversity of live, injured and dead fecal bacteria assessed by fluorescence
activated cell sorting and 16S RRNA gene analysis ....................................................................... 123
Chapter 8:
Summary and concluding remarks.................................................................................................... 149
Samenvatting.........................................................................................................................................155
Acknowledgments ...............................................................................................................................161
About the author..................................................................................................................................163
List of publications ..............................................................................................................................164
-
8/13/2019 Ecophysiology Intestinal
6/171
Chapter 1
GENERAL INTRODUCTION:
Ecology of the human intestinal microbiota
A modified version of this chapter has been accepted for publication as a chapter in:
Gastrointestinal Microbiology
(Edited by Arthur Ouwehand and Elaine E. Vaughan and published by Marcel Dekker)
Molecular tools to analyze the composition of intestinal microbiotaKaouther Ben Amor and Elaine E. Vaughan
1
-
8/13/2019 Ecophysiology Intestinal
7/171
The human gastro-intestinal (GI) tract is the home of a huge microbial assemblage, the
vast extent of which is only being revealed. The number of microorganisms (microbiota) greatly
exceeds human cells, resulting in one of the most diverse and dynamic microbial ecosystems,
where relationships amongst the microbes and between those and the host have a profound
influence on all concerned (33). This microbiota play essential roles in a wide variety ofmetabolic and immunological processe and therefore significantly contribute to the well being
of the host (17). During the last decade, food-grade specific isolates, termed probiotics have been
extensively used in an attempt to modulate the composition and/or activity of the intestinal
microbiota so as to provide an advantage to the host. Despite certain haziness about the use of
probiotics as functional foods or as bio-therapeutic agents, today there is persuasive evidence
supporting their efficacy in the prevention or treatment of a number of intestinal disorders in
humans (54, 57). Nevertheless, in order to rationally use probiotics as functional foods or as
therapeutic agents, in-depth knowledge of the structure, dynamics and function of the bacterial
populations of the GI-tract microbiota is crucial.
Although the human intestinal microbiota have been extensively investigated by
culture-based methods more than any other natural ecosystem (19, 31, 46), our knowledge
about the culturable fraction of this community is limited (3, 75). The advent of molecular
techniques based on the 16S ribosomal RNA (rRNA) gene analysis is now allowing a more
complete assessment of this complex microbial ecosystem by unraveling the extent of the
diversity, abundance and population dynamics of this community. These techniques have
extended our view of those microorganisms that have proven difficult to culture and which
play an important role in the gut physiology. This huge intestinal microbial reservoir,
estimated to contain more than 1,000 bacterial species (82) and as much as 10 13 cells,
exhibits a highly diverse set of metabolic activities (17, 32). Hence, it is essential to identify
these microbes based upon their eco-physiological traits i.e. those that are functionally
active versus those that are effectively redundant and play little or no role at a particular
time or at a given site of the intestinal tract. It is therefore a major challenge to develop
approaches that monitor the activity of these microorganisms at the single cell level in their
natural habitat. This chapter will focus on these new insights, highlight newly developed
molecular methods to study the eco-physiology of the GI-tract, and culminates in anoverview of this thesis.
1.1 The uncultured GI-tract microbiota is identified by 16S rRNAgene sequencing and phylogenetic analysis
The comparative analysis of environmentally retrieved nucleic acid sequences, most
notably of rRNA molecules and the genes encoding them, has become a standard for
cultivation-independent assessment of bacterial diversity in environmental samples (3).
Ribosomal RNA gene fragments are today routinely retrieved without prior cultivation of the
microbes by constructing 16S ribosomal DNA (rDNA) libraries. Large databases of especially
2
Chapter 1
-
8/13/2019 Ecophysiology Intestinal
8/171
16S rRNA gene sequence information for described as well as uncultured microorganisms are
available, and thus provide a high-resolution platform for the assignment of those new
sequences obtained in 16S rDNA libraries (41). The procedure is based upon PCR-mediated
amplification of 16S rRNA genes or gene fragments, using rRNA or rDNA isolated from the
environmental sample, followed by segregation of individual gene copies by cloning intoEscherichia coli. In this way a library of community 16S rRNA genes is generated, the
composition of which can be estimated by screening clones, full or partial sequence analysis
and comparing them with adequate reference sequences to infer their phylogenetic affiliation.
Sequencing of 16S rDNA clone libraries generated from various sites of the GI-tract
including terminal ileum, colon, mucosa and feces, obtained from healthy and diseased people
have confirmed that a relevant fraction of gut bacteria were derived from new, as yet
undescribed bacterial phylotypes (30, 53, 70, 80, 83, 85). Such studies revealed that the vast
majority of rDNA amplicons generated directly from fecal or biopsy samples were assigned tothree major phylogenetic lineages, namely the Clostridium coccoides, Clostridium leptum and
Bacteroidesgroups. Comprehensive phylogenetic analysis demonstrated that more than half of
the observed diversity was attributable to unknown dominant microorganisms within the
human gut. Additionally, Zoetendal et al. (85) demonstrated that the majority of predominant
bacterial species from an adult fecal sample did not correspond to known species, but that the
prominent bacteria were assigned to different Clostridium clusters namely, Ruminococcus obeum,
Eubacterium hallii and Fusobacterium prausnitzii. On the other hand, phylogenetic analysis of
16S rDNA clone libraries generated from mucosa-associated microbiota of patients with
inflammatory bowel disease (IBD), revealed a reduction in diversity due to a loss of normal
anaerobic bacteria especially those belonging to the Bacteroides, Eubacterium and Lactobacillus
species. Most of the sequenced clones retrieved from the biopsy samples (70%), obtained from
IBD patients, were assigned to known intestinal bacteria, but a significant number of the
cloned sequences were affiliated to normal residents of the oral mucosa such as Streptococcus
species (53). The authors suggested that alteration of the bacterial microbiota in mucosal
inflammation reflects a metabolic imbalance of the complex microbial ecosystem with
severe consequences for the mucosal barrier rather than disrupted defense to single
microorganisms (53).
Even though sequencing of cloned 16S rDNA amplicons provides relevant information
about the identity of uncultured bacteria, the data are not quantitative. Moreover, PCR and
cloning steps are not without biases (76), a recent comparative analysis of clone libraries from
a fecal sample pointed out that the number of PCR cycles may affect the diversity of the
amplified 16S rDNAs and thus should be minimized (8). More rapid culture-independent
options to the cloning procedures include examination of complex microbial populations using
a variety of fingerprinting methods.
3
General introduction
-
8/13/2019 Ecophysiology Intestinal
9/171
1.2 Fingerprinting techniques reveal the stability, uniqueness andcomplexity of the GI-tract microbiota
The most commonly applied fingerprinting methods used to study the GI-tract
microbiota are denaturing temperature (DGGE) and temperature gradient gel electrophoresis(TGGE) of PCR-amplified genes coding for 16S rRNA (75, 88). Other techniques such as
terminal restriction fragment length polymorphism (T-RFLP) and single strand conformation
polymorphism (SSCP) analysis have been applied but less frequently (50, 53). The common
principle of these methods is based on the separation of PCR-amplified segments of 16S rRNA
genes of the same length but with different sequence to visualize the diversity within the PCR
amplicons by a banding pattern. With DGGE/TGGE, separation is based on the decreased
electrophoretic mobility of partially melted double-stranded DNA molecules in
polyacrylamide gels containing a linear gradient of DNA denaturants (a mixture or formamide
and urea) or a linear temperature gradient, respectively. As a result mixed amplified PCRproducts will form a banding pattern after staining that reflects the different melting behaviors
of the various sequences (49, 62). Subsequent identification of specific bacterial groups or
species present in the sample can be achieved either by cloning and sequencing of the excised
bands or by hybridization of the profile using phylogenetic probes (48). Furthermore,
complementation of the fingerprinting results with statistical analysis provides additional
information of the observed diversity by highlighting some putative correlations between
different sets of variables (20).
Since its application to study the intestinal microbiota, PCR-DGGE/-TGGEfingerprinting has advanced our knowledge of the intestinal microbiota by unraveling the
complexity of this ecosystem and providing insight in the establishment and succession of the
bacterial community within the host (18, 85). In healthy adults, the predominant fecal
microbiota was shown to be host-specific, relatively stable in time and not significantly altered
following consumption of certain probiotic strains (72, 74, 84, 85). Furthermore, it revealed
that the predominant bacterial species associated with the colonic mucosa are uniformly
distributed along the colon, but significantly different from the predominant fecal community
(89). Under certain environmental circumstances and/or in genetically susceptible individuals,
there is persuasive evidence that the GI-tract microbiota may play a role in the pathogenesis
and aetiology of a number of inflammatory diseases such as ulcerative colitis (UC), and Crohns
disease (CD) (10, 66). Using DGGE, TTGE and SSCP fingerprinting analyses, it was
demonstrated that fecal and mucosa-associated microbiota of patients with UC and CD is
altered, less complex, and also unstable over time as compared to matched healthy people (53,
64 )(Chapter 4).
Although DGGE or TGGE were initially developed for total ecosystem communities,
the sensitivity of the method for detecting specific groups that are present in lower numbers in
the GI-tract such as bifidobacteria and especially lactobacilli has been considerably enhanced
4
Chapter 1
-
8/13/2019 Ecophysiology Intestinal
10/171
by using group- or genus-specific primers (29, 63, 72, 79). Consequently, it was possible to
monitor the effect of the administration of prebiotics and/or probiotics on the composition of
indigenous bifidobacterial species, and to track the probiotic strain itself (63). In the latter case,
DGGE profiles showed that the simultaneous administration of the prebiotic and probiotic
(symbiotic approach) did not improve the colonization of the probiotic strain in the gut of thetested individuals. In another study, the DGGE profiles generated from fecal samples of healthy
individuals fed a probiotic strain Lactobacillus paracaseiF19, allowed the tracing of the probiotic
and supported its presence as autochthonous within the intestinal community of a number of
individuals (29).
While the application of 16S rDNA-based fingerprinting are particularly well suited for
examining time series and population dynamics, a more quantitative approach is useful to
complement our knowledge about the composition and structure of this complex intestinal
ecosystem.
1.3 16S rRNA-targeted probes quantify the GI-tract microbiota
Hybridization with rRNA-targeted oligonucleotide probes has become the method of
choice for the direct cultivation-independent identification of individual bacterial cells in
natural samples. During the last decade, this technique has extended our view of bacterial
assemblage and population dynamics of complex microbial communities (3, 38, 47). The
most commonly used biomarker for hybridization techniques, either dot blot or fluorescent
in situ hybridization (FISH) is the 16S rRNA molecule because of its genetic stability, domainstructure with conserved and variable regions, and high copy number. Highly conserved
stretches may thus be used to design domain-specific probes such as EUB338/EUBII/EUBIII
which collectively target most of the bacteria, whereas specific probes for each taxonomic
level, between bacterial and archaeal, down to genus-specific and species-specific, can be
designed according to the highly variable regions of the 16S rRNA (3, 4, 43). The increasing
availability of 16S rRNA sequences contributed significantly to the development of the
hybridization methods and their application in different microbial ecosystems (41).
Unquestionably, the success of the implementation of 16S rRNA hybridization strategies
depends on different factors, among them a rational design and validation of newly designedrRNA-targeted probes.
Probe design and validation
When designing new probes, one must consider specificity, sensitivity and accessibility
to the target sequence. Nucleic acid probes can be designed to specifically target taxonomic
groups at different levels of specificity (from species to domain) by virtue of variable
evolutionary conservation of the ribosomal rRNA molecules. Appropriate software such as the
ARB software package (40) and availability of large databases (http://rdp.cme.msu.edu/html/)or the online resource for oligonucleotide probes Probe Base (39) are useful tools for a rapid
5
General introduction
-
8/13/2019 Ecophysiology Intestinal
11/171
probe design and in silico specificity profiling. Additional experimental evaluation of the probes
with target and non-target microorganisms is necessary to ensure the specificity and the
sensitivity of the newly designed probe. It is important to notice that the validation of a newly
designed probe requires different procedures for the dot blot (15) and FISH format (12).
Moreover, the hybridization and washing conditions (temperature, salt concentration anddetergent) are also crucial for obtaining a detectable probe signal (69). The accessibility of the
probe to its target site is another factor to be considered when designing new probes. The
accessibility of probe target sites on the 16S and 23S rRNA of Escherichia colihas been mapped
systematically by flow cytomety (FCM) and FISH and it was shown that probe-conferred
signal intensities vary greatly among different targets sites (23, 24). More recently, it was
demonstrated that accessibility patterns of 16S rRNAs are more similar for phylogenetically
related organisms; these findings may be the first description of consensus probe accessibility
maps for prokaryotes (5).
Hybridization techniques
Nucleic acid probing of complex communities comprises two major techniques: dot
blot hybridization and fluorescent in situ hybridization (FISH). In the dot blot format, total
DNA or RNA is extracted from the sample and is immobilized on a membrane together with
a series of RNA from reference strains. Subsequently, the membrane is hybridized with a
radioactively labeled probe and after a stringent washing step the amount of target rRNA is
quantified. The membrane can be rehybridized with a general bacterial probe and the amount
of population-specific rRNA detected with the specific probe is expressed as a fraction of thetotal bacterial RNA. Quantification of the absolute and relative (as compared to total rRNA)
amounts of a specific rRNA reflects the abundance of the target population and thus do not
represent a direct measure of cell number since cellular rRNA content varies with the current
environmental conditions and the physiological activity of the cells at the time of sampling
(45). Dot blot hybridization has been successfully used to quantify rRNA from human fecal
and cecal samples (44, 65). It was found that strict anaerobic bacterial populations represented
by the Bacteroides, Clostridium leptum and Clostridium coccoidesgroups were significantly lower
in the cecum (right colon) than in the feces, while the Lactobacillus group was significantly
higher in the feces than in the cecum (44).
In contrast to dot blot hybridization, FISH is applied to morphologically intact
cells and thus provides a quantitative measure of the target organism without the limitation
of culture-dependent methods (2, 3). Following fixation, bacteria from any given sample can
be hybridized with an appropriate probe or set of probes. The fixation allows permeabilization
of the cell membrane and thus facilitates the accessibility of the fluorescent probes to the
target sequence. For some Gram-positive bacteria, especially lactobacilli, additional pre-
treatments including the use of cell wall lytic enzymes e.g. lysozyme, mutanolysin, protease K
or a mixture is needed (6, 28). Prior to hybridization, the cells can be either immobilized on
6
Chapter 1
-
8/13/2019 Ecophysiology Intestinal
12/171
gelatine-treated glass slides or simply kept in suspension when analyzed by FCM. The
stringency, i.e. conditions of hybridization that increase the specificity of binding between the
probe and its target sequence, can be adjusted by varying either the hybridization temperature
or formamide concentration. Under highly stringent conditions oligonucleotide probes can
discriminate closely related target sites. Post-hybridization stringency can be achieved bylowering the salt concentration in the washing buffer in order to remove unbound probe and
avoid unspecific binding.
Quantification of FISH signals
Over the past years, significant methodological improvements of the probe
fluorescent-conferred signal have been reported. These include the use of (i) brighter
fluorochromes i.e. Cy3 and Cy5 (25, 68), (ii) unlabeled helper oligonucleotide probes (22)
(iii) signal amplification with reporter enzymes (CARD-FISH) (55), and (iv) the use ofpeptide nucleic acid (PNA) probes (52, 56). Commonly epifluorescence microscopy is the
standard method by which fluorescent-stained cells are enumerated, however the method is
time consuming and subjective (38, 47). Recently, this technique has been improved by
development of automated image acquisition and analysis software allowing accurate
microscopic enumeration of fecal bacteria cells (34). Alternatively, FCM offers a potential
platform for high-resolution, high throughput identification and enumeration of
microorganisms using fluorescent rRNA-targeted oligonucleotides with the possibility of cell
sorting (60, 77, 78, 87).
A FCM method for direct detection of the anaerobic bacteria in human feces
was first described by Van der Waaij et al. (73). They used a membrane-impermeant
nucleic acid dye propidium iodide (PI) in combination with the intrinsic scatter parameters of
the cells to discriminate the fecal cells from large particles. Coupling FCM results and image
analysis, the authors showed that most of the particles detected with a large forward scatter
value corresponded to aggregates most likely representing mucus fragments and indigested
dietary compounds. They confirmed by means of cell sorting that the PI-stained cells (fecal
cells) corresponded to a 2-D surface area of
-
8/13/2019 Ecophysiology Intestinal
13/171
thus used as an internal standard to calibrate the measured volume and to determine the
absolute count of the probe-detected cells (Chapter 5). In addition to the determination of
the absolute cell counts, the fluorescence intensity signal can also be quantified using
fluorescent beads with known fluorescent intensities (67). This is of major importance for
determining optimal hybridization conditions for newly designed probes (16, 61). Definitely,FCM will become the method of choice for high-resolution, high throughput identification
of microorganisms using fluorescent rRNA-targeted oligonucleotides.
Application of FISH to study the GI-tract ecosystem
During the last five years, hybridizations with rRNA-targeted probes have provided a
significant knowledge about the structure of the gut microbiota. A large panel of
oligonucleotide probes specific for various genera predominant in the GI-tract have been
designed and validated. These include Clostridium, Bacteroides, Eubacterium, Ruminococcus,Bifidobacterium, Lactobacillus, Streptococcus, Fusobacterium, Collinsella, Atopobium and
Veillonella specific probes (Table 1) and which have been used intensively to study the
composition and structure of the intestinal microbiota. .
The uniqueness and complexity of the human gut microbiota revealed
by fingerprinting techniques was supported by results of analysis using nucleic-acid
probes based methods. Results of such studies revealed that the majority of fecal bacteria
belong to the Bacteroides-Prevotella, C. coccoides, C. leptum group, Atopobium group and
bifidobacteria (21, 26, 35, 60). These investigations showed that the genus Bacteroides andmembers of C. coccoides and C. leptum constitute more than half of the fecal microbiota.
Among members of the C. coccoidesgroup which equates to Clostridium rRNA cluster XIVa
(11), Ruminococcus, Eubacterium hallii, Lachnospira and Eubacterium cylindroides related
bacteria were found to be dominant members of the microbiota. However, Enterobacteriaceae,
Lactobacillus-Enterococcusgroup, Phascolarctobacterium and relatives, and Veillonellawere less
dominant (26). However, differences in the occurrence of these bacterial groups have been
reported by different research groups. These deviations may be due the different methods or
probes used but it is also likely that the observed variance is due to the differences in the
genetic background, lifestyle, and diet in the human populations studied (60). The results oftwo extensive studies, where an extensive array of oligonucleotide probes targeting the major
bacterial groups in the GI-tract was used, showed that 62-75% of the fecal bacteria could be
detected and identified (26, 36). The remainder (~ 30%) could either belong to members of
the Archaea, Eukarya or most likely to yet unknown bacteria. Furthermore, FISH-FCM
analysis of fecal microbiota of patients with ulcerative colitis revealed substantial temporal
variations in the major bacterial groups studied (i.e. Bacteroides, C. coccoides, Atopobium,
bifidobacteria and lactobacilli) (Chapter 5).
8
Chapter 1
-
8/13/2019 Ecophysiology Intestinal
14/171
Table 1: Major FISH probes used to study the GI-tract microbiota.
Probe Probe Sequence (5-3) Target organism % Formamide Reference
Eub338 GCTGCCTCCCGTAGGAGT Most bacteria 0 80 (4)
EubII GCAGCCACCCGTAGGTGT Planctomycetes 0- 60 (12)
EubIII GCTGCCACCCGTAGGTGT Verrucomicrobia 0- 60 (12)
Bac303 CCAATGTGGGGGACCTT Bacteroides/Prevotella 0 (43)
Erec482 GCTTCTTAGTCAR*GTACCG Clostridium coccoides cluster 0 (21)
Elgc01 GGGACGTTGTTTCTGAGT Clostridium leptum cluster 0 (21)
Fprau645 CCTCTGCACTACTCAAGAAAA Fusobacterium prausnitzii 15 (71)
Bif164 CATCCGGCATTACCACCC Bifidobacteria 0 (35)
Ato291 GGTCGGTCTCTCAACCC Atopobium group 0 (27)
Veil223 AGACGCAATCCCCTCCTT Veillonella 0 (26)
Ecyl1387 CGCGGCATTGCTGCTTCA Eubacterium cylindroides 20 (26)
Rbro729 AAAGCCCAGTAAGCCGCCRuminococcus group 20 (26)
Rfla730 TAAAGCCCAGY*AGGCCGC
Lach571 GCCACCTACACTCCCTTT Lachonospira group 40 (26)
Ehal1469 CCAGTTACCGGCTCCACC Eubacterium hallii group 20 (26)
Phasco741 TCAGCGTCAGACACAGTC Phascolarctobacterium group 0 (26)
Bdis656 CCGCCTGCCTCAAACATA Bacteroides distasonis 0 (21)
Bfra602 GAGCCGCAAACTTTCACAA Bacteroides fragilis 30 (21)
Bvulg1017 AGATGCCTTGCGGCTTACGGC Bacteroides vulgatus 30 (61)
Bfrag998 GTTTCCACATCATTCCACTG Bacteroides fragilis 30 (61)
Bdist1025 CGCAAACGGCTATTGGTAG Bacteroides distasonis 30 (61)
Lab158 GGTATTAGCAY*CTGT TTCCA Lactobacillus/Enterococcus 0 (28)
Urobe63a AATAAAGTAATTCCCGTTCG Uncultured Ruminococcus 20 (87)
Urobeb63b AATRAARTATTTCCCGTTCG obeum-like bacteria
Non338 ACATCCTACGGGAGGC Negative control (77)
* R and Y are the International Union of Pure and Applied Chemistry codes for ambiguous bases.
9
General introduction
-
8/13/2019 Ecophysiology Intestinal
15/171
1.4 Inferring structure to metabolic activity
The aforementioned molecular techniques have greatly contributed to our
fundamental understanding of the biodiversity, establishment, succession and structure of the
intestinal microbiota; yet little is known about the in situ association between the microbialdiversity and the metabolic activity of a phylogenetic affiliated group. It is well recognized that
this highly diverse microbiota plays a significant role in the processing of undigested food to
the benefit of the host and contributes to the host defense by limiting colonization of the GI-
tract by pathogens (17, 32). For instance the generation of short chain fatty acids is a common
feature of the climax community, although many of the specific species responsible remain
undefined. It is therefore a major challenge to develop methods that allow monitoring of
microorganisms according to their eco-physiological traits in situ.
During the last years several innovative methods have been developed to resolve thelinkage between structure, activity and function in microbial communities. These include
methods where molecular techniques are coupled with substrate labeling such as stable isotope
probing (SIP) (58, 59), microautoradiography and FISH (MAR-FISH) (37, 51) or labeling
with fluorescent functional probes followed by flow cytometry and cell sorting analysis (7, 81,
Chapter 7). MAR-FISH allows monitoring of the radiolabeled substrate uptake patterns of
the probe-identified organisms under different environmental conditions (13, 37). This
method has been applied with high throughput DNA microarray analysis to study the
complex activated sludge ecosystem (1). In stable isotope probing (SIP), either lipid
biomarkers (9), DNA (58) or RNA (42) are extracted from microbial communities incubatedwith 13C-labeled substrates. If cells grow on the added compounds, their pool of
macromolecules will be isotopically enriched (heavy) compared to those of inactive organisms.
For DNA- or RNA-SIP, identification of the metabolically active organisms (heavy) is
achieved by separation of community DNA/RNA according to their buoyant density by
means of equilibrium density-gradient centrifugation, followed by PCR-amplification of 16S
rRNA genes in the isotopically heavy DNA/RNA pool, cloning and sequencing. The use of
RNA was proposed as a more responsive biomarker as its turnover is much higher than that
of DNA (42). Phospholipid fatty acids are also used as biomarker for 13C enrichments, but
their resolution for diversity analysis is less powerful than for sequence analysis. On the other
hand, FCM has been viewed as a powerful technique to monitor the metabolic activity of
stressed and starved bacteria and identifies microorganisms in their natural habitat, with
potential for automation (Chapter 2). One major advantage of FCM is that it allows
monitoring of bacterial heterogeneity at the single cell level and provides a mean to sort sub-
populations of interest for further molecular analysis (14). This approach has been ultimately
applied to fecal microbiota, the results provided relevant ecological information related to the
diversity and activity of different affiliated phylogenetic groups and highlighted the
physiological heterogeneity of this complex ecosystem (Chapter 7). The application of
10
Chapter 1
-
8/13/2019 Ecophysiology Intestinal
16/171
cytometric protocols using fluorescent probes in combination with molecular techniques
opens the potential for examining key microbial processes and community function in
complex microbial ecosystems.
1.5 Outline of the thesisThroughout this thesis, the potential of flow cytometry (FCM) and fluorescence
activated cell sorting (FACS) for the analysis of the complex intestinal microbiota will be
demonstrated, with the ultimate aim to provide insight into the biodiversity of the intestinal
ecosystem coupled with the global in situ activity of these microbes.
Chapter 2 reviews the potential of FCM and FACS as an analytical and preparative tool
to analyze microorganisms in different environmental settings.
Chapters 3 describes the application of FCM in combination with FISH (FISH-FCM)to identify and enumerate an uncultured group of fecal bacteria, which have only been detected
by PCR-based approaches.
Chapter 4 describes the distribution of the predominant and Lactobacillusgroup bacterial
community along different sites of the colon of different individuals some of which are diagnosed
with ulcerative colitis or polyposis. The results demonstrate the ability of FCM for studying not
only fecal bacteria (suspended cells) but also mucosa-associated microbiota (attached cells).
Chapter 5 describes the application of FISH-FCM and denaturing gradient gel
electrophoresis (DGGE) as a high throughput platform to evaluate the effect of two probiotic
strains on the population dynamics of fecal microbiota of patients with ulcerative colitis during
a probiotic trial.
Chapter 6 describes a new approach based on the use of functional probes to assess the
viability of Bifidobacterium adolescentis and Bifidobacterium lactisduring bile salt stress and
highlights the importance of multiparametric FCM as a powerful technique to monitor
physiological heterogeneity including live, dead and injured cells within stressed populations at
the single cell level.
Chapter 7 illustrates a novel approach where functional probes and FACS are combined
with 16S rRNA gene analyses to get insight into the genetic diversity of live, dead and injured
fecal bacteria.
The summary and concluding remarks are presented in Chapter 8.
11
General introduction
-
8/13/2019 Ecophysiology Intestinal
17/171
1.6 References
1. Adamczyk, J., M. Hesselsoe, N. Iversen, M. Horn, A. Lehner, P. H. Nielsen, M.
Schloter, P. Roslev, and M. Wagner. 2003. The isotope array, a new tool that employs
substrate-mediated labeling of rRNA for determination of microbial communitystructure and function. Appl. Environ. Microbiol. 69:6875-6887.
2. Amann, R., B. M. Fuchs, and S. Behrens. 2001. The identification of microorganisms
by fluorescence in situ hybridisation. Curr. Opin. Biotechnol. 12:231-236.
3. Amann, R., W. Ludwig, and K. Schleifer. 1995. Phylogenetic identification and
in situ detection of individual microbial cells without cultivation. Microbiol.
Rev. 59:143-169.
4. Amann, R. I., B. Binder, R. Olson, S. W. Chisholm, R. Devereux, and D. Stahl. 1990.Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for
analyzing mixed microbial populations. Appl. Environ. Microbiol. 56:1919-1925.
5. Behrens, S., B. M. Fuchs, F. Mueller, and R. Amann. 2003. Is the in situ accessibility
of the 16S rRNA ofEscherichia colifor Cy3-labeled oligonucleotide probes predicted by
a three-dimensional structure model of the 30S ribosomal subunit. Appl. Environ.
Microbiol. 69:4935-4941.
6. Beimfohr, C., A. Krause, R. Amann, W. Ludwig, and K. H. Schleifer. 1993. In situ
identification of lactococci, enterococci and streptococci. Syst. Appl. Microbiol. 16:450-456.
7. Bernard, L., C. Courties, C. Duperray, H. Schafer, G. Muyzer, and P. Lebaron. 2001.
A new approach to determine the genetic diversity of viable and active bacteria in aquatic
ecosystems. Cytometry 43:314-321.
8. Bonnet, R., A. Suau, J. Dore, G. R. Gibson, and M. D. Collins. 2002. Differences in
rDNA libraries of faecal bacteria derived from 10- and 25-cycle PCRs. Int. J. Syst. Evol.
Microbiol. 52:757-763.
9. Boschker, H. T. S., and J. J. Middelburg. 2002. Stable isotope and biomarkers in microbial
ecology. FEMS Microbiol. Ecol. 40:85-95.
10. Campieri, M., and P. Gionchetti. 2001. Bacteria as the cause of ulcerative colitis. Gut
48:132-135.
11. Collins, M. D., P. A. Lawson, A. Willems, J. J. Cordoba, J. Fernandez-Garayzabal, P.
Garcia, J. Cai, H. Hippe, and J. A. Farrow. 1994. The phylogeny of the genus
Clostridium: proposal of five new genera and eleven new species combinations. Int.
J. Syst. Bacteriol. 144:812-826.
12
Chapter 1
-
8/13/2019 Ecophysiology Intestinal
18/171
12. Daims, H., A. Bruhl, R. Amann, K. H. Schleifer, and M. Wagner. 1999. The
domain-specific probe EUB338 is insufficient for the detection of all bacteria:
development and evaluation of a more comprehensive probe set. Syst. Appl.
Microbiol. 22 :434-444.
13. Daims, H., J. L. Nielsen, P. H. Nielsen, K. H. Schleifer, and M. Wagner. 2001. In situ
characterization of Nitrospira-like nitrite-oxidizing bacteria active in wastewater
treatment plants. Appl. Environ. Microbiol. 67:5273-5284.
14. Davey, H. M., and M. K. Winson. 2003. Using flow cytometry to quantify microbial
heterogeneity. Curr. Issues Mol. Biol. 5:9-15.
15. de los Reyes, F. L., W. Ritter, and L. Raskin. 1997. Group-specific small-subunit rRNA
hybridization probes to characterize filamentous foaming in activated sludge systems.
Appl. Environ. Microbiol. 63:1107-1117.
16. Derrien, M., K. Ben-Amor, E. E. Vaughan , and W. M. de Vos. 2004. Validation of 16S
rRNA probe specific for the novel intestinal mucin-degraderAkkermansis muciniphila.
p. 60. PROEUHEALTH: The Food, GI-tract Functionality and Human Health Cluster.
VTT Biotechnolgy (http://www.vtt.fi/inf/pdf). Sitges, Spain.
17. Falk, P. G., L. V. Hooper, T. Midtvedt, and J. I. Gordon. 1998. Creating and maintaining
the gastrointestinal ecosystem: what we know and need to know from gnotobiology.
Microbiol. Mol. Biol. Rev. 62:1157-1170.
18. Favier, C. F., E. E. Vaughan, W. M. de Vos, and A. D. L. Akkermans. 2002. Molecularmonitoring of succession of bacterial communities in human neonates. Appl. Environ.
Microbiol. 68:219-226.
19. Finegold, S. M., V. L. Sutter, and G. E. Mathisen .1983. Normal indigenous flora.,
p. 3-31. In D. J. Hentges (ed.), Human intestinal microflora in health and disease.
Academic Press, New York, N.Y.
20. Formin, N., S. Hamelin, S. Tarnawski, D. Roesti, K. Jourdain-Miserez, N. Foresties,
S. Teyssier-Cuvelle, F. Gillet, M. Aragno, and P. Rossi. 2002. Statistical analysis of
denaturing gel electophoresis (DGE) fingerprinting patterns. Environ. Microbiol. 4:634-
643.
21. Franks, A. H., H. J. M. Harmsen, G. C. Raangs, G. J. Jansen, F. Schut, and G. W.
Welling. 1998. Variations of bacterial populations in human feces measured by
fluorescent in situ hybridization with group-specific 16S rRNA-targeted oligonucleotide
probes. Appl. Environ. Microbiol. 64:3336-3345.
22. Fuchs, B. M., F. O. Glockner, J. Wulf, and R. Amann. 2000. Unlabeled helper
oligonucleotides increase the in situ accessibility to 16S rRNA of fluorescently labeled
oligonucleotide probes. Appl. Environ. Microbiol. 66:3603-3607.
13
General introduction
-
8/13/2019 Ecophysiology Intestinal
19/171
23. Fuchs, B. M., K. Syutsubo, W. Ludwig, and R. Amann. 2001. In situ accessibility of
Escherichia coli23S rRNA to fluorescently labeled oligonucleotide probes. Appl. Environ.
Microbiol. 67:961-968.
24. Fuchs, B. M., G. Wallner, W. Beisker, I. Schwippl, W. Ludwig, and R. Amann. 1998.
Flow cytometric analysis of the in situ accessibility of Escherichia coli 16S rRNA for
fluorescently labeled oligonucleotide probes. Appl. Environ. Microbiol. 64:4973-4982.
25. Glockner, F. O., R. Amann, A. Alfreider, J. Pernthaler, R. Psenner, K. Trebesius, and K.
H. Schleifer. 1996. An in situ hybridization protocol for detection and identification of
planktonic bacteria. Syst. Appl. Microbiol. 19:403-406.
26. Harmsen, H. J. M., G. C. Raangs, T. He, J. E. Degener, and G. W. Welling. 2002.
Extensive set of 16S rRNA-based probes for detection of bacteria in human feces. Appl.
Environ. Microbiol. 68:2982-2990.
27. Harmsen, H. J. M., A. C. M. Wildeboer-Veloo, J. Grijpstra, J. Knol, J. E. Degener, and
G. W. Welling. 2000. Development of 16S rRNA-based probes for the Coriobacterium
group and the Atopobium cluster and their application for enumeration of
Coriobacteriaceaein human feces from volunteers of different age groups. Appl. Environ.
Microbiol. 66:4523-4527.
28. Harmsen, J. H. M., P. Elfferich, F. Schut, and G. W. Welling. 1999. A 16 S rRNA-
tageted probe for detection of lactobacilli and enterococci in faecal samples by
fluorescent in situ hybridization. Micriol. Ecol. Health Dis. 11:3-12.29. Heilig, H. G. H. J., E. G. Zoetendal, E. E. Vaughan, P. Marteau, A. D. L. Akkermans,
and W. M. de Vos 2002. Molecular diversity of Lactobacillusspp. and other lactic acid
bacteria in the human intestine as determined by specific amplification of 16S ribosomal
DNA. Appl. Environ. Microbiol. 68:114-123.
30. Hold, G. L., S. E. Pryde, V. J. Russell, E. Furrie, and H. J. Flint. 2002. Assessment of
microbial diversity in human colonic samples by 16S rDNA sequence analysis. FEMS
Microbiol. Ecol. 39:33-39.
31. Holdeman, L. V., I. J. Good, and W. E. Moore. 1976. Human fecal flora: variation in
bacterial composition within individuals and a possible effect of emotional stress. Appl.
Environ. Microbiol. 31:359-375.
32. Hooper, L. V., T. Midtvedt, and J. I. Gordon. 2002. How host-microbial interactions
shape the nutrient environment of the mammalian intestine. Annu. Rev. Nutr. 22:283-
307.
33. Hooper, L. V., M. H. Wong, A. Thelin, L. Hansson, P. G. Falk, and J. I. Gordon. 2001.
Molecular analysis of commensal host-microbial relationships in the intestine. Science
291:881-884.
14
Chapter 1
-
8/13/2019 Ecophysiology Intestinal
20/171
34. Jansen, G. J., A. C. M. Wildeboer-Veloo, R. H. J. Tonk, A. H. Franks, and G. W.
Welling. 1999. Development and validation of an automated, microscopy-based method
for enumeration of groups of intestinal bacteria. J. Microbiol. Methods. 37:215-221.
35. Langendijk, P., F. Schut, G. Jansen, G. Raangs, G. Kamphuis, M. Wilkinson, and G.
Welling. 1995. Quantitative fluorescence in situ hybridization of Bifidobacterium spp.
with genus-specific 16S rRNA-targeted probes and its application in fecal samples. Appl.
Environ. Microbiol. 61:3069-3075.
36. Lay, C., L. Rigottier-Gois, K. Holmstrom, M. Rajilic, E. Vaughan , M. D. Collins, R.
Thiel, P. Namsolleck, M. Blaut, and J. Dore. 2004. Assessment of human faecal
microbiota composition using FISH combined with flow cytomety, Pan-European
comparison. p. 75. PROEUHEALTH: The food, GI-tract functionality and human
health cluster 3rd workshop. VTT Biotechnology (http://www.vtt.fi/inf/pdf). Stiges,
Spain.
37. Lee, N., P. H. Nielsen, K. H. Andreasen, S. Juretschko, J. L. Nielsen, K.H. Schleifer, and
M. Wagner. 1999. Combination of fluorescent in situ hybridization and
microautoradiography - a new tool for structure-function analyses in microbial ecology.
Appl. Environ. Microbiol. 65:1289-1297.
38. Lipski, A., U. Friedrich, and K. Altendorf. 2001. Application of rRNA-targeted
oligonucleotide probes in biotechnology. Appl. Microbiol. Biotechnol. 56:40-57.
39. Loy, A., M. Horn, and M. Wagner. 2003. ProbeBase: An online resource for rRNA-targeted oligonucleotide probes. Nucleic Acids Res. 31:514-516.
40. Ludwig, W., O. Strunk, R. Westram, L. Richter, H. Meier, Yadhukumar, A. Buchner, T.
Lai, S. Steppi, G. Jobb, W. Forster, I. Brettske, S. Gerber, A. W. Ginhart, O. Gross, S.
Grumann, S. Hermann, R. Jost, A. Konig, T. Liss, R. Lussmann, M. May, B. Nonhoff,
B. Reichel, R. Strehlow, A. Stamatakis, N. Stuckmann, A. Vilbig, M. Lenke, T. Ludwig,
A. Bode, and K. H. Schleifer. 2004. ARB: a software environment for sequence data.
Nucleic Acids Res. 32:1363-1371.
41. Maidak, B. L., J. R. Cole, T. G. Lilburn, C. T. Parker, Jr, P. R. Saxman, R. J. Farris,G. M. Garrity, G. J. Olsen, T. M. Schmidt, and J. M. Tiedje. 2001. The RDP-II
(Ribosomal Database Project). Nucleic Acids Res. 29:173-174.
42. Manefield, M., A. S. Whiteley, R. I. Griffiths, and M. J. Bailey. 2002. RNA stable
isotope probing, a novel means of linking microbial community function to phylogeny.
Appl. Environ. Microbiol. 68:5367-5373.
43. Manz, W., R. Amann, W. Ludwig, M. Vancanneyt, and K. Schleifer. 1996. Application
of a suite of 16S rRNA-specific oligonucleotide probes designed to investigate bacteria
of the phylum cytophaga-flavobacter-bacteroides in the natural environment. Microbiol.142:1097-1106.
15
General introduction
-
8/13/2019 Ecophysiology Intestinal
21/171
44. Marteau, P., P. Pochart, J. Dore, C. Bera-Maillet, A. Bernalier, and G. Corthier. 2001.
Comparative study of bacterial groups within the human cecal and fecal microbiota.
Appl. Environ. Microbiol. 67:4939-4942.
45. Molin, S., and M. Givskov. 1999. Application of molecular tools for in situ monitoring
of bacterial growth activity. Environ. Microbiol. 1:383-391.
46. Moore, W. E., and L. V. Holdeman. 1974. Human fecal flora: the normal flora of 20
Japanese-Hawaiians. Appl. Microbiol. 27:961-979.
47. Moter, A., and U. B. Gobel. 2000. Fluorescence in situ hybridization (FISH) for direct
visualization of microorganisms. J. Microbiol. Methods. 41:85-112.
48. Muyzer, G., E. de Waal, and A. Uitterlinden. 1993. Profiling of complex microbial
populations by denaturing gradient gel electrophoresis analysis of polymerase chain
reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59:695-700.
49. Muyzer, G., and K. Smalla. 1998. Application of denaturing gradient gel electrophoresis
(DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology.
Antonie Van Leeuwenhoek 73:127-41.
50. Nagashima, K., T. Hisada, M. Sato, and J. Mochizuki. 2003. Application of new
primer-enzyme combinations to terminal restriction fragment length polymorphism
profiling of bacterial populations in human feces. Appl. Environ. Microbiol.
69:1251-1262.
51. Nielsen, J. L., D. Christensen, M. Kloppenborg, and P. H. Nielsen. 2003.
Quantification of cell-specific substrate uptake by probe-defined bacteria under in situ
conditions by microautoradiography and fluorescence in situ hybridization. Environ.
Microbiol. 5:202-211.
52. Oliveira, K., S. M. Brecher, A. Durbin, D. S. Shapiro, D. R. Schwartz, P. C. De
Girolami, J. Dakos, G. W. Procop, D. Wilson, C. S. Hanna, G. Haase, H. Peltroche-
Llacsahuanga, K. C. Chapin, M. C. Musgnug, M. H. Levi, C. Shoemaker, and H.
Stender. 2003. Direct identification ofStaphylococcus aureusfrom positive blood culture
bottles. J. Clin. Microbiol. 41:889-891.
53. Ott, S. J., M. Musfeldt, D. F. Wenderoth, J. Hampe, O. Brant, U. R. Folsch, K. N.
Timmis, and S. Schreiber. 2004. Reduction in diversity of the colonic mucosa associated
bacterial microflora in patients with active inflammatory bowel disease. Gut
53:685-693.
54. Ouwehand, A. C., S. Salminen, and E. Isolauri 2002. Probiotics: an overview of
beneficial effects. Antonie van Leeuwenhoek 82:279-289.
16
Chapter 1
-
8/13/2019 Ecophysiology Intestinal
22/171
55. Pernthaler, A., J. Pernthaler, and R. Amann. 2002. Fluorescence in situ hybridization
and catalyzed reporter deposition for the identification of marine bacteria. Appl.
Environ. Microbiol. 68:3094-3101.
56. Perry-O'Keefe, H., S. Rigby, K. Oliveira, D. Sorensen, H. Stender, J. Coull, and J. J.
Hyldig-Nielsen. 2001. Identification of indicator microorganisms using a standardized
PNA FISH method. J. Microbiol. Methods. 47:281-292.
57. Rachmilewitz, D., K. Katakura, F. Karmeli, T. Hayashi, C. Reinus, B. Rudensky, S.
Akira, K. Takeda, J. Lee, K. Takabayashi, and E. Raz. 2004. Toll-like receptor 9 signaling
mediates the anti-inflammatory effects of probiotics in murine experimental colitis.
Gastroenterol. 126:520-528.
58. Radajewski, S., P. Ineson, N. R. Parekh, and J. C. Murrell. 2000. Stable-isotope
probing as a tool in microbial ecology. Nature 403:646-649.
59. Radajewski, S., I. R. McDonald, and J. C. Murrell. 2003. Stable-isotope probing of
nucleic acids: a window to the function of uncultured microorganisms. Curr. Opin.
Biotechnol. 14:296-302.
60. Rigottier-Gois, L., A. G. Le Bourhis, G. Gramet, V. Rochet, and J. Dore. 2003.
Fluorescent hybridisation combined with flow cytometry and hybridisation of total
RNA to analyse the composition of microbial communities in human faeces using 16S
rRNA probes. FEMS Microbiol. Ecol. 43:237-245.
61. Rigottier-Gois, L., V. Rochet, N. Garrec, A. Suau, and J. Dore. 2003. Enumeration ofBacteroidesspecies in human faeces by fluorescent in situ hybridisation combined with flow
cytometry using 16S rRNA probes. Syst. Appl. Microbiol. 26:110-118.
62. Rosenbaum, V., and D. Riesner. 1987. Temperature-gradient gel electrophoresis.
Thermodynamic analysis of nucleic acids and proteins in purified form and in cellular
extracts. Biophys. Chem. 26:235-246.
63. Satokari, R. M., E. E. Vaughan, A. D. Akkermans, M. Saarela, and W. M. de Vos 2001.
Polymerase chain reaction and denaturing gradient gel electrophoresis monitoring of
fecal Bifidobacterium populations in a prebiotic and probiotic feeding trial. Syst. Appl.
Microbiol. 24:227-231.
64. Seksik, P., L. Rigottier-Gois, G. Gramet, M. Sutren, P. Pochart, P. Marteau, R. Jian,
and J. Dore. 2003. Alterations of the dominant faecal bacterial groups in patients with
Crohn's disease of the colon. Gut 52:237-242.
65. Sghir, A., G. Gramet, A. Suau, V. Rochet, P. Pochart, and J. Dore. 2000. Quantification
of bacterial groups within human fecal flora by oligonucleotide probe hybridization.
Appl. Environ. Microbiol. 66:2263-2266.
66. Shanahan, F. 2003. Probiotics: a perspective on problems and pitfalls. Scand. J.
Gastroenterol. Suppl. 237:34-46.
17
General introduction
-
8/13/2019 Ecophysiology Intestinal
23/171
67. Shapiro, H. M. 1995. Practical Flow Cytometry., 3d ed. Wiley-Liss Inc, New York.
68. Southwick, P. L., L. A. Ernst, E. W. Tauriello, S. R. Parker, R. B. Mujumdar, S. R.
Mujumdar, H. A. Clever, and A. S. Waggoner. 1990. Cyanine dye labeling reagents-
carboxymethylindocyanine succinimidyl esters. Cytometry 11:418-430.
69. Stahl, D. A., and R. Amann. 1991. Development and application of nucleic acid probes.
In E. Stackerbrandt, and M. Goodfellow (eds), Nucleic acid techniques in bacterial
systematics. John Wiley & Sons Ltd, Chichester.
70. Suau, A., R. Bonnet, M. Sutren, J. J. Godon, G. R. Gibson, M. D. Collins, and J. Dore.
1999. Direct analysis of genes encoding 16S rRNA from complex communities reveals many
novel molecular species within the human gut. Appl. Environ. Microbiol. 65:4799-4807.
71. Suau, A., V. Rochet, A. Sghir, G. Gramet, S. Brewaeys, M. Sutren, L. Rigottier-Gois,
and J. Dor. 2001. Fusobacterium prausnitzii and related species represent a dominantgroup within the human fecal flora. Syst. Appl. Microbiol. 24:139-145.
72. Tannock, G. W., K. Munro, H. J. M. Harmsen, G. W. Welling, J. Smart, and P. K. Gopal.
2000. Analysis of the fecal microflora of human subjects consuming a probiotic product
containing Lactobacillus rhamnosusDR20. Appl. Environ. Microbiol. 66:2578-2588.
73. van der Waaij, L. A., G. Mesander, P. C. Limburg, and D. Wan der Waaij. 1994. Direct
flow cytometry of anaerobic bacteria in human feces. Cytometry 16:270-279.
74. Vaughan, E. E., H. G. H. J. Heilig, E. G. Zoetendal, R. M. Satokari, J. K. Collins,
A. D. Akkermans, and W. M. de Vos. 1999. Molecular approaches to study probioticbacteria. Trends Food Sci. Technol. 10:400-404.
75. Vaughan, E. E., F. Schut, H. G. H. J. Heilig, E. G. Zoetendal, W. M. de Vos, M, and
A.D.L. Akkermans. 2000. A molecular view of the intestinal ecosystem. Curr. Issues
Intest. Microbiol. 1:1-12.
76. Von Wintzingrode, F., U. B. Gbel, and E. Stackebrandt. 1997. Determination of
microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis.
FEMS Microbiol. Rev. 21:213-229.
77. Wallner, G., R. Amann, and W. Beisker. 1993. Optimizing fluorescent in situ
hybridization with rRNA-targeted oligonucleotide probes for flow cytometric
identification of microorganisms. Cytometry 14:136-143.
78. Wallner, G., B. Fuchs, S. Spring, W. Beisker, and R. Amann. 1997. Flow sorting of
microorganisms for molecular analysis. Appl. Environ. Microbiol. 63:4223-4231.
79. Walter, J., C. Hertel, G. W. Tannock, C. M. Lis, K. Munro, and W. P. Hammes. 2001.
Detection of Lactobacillus, Pediococcus, Leuconostoc, and Weissellaspecies in human feces by
using group-specific PCR primers and denaturing gradient gel electrophoresis. Appl.
Environ. Microbiol. 67:2578-2585.
18
Chapter 1
-
8/13/2019 Ecophysiology Intestinal
24/171
80. Wang, X., S. P. Heazlewood, D. O. Krause, and T. H. J. Florin. 2003. Molecular
characterization of the microbial species that colonize human ileal and colonic mucosa by
using 16S rDNA sequence analysis. Appl. Microbiol. 95:508-520.
81. Whiteley, A. S., R. I. Griffiths, and M. J. Bailey. 2003. Analysis of the microbial
functional diversity within water-stressed soil communities by flow cytometric analysis
and CTC+ cell sorting. J. Microbiol. Methods. 54:257-267.
82. Whitfield, J. 2004. Features-Science and health: microbial soup of life is sieved for
treasure, Financial Times.
83. Wilson, K., and R. Blitchington. 1996. Human colonic biota studied by ribosomal
DNA sequence analysis. Appl. Environ. Microbiol. 62:2273-2278.
84. Zoetendal, E. G., A. D. L. Akkermans, W. M. Akkermans-van Vliet, J. A. G. M. de
Visser, and W. M. de Vos. 2001. The host genotype affects the bacterial community inthe human gastrointestinal tract. Microbial. Ecol. Health Dis. 13:129-134.
85. Zoetendal, E. G., A. D. L. Akkermans, and W. M. De Vos. 1998. Temperature gradient
gel electrophoresis analysis of 16S rRNA from human fecal samples reveals stable and
host-specific communities of active bacteria. Appl. Environ. Microbiol. 64:3854-3859.
86. Zoetendal, E. G., K. Ben-Amor, A. D. L. Akkermans, T. Abee, and W. M. de Vos. 2001.
DNA isolation protocols affect the detection limit of PCR approaches of bacteria in samples
from the human gastrointestinal tract. Syst. Appl. Microbiol. 24:405-410.
87. Zoetendal, E. G., K. Ben-Amor, H. J. M. Harmsen, F. Schut, A. D. L. Akkermans, and
W. M. de Vos. 2002. Quantification of uncultured Ruminococcus obeum-like bacteria in
human fecal samples by fluorescent in situ hybridization and flow cytometry using 16S
rRNA-targeted probes. Appl. Environ. Microbiol. 68:4225-4232.
88. Zoetendal, E. G., C. T. Collier, S. Koike, R. I. Mackie, and H. R. Gaskins. 2004.
Molecular ecological analysis of the gastrointestinal microbiota: a review. J. Nutr.
134:465-472.
89. Zoetendal, E. G., A. von Wright, T. Vilpponen-Salmela, K. Ben-Amor, A. D. L.Akkermans, and W. M. de Vos. 2002. Mucosa-associated bacteria in the human
gastrointestinal tract are uniformly distributed along the colon and differ from the
community recovered from feces. Appl. Environ. Microbiol. 68:3401-3407.
19
General introduction
-
8/13/2019 Ecophysiology Intestinal
25/171
.
-
8/13/2019 Ecophysiology Intestinal
26/171
Chapter 2
FLOW
CYTOMETRIC
ANALYSIS OF
MICROOGRANISMS
Kaouther Ben Amor, Willem M. de Vos and Tjakko Abee
Abstract: Flow cytometry analysis of fluorescently-labeled microorganisms has a
wide range of applications including detection, identification, viability assessment,
analysis of cellular function, as well as heterogeneity assessment of cell
populations. This chapter seeks to review the recent applications of flow cytometry
and fluorescent probes in microbial ecology and physiology and highlights the
progress made in developing new strategies for use in microbiological
investigations
21
-
8/13/2019 Ecophysiology Intestinal
27/171
2.1 Introduction
The continuous improvement of the sensitivity and the performance of flow
cytometric instruments has resulted on a wide range of applications to characterize bacteria,
yeast, fungi and even viruses (76, 89, 113). Until the late 1970s, applications of flowcytometry (FCM) in the field of microbiology were rather limited due to the fact that most
of the flow cytometers available at that time were not suited for measurement of bacteria due
to their small size compared to that of mammalian cells. The first applications of flow
cytometry in the field of microbiology were published by Paau et al. (99) and Bailey et al. (11)
who studied the cell cycle of three bacterial species with different growth rates (Escherichia
coli, Rhizobium melilotiand Rhizobium japonicum) using a combination of light scattering and
ethidium bromide fluorescence signals. Hutter et al. (59) published a series of pioneering flow
cytometric studies demonstrating the suitability of the technique to determine the DNA and
protein content of several types of microorganisms and to discriminate live and dead cells onthe basis of their light scattering behaviour. However, Steen and co-workers (120, 121) were
the first to design a flow cytometer well suited for the analysis of bacteria and this led to a
breakthrough in the field of microbial FCM. The power of FCM stems from the ability to
perform multiparametric analysis at the single cell level, the high throughput capacity, and the
option of cell sorting. In this chapter we will discuss the principle of FCM and highlight a
number of applications in microbial ecology and physiology.
2.2 How does it work?
Flow cytometry is a mean of measuring specific physical and chemical characteristics
of cells or particles as they flow single-filed in a liquid stream through the focus of a laser
beam(s). At the sensing or measuring point, the stained cells will scatter light in different
directions and emit fluorescence. These light pulses are then collected by an array of detectors,
which in turn translate these signals into electrical pulses (voltage) (Fig. 1). The voltage level
of each detector, either a photo multiplier tube (PMT) or photodiode, can be adjusted to
optimize signal amplification. Logarithmic amplification is used to provide a wide dynamic
range so that both weak and strong signals can be recorded in the same scale. The analog
signal is then converted to a digital value, which is stored in a list mode data files where each
event (i.e. presence of a microbial cell) with the corresponding data for each parameter is
recorded sequentially. One of the main aims in analyzing flow cytometric data is to distinguish
individual target cells among the total population. This is accomplished in a first step by
setting an electronic threshold or by using electronic gating in order to minimize the
background noise or exclude non-targeted cells, respectively. Statistical analysis is then used to
generate representing cell counts including, the median, the mean, the standard deviation and
the coefficient of variance of the measured parameters. For visualization purposes, data are
displayed either as a frequency distribution where the magnitude of the parameter measuredis expressed as a function of number of cells, or two- or three-parameter dot plots or density
22
Chapter 2
-
8/13/2019 Ecophysiology Intestinal
28/171
plots (Fig. 2). For multiparametric analysis, more advanced multivariate statistical methods
such as principal component analysis, cluster analysis or neural networks can be used in order
to extract useful information from the large data sets (38). For a more detailed discussion on
the principles of FCM and data analysis the monograph by Shapiro (113) is recommended.
Figure 1: Standard optical detector array of a FACSCalibur cytometer equipped with a dual- laser (a blue
and red-diode lasers emitting at 488nm diode 623 nm, respectively). A cell is intercepted at the focused
laser beam (s) within the sensing region of the flow cell. Light is scattered by the cell in the forward angle
and detected by a photodiode (FSC). Light scattered at right angles to the cell passes through a dichroic
filter than splits the light wavelengths > 560 nm and < 560 nm. Fluorescence > 560 nm is subsequently
split again with a 640 nm long pass filter. The wave lengths > 650 nm are detected by the red
fluorescence PMT (FL3) and the range of wavelengths within approximately 560-545 nm is detected by
the orange fluorescence (FL2) PMT. Fluorescence within the range 515-545 nm is collected by the green
fluorescence (FL1) PMT. (With permission from Beckton and Dickinson, The Benelux).
23
Flow Cytometry
-
8/13/2019 Ecophysiology Intestinal
29/171
Figure 2: FCM data display. The data obtained from the FCM analysis can be displayed in different ways:
the one-parameter or frequency histogram (A), the two-parameter dot plot (B), and a three dimensionalrepresentation of the data (C), generated from the analysis of Bifidobacterium adolescentisduring pH, heat
and bile salt stress exposure, respectively. The plots were generated with WinMDI software available at
http//:facs.Scripps.edu/software.html.
2.3 What does it Measure?
A flow cytometer measures the light scattered by and the fluorescence emitted from
particles or cells upon excitation with a light source (laser) as they pass in liquid fluid. The lightscatter parameters measured by the FCM known as forward scatter (FSC) and side scatter
(SSC) provide information about the intrinsic cell properties. As a general rule, FSC is used to
estimate cell size and volume while the SSC parameter is a rough estimate of the internal cell
structure and granularity (1, 37, 39, 112, 113). Taken together, FSC and SSC can distinguish
cells in a mixed sample according to their morphological fingerprints, thus allowing exclusion
of aggregates or debris from the cell of interest. A FCM method for direct detection of
anaerobic bacteria in human feces and colon biopsies was described using propidium iodide
(PI), a nucleic acid dye, and scatter parameters to discriminate fecal and mucosa-associated
bacteria from non-bacterial aggregates (127, 128, 144). Combining cell sorting and image
24
Chapter 2
-
8/13/2019 Ecophysiology Intestinal
30/171
analysis, van der Waaij et al. (128) showed that particles with high value in the FSC represented
aggregated particles presumably food particles or mucus fragments. These parameters were also
used to determine bacterial cell biomass, size and volume (145). Sincock et al. (116)
discriminated populations of closely related Gram-positive spores based on their scattering
profiles.
Figure 3: Different cellular target sites for physiological and taxonomic fluorescent probes (See text for
further explanation).
While measurements of FSC/SSC parameters can be useful to characterize
bacterial cells and exclude background, it is the capability of the flow cytometer to
measure particle-associated fluorescence that makes the technique extremely attractive.
Commonly, the fluorescence emitted from the stained cell represents the expression
of an intracellular marker or a reporter molecule attached to an oligonucleotide or to an
antibody. The advance in fluorescent technology allowed the development of a wide range
of fluorescent probes (Table 1) targeting a large array of cellular site parameters (Fig. 3)
and well suited for FCM (53, 112). These include stains that have a high specificity for nucleic
acids, total proteins, or lipids. Indicators that reflect enzyme activity such as esterases,galactosidases or dehydrogenases are also available and have been used for a wide range
25
Flow Cytometry
-
8/13/2019 Ecophysiology Intestinal
31/171
26
Chapter 2
Table
1:Commonlyusedfluorescent
probestostudymicroorganism
sbyFCM(39,53).
Fluore
scentprobe
Ex(max)a(nm)
Em(
max)(nm)
Ligandorsubstrate
Applications
Propid
iumIodide(PI)
536
617
DNA,RNA
Viability,DNAcellcyc
le
TOTO
-1
514
533
DNA,RNA
Detection,enumeration
SYTO
13
488
509
DNA,RNA
Viability,Gramstainin
g
SYBR
GreenI
494
521
DNA,RNA
DNAquantification,V
iability
TOPR
O-3
642
661
DNA,RNA
Viability
DAPI
358
461
DNA/RNA
Detection,enumeration
Hoesh
st33258/22342
340
450
DNA(GCpairs)
Determinationof%G
Ccontent,
Hexidiumiodide(HI)
518
600
DNA,RNA
Gramstaining
FITC
495
525
Protein
Detection,Size
cFDA-SE
519
542
Protein
Celltracking
NileR
ed
551
636
Lipids
Poly--hydroxybutyra
teproduction
Indo-1
330-3
50
390-485
Ca2+
Calciumconcentration
Fluo-3
506
526
Ca2+
Calciumconcentration
Rhoda
mine123
510
580
Membranepotential
ViabilityofGram+bac
teria,
Oxonol[DiBAC4(3)]
488
525
Membranepotential
Viability,Antibibioticsusceptibility
BCEC
F
460-5
10
520-610
pH(6,9)
CellinternalpH,Viability
SNAR
F-1
490-5
40
587-635
pH
CellinternalpH
CFDA
492
517
Esterases
Viability
Calcein
494
517
Esterases
Viability
FDG
491
514
-Galactosidase
Reportergeneexpression,
CTC
530-5
50
varies
Dehydrogenases
Respiratoryactivity,viability
Fun-1
508
525-590
Yeastvacuolarenzymeactivity
Yeastmetabolicactivity
Calcofluor
347
436
Chitinandothercarbohydrate
Fungaldetection
Cy3
550
570
Nucleotidesequence,Antibodies
Identification
Cy5
651
674
Nucleotidesequence,Antibodies
Identification
aEx(m
ax)andEm
(max)arethew
avelengthsofmaximalexcitation
andemission,respectively.
Itshould
benoted
thatthese
parametersare
depend
enttoavariabledegreeonthecon
ditionsusedformeasurement.
-
8/13/2019 Ecophysiology Intestinal
32/171
of applications. Other fluorochromes are useful because their properties change as a function
of pH or because they are accumulated or extruded as a response to cell energization. The use
of fluorescently-labeled oligonucleotide probes, the use of fusions to fluorescent reporter
proteins such as GFP and the detection of molecular interaction by Fluorescent Resonance
Energy Transfer (FRET) offer other means to study microorganisms and their components byFCM (36, 98, 132, 139, 143).
2.4 What makes flow cytometry a powerful technology?
2.4.1 Multiparametric measurements
Flow cytometry is the most effective single-cell analysis technology available today,
since each cell can be characterized with 5-10 parameters allowing a multiparametric
characterization of a given cell population (38, 39, 112). Indeed, combinations of scatter
parameters with marker-conferred fluorescence are used to simultaneously characterize two or
more cellular properties i.e. DNA content, protein content, enzyme activity or simply to
identify target cells using oligonucleotides or antibodies (39). The combination of functional
probes and FCM has been applied to study the stress response of a number of lactic acid
bacteria and bifidoabcteria during heat, acid, ethanol and bile salt stress (15, 25, 34). The
multiparametric assay allowed to discriminate subpopulations with different physiological
status: live, dead and injured-damaged cells (Fig. 4). With the advent of FCM, it became
increasingly clear that even clonal populations derived from a single cell are far from
homogeneous. The development of complementary technologies using multiplexed bead-based arrays will offer even more possibilities for studying microbial eco-physiology (62, 96,
118, 119).
2.4.2 High throughput analysis.
The utility of FCM as a high throughput approach stems from the ability to perform
quantitative assays on a large number of cells, with single cell resolution. Analyses are
commonly performed at a flow rate of 10-100 l/minute thus enabling tens of thousands of
cells to be collected from one sample in less than one minute and statistics are then generated
in real-time. Recent development such as serial-sample delivery using micro-well plates will
extend the ability of FCM resulting in higher throughput and automation analysis of a large
number of samples (48, 72).
2.4.3 Cell sorting.
The most attractive feature of FCM is that cells of interest can be physically separated for
subsequent molecular analysis (16, 133) or functional assays (56, 93), the so-called fluorescence
activated cell sorting (FACS). The cells of interest can be separated from a complex mixture even
though it may be a minor subpopulation and thus allowing for physical enrichments. Amorphologically conspicuous bacterium that accounted for less than 0.01% of the total microbial
27
Flow Cytometry
-
8/13/2019 Ecophysiology Intestinal
33/171
community of activated sludge was physically sorted using the fluorescent signal conferred by a
specific oligonucleotide probe and forward scatter as sorting criteria. Cell sorting resulted in a 30%
enrichment of the target bacteria while traditional microbiological enrichment had failed (117).
Multiparameter FCM combined with cell sorting unquestionably adds an extra dimension to the
information one gains from the results of the post-sorting assays (36, 126).
Figure 4: Dual parameter dot plot of B. adolescentisDSM 20083 representing carboxyfluorescein (cF)
versus propidium iodide (PI) fluorescence. Cultures were exposed for 10 min to different concentrations
of deconjugated bile salts (0.1 %, left and 0.25 %, right) and subsequently stained with cFDA and PI in
order to monitor the esterase activity and membrane permeability, respectively. Three main subpopulations
can be readily differentiated, corresponding to viable cF-stained cells, injured cells double stained with PI
and cF and dead PI-stained cells. The number of colony forming units corresponded to the number of cF-
stained cells, while the injured cells were not detected by the plate count method.
2.5 Applications of FCM in microbiology
Excellent reviews describing applications of FCM in the field of general (21, 39, 116,137), clinical (3), food (8, 116) and environmental microbiology (65, 104) have been published.
In this section we will focus more specifically on viability assessment, detection and identification
of microorganisms, and the use of gene reporter systems in combination with FCM.
2.5.1 Assessment of bacterial viability and metabolic activity
The most important application of FCM in the field of microbiology is the assessment
of cell viability. Although viability is one of the most basic properties of a cell, its definition still
remains a topic of discussion among microbiologists (13, 19, 68). The gold standard method
28
Chapter 2
-
8/13/2019 Ecophysiology Intestinal
34/171
-
8/13/2019 Ecophysiology Intestinal
35/171
Membrane potential
Membrane potential plays a critical role in bacterial physiology. As a component of the
proton motive force, it is intimately involved in the generation of ATP, but it has also been
implicated in various energy-requiring processes, such as nutrient transport, chemotaxis,
survival at low pH, and bacterial autolysis. Membrane potential analysis is based on the
selective permeability and active transport of charged molecules through intact membranes.
Cells with a trans-membrane potential actively take up lipophilic cationic dyes such as
Rhodamine 123 and 3, 3-dihexyloxacarbocyanine (DiOC6(3)) or actively exclude lipophilic
anionic dyes such as the negatively charged bis-(1,3-dibutylbarbutiric acid trimethine oxonol)
DiBAC4(3) known as oxonol (Fig. 3). The specific accumulation of Rhodamine 123, which is
taken up by polarized cells, has been used together with FCM to assess the viability of starved
M. luteus(67), to monitor the survival of starved Escherichia coliand Salmonellapopulations
in seawater (77), and to assess mitochondrial membrane potential inZygosaccharomyces bailiiand Saccharomyces cerevisiae (81). However, the limited applicability of Rhodamine 123
especially for Gram-negative bacteria, which need to be permeabilized prior to the staining,
has led to the extensive use of oxonol for rapid assessment of the microbial response to
antibiotics (28, 64, 85, 122, 123) as well as for cell viability (9, 54, 77, 78, 86). Correcting
the fluorescence conferred by oxonol for bacterial cell size, a better discrimination was
obtained between viable and depolarized/dead cells in bile salt-stressed bifidobacteria (15).
Enzyme activity
Monitoring the cellular esterase activity is another approach to determine the viability
of cell populations by means of FCM. Assessment of the esterase activity is determined using
a lipophylic, uncharged and non-fluorescent precursor. A number of fluorochromes such as 5,
(and-6)-carboxyfluorescein diacetate (cFDA), calcein-AM, 5, (and-6)-carboxyfluorescein
succinimidyl ester cFDASE; 2,7bis (2-carboxyethl)-5-(and-6)-caboxyfluorescein acetoxy
methyl ester (BCECF-AM) have been extensively used to monitor the viability of a wide range
of microorganisms (Table 1) (9, 15, 22, 25, 29, 44, 84, 105). These fluorogenic molecules can
diffuse across the membrane of viable cells where they are cleaved by non-specific esterases and
converted to polar fluorescent products such as fluorescein or fluorescein derivatives (Fig. 3).The staining capacity and subsequent retention of the fluorescent substrate by intact cells are
good indicators for metabolic activity and membrane integrity of the cell. However, the major
limitations encountered with the fluorogenic esterases are related to a poor dye uptake
especially by Gram-negative bacteria and active dye-extrusion resulting in non-stained viable
cells (23). On the other hand, since cFDA-cleaving reactions are typically not energy
dependent, some authors argue that cFDA alone cannot be used as a viability indicator. Da
Silveira et al. (34) demonstrated that in addition to cF-labeling, the subsequent extrusion of
the probe provided a high sensitive indicator of stress response in ethanol-stressed and
ethanol-adapted Oenococcus oeni cells during malolactic fermentation. The combination of
30
Chapter 2
-
8/13/2019 Ecophysiology Intestinal
36/171
cFDA with other viability indicators such as PI, TOTO-1 or oxonol provided more solid
information to assess the viability of stressed bacteria (9, 15, 24, 34, 141).
The respiration activity in aerobic bacteria can be detected using the substrate 5-cyano-
2, 3-ditolyl-tetrazolium chloride (CTC). CTC acts as an electron acceptor in the electron
transport system and can be reduced by a variety of dehydrogenases to an insoluble fluorescent
formazan, which accumulates inside the cell (Fig. 3). Since electron transport is directly related
to cellular energy metabolism in respiring cells, the ability of cells to reduce tetrazolium
compounds can be considered an indicator of bacterial activity. The CTC assay in combination
with FCM has been extensively used as a measure of cellular metabolic activity of different
bacterial species (66, 77, 108, 122, 123). Furthermore, its applicability to a number of anaerobic
bacteria including the sulphate reducers and methanogens has been demonstrated (18). The
redox CTC dye has gained plenty of applications in the study of microbial activity in different
ecosystems including drinking water (111), seawater (16, 114), activated sludge (94), soil (136),food matrices (51, 138) and biofilms (7, 83). However, the universality of CTC to detect
respiring cells in natural samples remains arguable, due to its possible toxic effect on bacterial
cells (129).
2.5.2 Reporter gene expression systems
FCM has been used to monitor gene expression by reporter genes in yeasts (10, 32),
bacteria (2, 31, 126) and to study microbe-host interaction (126). The LacZ gene encoding
-galactosidase and the green fluorescent protein (GFP) from the jellyfish (Aequorea victoria) are
particularly useful for such studies because they enable gene expression in individual cells to be
examined non-destructively and in real time (137)
The sensitive fluorogenic substrate fluorescein di--galactopyranoside (FDG) has been
proven effective for monitoring -galactosidase expression levels in single cells of bacteria and
yeast using FCM. The non-fluorescent FDG substrate is hydrolyzed by cellular -galactosidases
first to fluorescein monogalactosidase and then to the highly fluorescent fluorescein (Fig. 3).
A ready to use kit is available and widely used for mammalian cells, however its application for
bacteria is somewhat limited due the poor substrate uptake and retention of the fluorescent
product in active cells (53, 103). Different approaches have been used to overcome
these problems such as the development of lipophylic derivatives of FDG, use of hypertonic
shock and encapsulation of single cells in agarose microbeads. Nir et al. (95) showed that
encapsulation of E. coli and Candida pseudotropicalis in agar beads allowed the diffusion of
FDG into the microcolonies without permeabilization, and viable cells were then analyzed and
sorted by FACS on the basis of their native -galactosidase activity (110). In another study
it was shown that exposure to osmotic shock resulted in the uptake of FDG by Myxococcus
xanthus strains containing transcriptional fusions to lacZ and allowed sorting of
31
Flow Cytometry
-
8/13/2019 Ecophysiology Intestinal
37/171
subpopulations according to their level of -galactosidase expression. A lipophilic derivative of
FDG (C8-FDG), which yields a product that is better retained by cells, has been used to study
the gene expression in sporulating cultures of Bacillus subtilus(31, 52).
Advances in engineering of the green fluorescent protein (GFP) fromAequorea victoria
into mutants with improved properties and altered colours have provided the basic tools that
allow the investigation of complex processes in live cells (101, 124, 125, 140). A major
advantage of using GFP is that it can be used to stain living cells and monitor them in real time.
GFP in combination with FCM has been used to detect and enumerate starved bacteria (30,
79), to investigate the heterogeneity of stress gene expression in S. cerevisiae during heat
treatment (10) and to track Campylobacter jejuni, a food-borne pathogen, in a mouse model
(90). Gunasekera et al. (50) used GFP production and PI uptake to monitor the gene expression
and viability of Pseudomonas putida, a psychotrophic milk spoilage bacterium, following
pasteurization. Their results showed that a substantial fraction of cells that were incapable offorming colonies as a result of the heat stress, were metabolically active since they were able to
transcribe and translates genes, which in turn may affect milk quality and safety. The interaction
between bacteria and host cells has been also studied in vivo and ex-vivo using GFP in
conjunction with fluorescence activated cell sorting (46, 126).
A pioneering assay using -lactamase as reporter system has recently been reported by
Zlokarnik et al. (142). The novelty resides on the design of a fluorogenic substrate, derivative
of cephalosporins (coumarin cephalosporin fluorescein (CCF2)) that is well retained in active
cells. The nonfluorescent, esterified substrate CCF2/AM is relatively nonpolar and canpassively diffuses across the cell membrane. Once inside the cell, the ester groups are
hydrolyzed by nonspecific esterases to release and retain within the cells the substrate for
-lactamase. CCF2 is composed of a fluorescein and coumarin linked by a cephalosporin
bridge, which is cleaved in the presence of -lactamase. If the cells are not expressing the
-lactamase reporter enzyme, the intact CCF2 fluoresces green under ultraviolet excitation, as
a result of the fluorescence resonance energy transfer (FRET) between coumarin and the
green-emitting fluorescein. In the presence of -lactamase, substrate cleavage allows the
coumarin to emit blue fluorescence while the fluorescein is quenched. Using the ratio of
intensities at the two wavelengths (blue/green) allows more accurate signal quantification
since it improves signal-to-noise due to cell size variation. The -lactamase reporter system
(CCF2) was demonstrated to exhibit higher sensitivity and specificity than the -galactosidase
FDG, and it is well adapted for flow cytometric analysis (27, 70). Although this method was
designed to measure gene expression in mammalian cells, the principle of FRET and trapping
the substrate would also be applicable in analysis of microbial gene expression. The method
could be used without modification for the rapid analysis of cells expressing native
-lactamase activity and for screening for inhibitors (137).
32
Chapter 2
-
8/13/2019 Ecophysiology Intestinal
38/171
2.5.3 Identification of microorganisms
Flow cytometry offers numerous possibilities for identification and enumeration of
microorganisms in their natural habitat. Hence it provides an extensive toolbox for
microbiologists to detect, isolate and enumerate microorganisms of interest in natural samplesin an accurate and rapid way.
Nucleic acid dyes: non-specific detection
A large number of fluorescent dyes with high affinity binding to DNA and /or RNA are
used to discriminate the target cells from the background. The combination of scatter
parameters and the nucleic acid dye fluorescence is becoming the method of choice to
discriminate target cells from the background sample and is widely employed to detect and
enumerate bacteria in their natural environments (17, 20, 51, 65, 74, 109). A FCM method for
direct detection of the anaerobic bacteria in human feces and biopsies was described using PI for
discrimination the fecal cells and excluding large particles by FSC and SSC (128, 143, 144).
The range of fluorescent stains, with different spectral characteristics and high
quantum yield, appropriate for flow cytometry analysis is continuously expanding. One
further development in this area is the availability of some commercial kits well suited for
rapid detecting and counting of total and viable bacterial cells (53). The BacLight viability kit
has been used to monitor the viability of microorganisms in different environmental settings
such as in drinking water (20), seawater (45) and food products such as cheese (26) or milk
(51). Gram staining kits for unfixed and viable microorganisms have been developed (53) and
have recently been applied to study the viability of bacteria in sewage water (41). Using
hexidium iodide (HI), and SYTO13, Mason et al. (87) could correctly predict the Gram status
of 45 strains of clinically relevant organisms, including several known to be Gram variable.
Recently, a FCM-based Gram staining protocol was used to monitor milk contamined with
Staphylococcus aureusand E. colidemonstrating the suitability of this technique for detecting
bacteria in a food matrix by culture-independent means (55).
Antibodies: ImmunodetectionFlow cytometry in conjunction with fluorescent antibodies has been used to
detect surface antigens in a number of bacteria including Salmonella(33, 88), Legionella(61)
and E. coli (138). Antibodies can be made fluorescent by covalently attaching them to
fluorescent organic compounds such as fluorescein isothiocyanate (FITC),
tetramethylrhodamine isothiocyanate (TRITC), texa red, phycobiliproteins, the cyanine dyes
such as indocarbocyanine dyes (Cy3, Cy5 and Cy7) (113) and the ALEXA dyes