Copyright � 2008 by the Genetics Society of AmericaDOI: 10.1534/genetics.107.081778

Drosophila Importin a1 Performs Paralog-Specific FunctionsEssential For Gametogenesis

R. Ratan,*,1 D. A. Mason,†,1,2 B. Sinnot,* D. S. Goldfarb,†,3 and R. J. Fleming*

*Biology Department, Trinity College, Hartford, Connecticut 06106 and †Department of Biology,University of Rochester, Rochester, New York 14627

Manuscript received September 10, 2007Accepted for publication December 15, 2007

ABSTRACT

Importin a’s mediate nuclear transport by linking nuclear localization signal (NLS)-containing proteinsto importin b1. Animal genomes encode three conserved groups of importin a’s, a1’s, a2’s, and a3’s,each of which are competent to bind classical NLS sequences. Using Drosophila melanogaster we describethe isolation and phenotypic characterization of the first animal importin a1 mutant. Animal a1’s aremore similar to ancestral plant and fungal a1-like genes than to animal a2 and a3 genes. Male and femaleimportin a1 (Da1) null flies developed normally to adulthood (with a minor wing defect) but were sterilewith defects in gametogenesis. The Da1 mutant phenotypes were rescued by Da1 transgenes, but not byDa2 or Da3 transgenes. Genetic interactions between the ectopic expression of Da1 and the karyopherinsCAS and importin b1 suggest that high nuclear levels of Da1 are deleterious. We conclude that Da1performs paralog-specific activities that are essential for gametogenesis and that regulation of subcellularDa1 localization may affect cell fate decisions. The initial expansion and specialization of the animalimportin a-gene family may have been driven by the specialized needs of gametogenesis. These resultsprovide a framework for studies of the more complex mammalian importin a-gene family.

KARYOPHERINS are a multigene family of solublenuclear transport receptors that ferry import and

export signal-containing cargoes across nuclear porecomplexes (NPCs) (reviewed in Mossammaparast andPemberton 2004; Tran and Wente 2006; Stewart

2007). The nuclear import of proteins containing clas-sical nuclear localization signals (cNLS’s) is mediated bythe importin a/b1 heterodimer (Goldfarb et al. 2004;Lange et al. 2007). Importin a functions as an adapter tolink cNLS cargoes to the karyopherin importin b1. Afterthe targeting complex passes through the central chan-nel of the NPC, b1 binds to the small nuclear GTPaseRan-GTP, which induces a conformational change andcauses the dissociation of importin a and the release ofthe cNLS cargo (Stewart 2007). Free importin a isthen bound by the export karyopherin CAS/Cse1p andrecycled as a complex with Ran-GTP through the NPCto the cytoplasm. Hydrolysis of the GTP in the cyto-plasm releases importin a for a fresh cycle of import.

The animal importin a-gene family is diverse, havingundergone multiple rounds of duplications and lineage-specific expansions. Most animal importin a’s belongto one of three conserved clades, referred to here as a1,

a2, and a3 (Kohler et al. 1997; Malik et al. 1997; Tsuji

et al. 1997; Mason et al. 2002; Hogarth et al. 2006).Animal a1 genes are more similar to plant and fungala1-like genes than to animal a2 or a3 genes, whicharose from an animal a1-like progenitor to performspecialized roles in animal development and differ-entiation (Goldfarb et al. 2004). The evolution andmaintenance of a1, a2, and a3 genes among animals islikely due to their specialized roles in conserved aspectsof animal development. Although importin a1, a2, anda3 proteins are coexpressed in many adult tissues, theyexhibit complex temporal and spatial expression pat-terns during development (see Kamei et al. 1999;Hogarth et al. 2006). Animal importin a1’s, a2’s, anda3’s all mediate the import of classical NLS-containingcargoes and, in addition, each paralog is specialized tobind and mediate the import of distinct repertoires ofNLS cargoes (for example, see Michaud and Goldfarb

1993; Prieve et al. 1996; Miyamoto et al. 1997; Prieve

et al. 1998; Kohler et al. 1999; Talcott and Moore

2000; Fagerlund et al. 2002; Quensel et al. 2004; Lange

et al. 2007). Importin a’s may also mediate the import ofa few cargoes independent of b1 (Hubner et al. 1999;Miyamoto et al. 2002; Kotera et al. 2005). Finally, im-portin a’s play specialized roles in cell processes otherthan nuclear transport (Tabb et al. 2000; Gorjanacz

et al. 2002; Hanz et al. 2003; Schatz et al. 2003; Harel

and Forbes 2004).The proliferation of the importin a-gene family in

animals may have been driven in part by the specialized

1These authors contributed equally to this study.2Present address: Center for Neural Development and Disease, University

of Rochester Medical Center, Rochester, NY 14627.3Corresponding author: Department of Biology, 436 Hutchison Hall,

University of Rochester, Rochester, NY 14627.E-mail: dasg@mail.rochester.edu

Genetics 178: 839–850 (February 2008)

needs of gametogenesis (Goldfarb et al. 2004; Hogarth

et al. 2005). Importin a1, a2, and a3 proteins are dif-ferentially expressed during spermatogenesis in bothDrosophila (Giarre et al. 2002) and mouse (Hogarth

et al. 2006). Two of the three Caenorhabditis elegans im-portin a’s are expressed exclusively in the germline andare both required for gametogenesis (Geles and Adam

2001; Geles et al. 2002). Likewise, Drosophila lackingimportin a2 (Da2) develop normally to adulthood buthave serious defects in gametogenesis (Gorjanacz et al.2002; Mason et al. 2002, 2003). The spermatogenesisdefect of Da2 null flies is due to the loss of an activityshared by all three paralogs, since Da1, Da2, and Da3transgenes rescued the defect. In contrast, the role ofDa2 in oogenesis is unique since only Da2 transgenescould rescue the phenotype. Like the C. elegans importina3, Da3 is required for somatic development and dif-ferentiation (Mason et al. 2003). Da3 may also be re-quired for gametogenesis but mutant animals die aslarvae. Therefore, in addition to shared housekeepingroles in classical nuclear transport, importin a2’s anda3’s each have unique roles in animal-specific processessuch as gametogenesis. What remains is to describe theconsequences of mutating the single Drosophila im-portin a1 (Da1).

Here, we describe the isolation and characterizationof a Da1 null mutation. Like Da2 mutant flies, Da1 nullflies develop to adulthood with severe defects in game-togenesis. Spermatogenesis in Da1 null flies is arrestedand males are completely sterile. Oogenesis is morpho-logically less severely affected, but virtually all Da1 nullfemales are sterile. In addition, overexpression of Da1results in defects in tergite development and viabilitythat are enhanced by mutations in the importina-recycling factor CAS and suppressed by mutations inimportin b. This is the first genetic analysis of an animalimportin a1 mutant and completes our analysis on thenull phenotypes of the conventional Drosophila a1, a2,and a3 gene family.

MATERIALS AND METHODS

Genetic stocks and markers: Flies were raised on standardcornmeal–dextrose media at 25�. The y w1118; p{y1}Sup P or P�,CG8533 ry506 P-element insertion line, the X-linkedP{w[1mC]¼GAL4TVP16-nos.UTR}MVD2, w1118 driver line,the y1 w; P{w[1mC]¼Act5C-GAL4}25FO1/CyO, y1 driver line,the y1 w1; Ki1 P{ry[1t7.2]¼D2-3}99B ‘‘jump starter’’ chromo-some, and the multiply-marked rucuca (ru h th st cu sr e ca)chromosomes were obtained from the Bloomington Drosoph-ila Stock Center (Indiana University).

The w1118; ru h th st cu sr e D2-3 chromosome was generatedby meiotic recombination from a cross of w1118; rucuca (ru h th stcu sr e ca)/Ki1 P{ry[1t7.2]¼D2-3}99B females to w1118; rucucamales and were maintained as homozygous stocks.

Male recombination screen for Da1 deletions: The malerecombination screen was based on a similar analysis (Gray

et al. 1996). Heterozygous y w1118/Y; p{y1} SupP or P�, CG8533ry506 3/ ru h th st cu sr e D2-3 male progeny were collected and

mated with homozygous w1118; rucuca females. Phenotypicallywhite1, curled, stripe, ebony recombinant animals were re-covered and crossed to w1118; TM3, Sb/TM6B animals toestablish stocks of each individual recombinant line. Recombi-nant lines were ‘‘cleaned’’ of the cu sr e and D2-3 markers bycrossing to w1118 flies with normal third chromosomes andisolating phenotypically w1 female progeny (expected geno-type w1118; CG8533 *cu sr e D2-3/1, where * indicates a potentialmale recombination-generated deletion). These females werethen crossed to homozygous w1118; rucuca males, and pheno-typically white1 males that did not display the curled, stripeebony or D2-3 characteristics were selected and crossed back tow1118; TM3, Sb/TM6B females to establish balanced stocks.

Delimitation of Da1 deletion lines: PCR was utilized todetermine the extent of any deletions generated by the malerecombination scheme described above. A DNA primer wasgenerated complementary to the P-element sequence withinthe CG8533 P element (59 CGACGGGACCACCTTATGTTAT39) and used in conjunction with antisense primers derivedfrom genomic sequences (34). The genomic antisense pri-mers (see Figure 1) were named relative to primer zero thatlies just 39 to Da1 (59 CTGGCCGCCTTCATTTAAATCC 39).Two primers lying between Da1 and CG8533 were generated.Their positions relative to primer zero are approximately14000 (59 GCATTTGTTCCACCTATTGGCC 39) and 16000(59 GTATTAAAGTAGCGCTTGCCGG 39). The remainingprimers were generally spaced at �2-kb intervals from primerzero. Primer�2000 (59 GCTGTTGGCGGCCAGCACATCC 39),primer�4000 (59 CCGCATCGAGTTGCTGGCGCCG 39), primer�6000 (59 TGTCGGCCTGCACAA ACTTCCG 39), primer�8000(59 CTTGTGTTGGAACTACACAGTG 39), and primer �10,000(59 ACTGGGCGTATGCCACTTGTCC 39) were all made in theantisense orientation relative to the P-element primer locatedin the original CG8533 site (as determined from FlyBase).Each of the antisense primers was individually paired with theP-element primer and used on genomic DNA isolated fromindividual male recombinant lines. PCR products generatedby these primer pairs were used to establish potential deletionborders existing in male recombinant lines within 10 kb ofthe 39 limit of Da1. Additional primers that are the reversecomplement of the primers above were also generated so that�2-kb genomic intervals of homozygous viable recombinantlines could be surveyed for the presence or absence of thecorresponding DNA region (e.g., primer�2000 INV is the com-plement of primer �2000. Its sequence is (59 GGATGTGCTGGCCGCCAACAGC 39).

PCR products generated with the primer pairs describedabove were cloned into the pCR II TOPO vector accordingto manufacturer’s protocols (Invitrogen, Carlsbad, CA) and se-quenced using a Beckman–Coulter CEQ80000 DNA sequencer.

Fertility assays: For each female fertility assay, individualhomozygous Da1 deficiency female animals were mated tothree w1118 (Da11) males. Control crosses utilized heterozy-gous Da1�/Da11 females. A minimum of 20 crosses wereperformed for each trial with the number of fertile animalsdetermined by the production of larval and/or adult progenyresulting in each vial. For male fertility assays, individualhomozygous Da1 deficiency male animals were crossed withthree w1118 (Da11) females and the number of vials generatingprogeny determined. Heterozygous Da1�/Da11 males wereused as controls with �20 crosses used in each assay.

Fecundity assays: Fecundity of Df(3L)a1S1 (Da1�) femaleswas measured by placing 50–100 females of each genotypealong with 25–50 w1118 males in egg-laying cups. The femaleswere allowed to lay eggs for three consecutive 24-hr periods onapple juice agar plates. Eggs were counted after each trial andthe average number of eggs laid per female per day wascalculated.

840 R. Ratan et al.

Transgene expression: Crosses were performed between aUAS-a*/CyO; Df(3L)a1S1/TM6B line (* indicates Da1, Da2,or Da3) and either a w1118;P{w½1mC�¼GAL4TVP16-nanos.UTR}MVD2, Df(3L)a1S1/TM6B line or a w1118; P{w½1mC�¼Act5C-GAL4}25FO1/CyO; Df(3L)a1S1/TM6B line and ho-mozygous Df(3L)a1S1/Df(3L)a1S1 animals carrying bothUAS-a* and GAL4 driver chromosomes were isolated andtested for fertility. The statistical significance of differences infemale fertility was determined by comparing the fertility ofhomozygous Da1 mutant females to homozygous Da1 mutantfemales expressing a Da1, a Da2, or a Da3 transgene. P-valueswere calculated with the Fisher’s exact test using Prismsoftware (Graph Pad Software, San Diego).

Morphological analysis of Da1 mutant testes and ovaries:Testes were dissected from 1- to 2-day-old Da11/� and Da1�/�

males and ovaries were dissected from .2-day-old Da11/�

and Da1�/� females in 13 PBS buffer and stained with DAPIfor �10 min in PBS buffer. Testes and ovaries were examinedby DIC imaging and DAPI fluorescence using a Zeiss Axioplan2 compound microscope equipped with a mercury lamp (CarlZeiss, Jena, Germany). Images were collected using theAxiovision software and an ApoTome slider for optical sec-tioning (Carl Zeiss).

Kelch staining of ovaries was performed as previously de-scribed (Gorjanacz et al. 2002). Images were obtained by con-focal microscopy using a Leica TCS NT microscope equippedwith UV, Ar, Kr/Ar, and He/Ne lasers. The anti-Kelch antibodywas developed by L. Cooley and provided by the Developmen-tal Studies Hybridoma Bank (Iowa City). All digital imageswere processed using Adobe Photoshop software (AdobeSystems, San Jose, CA).

Ectopic overexpression of Da1, -2, and -3: To ectopicallyexpress the Drosophila importin a’s, UASt Da1, -2, or -3transgenic males (Mason et al. 2002) were crossed to Gal4e22c/CyO females and UASt Da1, -2, or -3/Gal4e22c offspring wereexamined for lethality and morphological defects. To generatea stock ectopically expressing Da1, the UASt Da1 transgene(Mason et al. 2002) was recombined onto the Gal4e22c chro-mosome. This was achieved by crossing UASt Da1/Gal4e22c

females to Sco/Cyo males and selecting for offspring which havetergite defects associated with ectopic expression of Da1 (seetext).

Genetic interactions were examined for ectopic expressionof Da1 with mutations in known nuclear transport genes bycrossing Gal4e22c, UASt Da1/Cyo females to the following malesat 25� or 27.5�: (a) KetelRx41/Sco, (b) KetelRe34/Sco, (c) Dcasl(2)k03902/Sco, (d) Dcas16-1/Sco, (e) DcasDf(2L)H20/Sco, (f) UASt Dcas/Sco, (g)UASt cNLS GFP/UASt cNLS GFP, (h) UASt GFP/UASt GFP,and (i) UASt Da2/UASt Da2.

The Dcas and Ketel mutations were made heterozygous overSco in the parental males to allow unambiguous identificationand survival of all offspring genotypes. To quantify the ability

of mutations to enhance or suppress the decreased viability ofDa1 overexpressing flies, a viability index was calculated fromthe ratio of the number of offspring that contain the UAStGal4e22c, Da1 chromosome compared to sibling controls thatreceived the Cyo chromosome. P-values were calculated withFisher’s exact test using Prism (Graph Pad Software).

RESULTS

In an effort to determine the functional role of an ani-mal importin a1, we wished to isolate a loss-of-functionmutation in the Drosophila importin a1 paralog importina1 (Da1) (Mason et al. 2002). To this end we performed amale recombination screen to recover small P element-mediated deletions that incorporated Da1 (supplementaldata at http://www.genetics.org/supplemental/). Recom-bination in Drosophila males can occur by aberranttransposon mobilization events in animals heterozygousfor a P-element insertion (Gray et al. 1996; Preston andEngels 1996). Recombinants recovered from these typesof events often display small deletions at the site of therecombination event (Gray et al. 1996).

Among the strains isolated in this screen (see materi-

als and methods and supplemental data) we chose toproceed with one containing a deletion that by DNAsequence analysis was shown to originate within theCG8533 P element and terminate 52 bp to the 59 side ofthe Cyp305a1 gene lying downstream of the Da1 locus (seeFigure 1 and supplemental data). This deletion, namedDf(3L)a1S1, removes most of CG8533 and part or all ofseveral other predicted genes including Da1 and results inhomozygous viable adult animals.

Homozygous Df(3L)a1S1 flies develop to adulthoodbut are sterile: Although homozygous Df(3L)a1S1 fliesdeveloped to adulthood, the deletion could not be main-tained as a homozygous stock because both sexes weresterile. The fertility of homozygous Df(3L)a1S1 malesand females was quantified by crossing individual mu-tant flies to three essentially wild-type w1118 virgin femalesor males. As shown in Table 1, homozygous Df(3L)a1S1males were completely sterile (23/23 animals tested)while females were almost completely sterile (32/33 ani-mals tested). The single nonsterile female only pro-duced three adult progeny. The only obvious defect in

Figure 1.—Gene arrangementof the 76C5–76C6 interval. Pre-dicted and defined genes in theinterval are shaded with the direc-tion of transcription denoted bythe arrowheads. The central barindicates the scale of the regionmarked in 1-kb intervals with thedemarcation between the 76C5and 76C6 cytological bandmarked by the heavy vertical line.

The inverted triangle above the CG8533 gene represents the white1 bearing P-element insertion at that site. The names of theprimers used for PCR amplification of genomic regions are shown at the bottom of the bar. The extent of Df(3L)a1S1 is denotedby the open box. Map modified from FlyBase (Crosby et al. 2007).

Drosophila Importin a1 Mutant 841

the soma of Df(3L)a1S1 flies was that the wings of bothsexes, although of normal size and shape, appeared dulland also somewhat fragile, and many were damaged orimproperly unfolded compared to those of sibling het-erozygous animals (not shown). These results demon-strate that Da1, the only Drosophila importin a1 paralog,is almost completely dispensable for development of thesoma.

Loss of Da1 is responsible for the phenotypic de-fects of Df(3L)a1S1 flies: Because Df(3L)a1S1 removesmultiple open reading frames (Figure 1), we wished todetermine if the mutant phenotypes could be attributedexclusively to the loss of Da1. We therefore expressedthe cDNA for Da1 in the Df(3L)a1S1 background usingthe Gal4 system (Brand and Perrimon 1993). We ini-tially used the Act5CGal4 promoter that is active in allcells. Expression of UAS Da1 using Act5CGal4 in homo-zygous mutant Df(3L)a1S1 males efficiently restoredfertility (Table 1). We conclude that the male sterilitydefect is due strictly to the loss of Da1, and that the otherdeleted genes do not contribute significantly to thephenotype. In the same cross, the wing defect in bothmales and females was also rescued by the UAS Da1transgene using the Act5CGal4 driver (not shown).

In contrast to the efficient rescue of male sterility, thesterility of homozygous Df(3L)a1S1 females was onlymoderately rescued by a Act5CGal4-driven UAS Da1transgene (15/24 animals tested produced progeny),

and the fecundity of the fertile females was low (3–4progeny per productive cross). In contrast, the use of aVP16-nanos Gal4 promoter, which is specifically active inthe female germ line and expressed in developingoocytes (Rorth 1998), rescued the sterility defect muchmore efficiently (Table 1). The fecundity of thesefemales was nearly normal (Table 2). Thus both maleand female sterility phenotypes were rescued by Da1transgenes, demonstrating that the loss of Da1 is re-sponsible for the male and female sterility and wingdefects of homozygous Df(3L)a1S1 flies (referred tohereafter as Da1�/�). We conclude that Da1 is requiredfor male and female fertility and for normal wingdevelopment.

The sterility defect of Da1 null flies is due to aparalog-specific activity of Da1: All three conventionalDrosophila importin a’s (Da1, Da2, and Da3) areexpressed in testes, so it is important to determine ifthe sterility defect of Da1 null flies is due to the loss of aparalog-specific or a shared activity. As summarized inTables 1 and 2, Da2 and Da3 transgenes did not rescuethe sterility/fecundity defects of Da1�/� flies. Likewise,Da2 and Da3 transgenes did not rescue the minor wingdefect (not shown). The Da2 and Da3 transgenes arefunctional as they are able to specifically rescue defectsassociated with mutations in Da2 and Da3, respectively(Mason et al. 2002, 2003). Therefore, we conclude thatDa1 performs paralog-specific activities that are requiredfor oogenesis, spermatogenesis, and wing development.

Da1 is required for the completion of spermatogenesis:In an effort to determine the cause of the sterility of Da1�/�

males, testes were dissected from young adult males andexamined by microscopy. Testes squashes from Da1�/�

males released no motile sperm (not shown) indicatinga profound defect in spermatogenesis. This observationwas substantiated by closer examination of mutant testes.As shown in Figure 2, A and D, 1- to 2-day-old Da1�/� maletestes were notably smaller than those from similarly agedheterozygous males. The testes dissected from heterozy-

TABLE 1

Paralog-specific function of Da1 in male and female fertility

Da1a Transgeneb

Gal4driverc

Fertilemalesd (%)

Fertilefemalesd (%)

�/� � � 0 3(n ¼ 23) (n ¼ 33)

Da1 1 92.3 88(n ¼ 26) (n ¼ 25)

P , 0.0001e

Da2 1 0 8(n ¼ 19) (n ¼ 25)

P ¼ 0.5791Da3 1 0 0

(n ¼ 19) (n ¼ 14)P ¼ 1.0000

a Da1�/� animals are homozygous for the Df(3L)a1S1 defi-ciency as described in the text.

b Rescue of the sterility phenotype was assayed using thepreviously described UASp Da1, a2, or a3 transgenes (Mason

et al. 2003).c The Act5C Gal4 driver was used for male rescue and the

VP16-nanos Gal4 driver was used for the female rescue.d Male and female fertility assays were performed by mating

individual homozygous Df(3L)a1S1 animals with three w1118

animals of the opposite sex.e P-values were calculated as described in materials and

methods by comparing the fertility of Da1�/� control femalesto Da1�/� females expressing Da1, Da2, or Da3 transgene.

TABLE 2

Paralog-specific rescue of the Da1�/� defect in egg laying

Da1a Transgeneb Eggs/female/dayc

1/� � 30.76�/� � 0.16

Da1 20.67Da2 0.64Da3 0.65

a Da1�/� animals are homozygous for the Df(3L)a1S1 defi-ciency as described in the text.

b Rescue of the egg-laying defective phenotype was assayedusing the previously described UASp Da1, -a2, or -a3 trans-genes (Mason et al. 2003). Transgene expression was drivenusing VP16-nanos Gal4.

c Egg-laying assays were performed as described in materi-

als and methods.

842 R. Ratan et al.

gous mutant animals were morphologically normal andfilled with bundles of elongated sperm (Figure 2, A–C). Incontrast, Da1�/� testes contained numerous large roundcysts filled with abnormal spermatocytes (arrows in Figure2D). The flagella of mutant spematocytes appeared to haveat least partially elongated, but they were not properlyorganized into bundles. In addition, the nuclei of themutant spermatocytes appeared abnormal (white arrow-head in Figure 2, C and F). The large round shape of theDa1�/� spermatocyte nuclei suggests that Da1 may berequired, either directly or indirectly, for chromatincondensation, which normally occurs after flagellar elon-gation and prior to individualization (Fuller 1998). Thisphenotype is clearly different from the incompletely pen-etrant defect in spermatogenesis observed in Da2 null flies.Testes from Da2 mutants contained numerous elongatedwell-organized sperm bundles but exhibited a defect inindividualization (Mason et al. 2002). We conclude thatDa1 and Da2 serve different important functions duringspermatogenesis.

Da1 is not required for Kelch localization to ringcanals: In contrast to the profound defect in spermato-genesis, Da1�/� ovaries displayed only relatively minordefects. Specifically, mutant ovaries were smaller thanwild-type ovaries and contained fewer ovarioles (Figure3, A–D). The mature eggs in Da1�/� exhibited onlyslight defects in shape and size, indicating that Da1plays a minor but important role in oogenesis (Figure 3,E and F). In contrast, oocytes from Da2�/� mutantfemales exhibited a deflated morphology that corre-sponded to a defect in the targeting of the protein Kelchto the ring canals, through which the contents of nursecells are dumped into the developing oocyte (Gorjanacz

et al. 2002; Mason et al. 2002). Although Da1 transgeneswere unable to rescue the Kelch localization defect inDa2�/� ovaries (Mason et al. 2003), it is possible that bothimportin a’s are required for distinct steps leading to

proper Kelch localization. A minor dumping defect couldexplain why Da1�/� eggs are slightly smaller than wild type(Figure 3). Thus we investigated whether Da1 is alsorequired for proper Kelch localization. As shown inFigure 3, Kelch is correctly targeted to ring canals inDa1 mutant ovaries, although we cannot rule out a minordefect (Figure 3, G and H). Da1�/� females also displayeda severe egg-laying defect (Table 2). Specifically, Da1�/�

females lay on average ,1 egg/day as opposed to the�30eggs/day laid by Da11/� control females. This phenotypewas rescued with the Da1 transgene, but not the Da2 andDa3 transgenes (Table 2). Therefore the sterility of Da1�/�

females may be confounded by additional defects inegg-laying behavior or defects in the oviducts. Alterna-tively the egg-laying defect may be an indirect result ofthe subtle oogenesis defect. We conclude that thesterility defect of Da1 null females is due either to someimportant but morphologically subtle defect in oogen-esis or, possibly, could involve factors such as egg-layingor mating behavior.

Ectopic expression of Da1 and Da3 result inabdominal defects: In conjunction with our previouswork, it has now been demonstrated that all three con-served Drosophila importin a’s, Da1, Da2, and Da3, per-form distinct paralog-specific functions in vivo (Mason

et al. 2002, 2003). These results raise the possibility thatregulated activity of specific importin a-forms may be amechanism by which cell fate decisions are controlled.Consistent with this, it has been found that the switchin expression from a mouse importin a2 paralog toan a1 paralog regulates neural differentiation of em-bryonic stem cells (Yasuhara et al. 2007). To furtherexplore this possibility we examined the phenotypesassociated with ectopic overexpression of Drosophilaimportin a’s. Previous results demonstrated that over-expression of Da1 during development decreases viability(Mason et al. 2003). For this reason, we hypothesized that

Figure 2.—Morphology of Da1mutant testes. Testes dissectedfrom 1- to 2-day-old males ofthe genotype Da11/� (A–C) andDa1�/� (D–F) were DAPI stainedand examined with DIC imaging.An overlay of DAPI and DIC isshown in B, C, E, and F. Low mag-nification of Da11/� and Da1�/�

testes demonstrate that mutanttestes (D) were smaller than testesfrom heterozygous sibling males(A) and contained multipleround cysts of defective spermato-cytes (black arrows in D). Highmagnification of elongated spermbundles in Da11/� (B) and defec-tive spermatocyte cysts from

Da1�/� (E). C and F correspond to a blowup of boxed areas in B and E. White arrows in C and F highlight elongated sperm tailsin both heterozygous and homozygous mutant animals and white arrowheads mark nuclei positions. Note the characteristic con-densed canoe-shaped nuclei in heterozygous spermatocytes (C) and the uncondensed round nuclei in homozygous mutant sper-matocytes (F).

Drosophila Importin a1 Mutant 843

Da1 overexpression might alter the activity of nuclearproteins that are specific targets of an importin a1,resulting in a partial lethal phenotype. To begin to testthis hypothesis we examined the phenotypes associatedwith ectopic expression of Da1, Da2, and Da3 using theGal4e22c driver.

The Gal4e22c transgenic line expresses Gal4 constitu-tively in the embryo (McCartney et al. 1999). Using aUASt GFP transgene crossed to Gal4e22c we were alsoable to observe a high level of expression in the larvalepidermis (Figure 4) and the developing pupal abdo-men (not shown). Ectopic expression of UASt Da1and Da3 at 25� via Gal4e22c caused partial lethality and,among surviving adults, produces an incompletely pen-

etrant defect in adult abdominal development (Table 3,Figure 4). These defects were not observed with expres-sion of UASt Da2 (Table 3). Expression of Da1 (Table 5)and Da3 (not shown) at 27.5�, was almost completelylethal, while UASt Da2-expressing progeny did not dis-play any defects when raised at temperatures up to 29�(not shown). The UASt Da2 transgene is functionalbecause it rescues the sterility defect of Da2�/� flies(Mason et al. 2002). Da2 can contribute to the lethalityphenotype since offspring expressing both Da1 andDa2 at 25� have lower viability than offspring onlyexpressing Da1 (not shown). The lack of a defect asso-ciated with ectopic expression of Da2 could be due tolower expression levels from the Da2 transgene.

Figure 3.—Morphology of Da1 mutant ovaries. Ovaries dis-sected from .2-day-old females of the genotype Da11/�

(A and C) or Da1�/� (B and D) were DAPI stained (A andB) and examined with DIC imaging (C and D). Da1�/�mutantovaries contained fewer ovarioles than ovaries from Da11/�

siblings. Unlaid mature eggs from Da11/� (E) and Da1�/�

(F) ovaries revealed only minor defects in overall egg mor-phology in mutant ovaries. Kelch immunofluorescence ofDa11/� (G) and Da1�/� (H) ovaries demonstrated that Kelchlocalizes to ring canals (arrows) in Da1 mutant ovaries.

Figure 4.—Tergite defects associated with overexpressionof importin a1. (A) Gal4e22c/UASt-GFP third instar larvae show-ing GFP expression at a high level in the larval epidermis. (B)Standard w1118 flies not expressing importin a-transgenesshow normal tergite development. (C) Ectopic expressionof UASt Da1 with Gal4e22c at 25� results in a partially penetrantdefect in tergite development. (D) Higher magnification ofabdomen shown in C. Adult hemitergites fail to properly fuseat the dorsal midline, leaving a stripe of presumptive larvaltissue (arrows in C and D). (E) These phenotypes are sup-pressed by mutations in the Drosophila importin b1 homo-log, Ketel. The majority of Gal4e22c, UASt Da1/KetelRe34 (E) orGal4e22c, UASt Da1/KetelRx41 (not shown) adults display normalhemitergite fusion or very slight tergite defects (not shown).(F) Mutations in the Drosophila CAS homolog, Dcas, enhancethe defect in abdominal development. Gal4e22c, UASt Da1/Dcasl(2)k03902 surviving flies display abdomens with much thin-ner tergites and appear to have an abundance of presumptivelarval tissue in the intertergal area.

844 R. Ratan et al.

In addition to causing lethality, the ectopic over-expression of Da1 and Da3 caused defects in the de-velopment of the abdominal cuticle. The dorsal cuticleof the adult abdomen is composed of six or seven (infemales) rectangular plates called tergites, which aredecorated with posterior-pointing bristles (microchae-tae and macrochaetae) (Madhavan and Madhavan

1980). In surviving Da1- and Da3-expressing flies, acommon phenotype is the failure of the hemitergites tofuse, leaving a visible stripe of colorless tissue that couldbe either intersegmental cuticle or persistent larvaltissue (Table 3; Figure 4, C and D). The patterningwithin each tergite appears relatively normal since theanterior, central, and posterior regions of each tergitesegment are visible, appropriately pigmented, and deco-rated with bristles (Struhl et al. 1997). In conclusion,ectopic expression of Da1 and Da3, but not Da2, causespartial lethality and, in surviving flies, defects in tergite

development. These defects are more severe in Da1-than in Da3-overexpressing flies.

Mutations in Dcas and Ketel (importin b1) interactwith Da1 ectopic expression phenotypes: To our knowl-edge the preceding experiments are the first to describedeleterious effects associated with the ectopic expres-sion of an animal importin a. To further explore theunderlying mechanism we examined the effects ofectopic Da1 expression in genetic backgrounds thathave altered levels of the two karyopherins that mediatethe import (importin b/Ketel) and export (CAS/Dcas)phases of the importin a-targeting cycle. As describedbelow, circumstances that are expected to promote theimport or inhibit the export of Da1 (possibly increasingnuclear Da1 levels) enhance the defects, and thoseexpected to inhibit import or enhance export (possiblydecreasing nuclear Da1 levels) suppress the defects.

We first examined flies expressing UASt Da1 underGal4e22c control in heterozygous Dcas mutant geneticbackgrounds and assayed for enhancement or suppres-sion of the lethality and tergite phenotypes. The Df(2L)H20deficiency completely removes Dcas (I. Davis, personalcommunication) and is viable when heterozygous.Heterozygous Df(2L)H20 decreases the viability of Gal4e22c,UASt Da1 flies such that complete lethality is observedat 25� (Table 4). Since heterozygous Df(2L)H20 ani-mals are less viable than wild-type animals (not shown),it is possible that its effects on Gal4e22c-mediated Da1expression may simply be additive rather than specific.We therefore obtained a P element that disrupts Dcas(Dcasl(2)k03902) (Tekotte et al. 2002) and acts as a simplerecessive lethal mutation. Significantly, when Dcasl(2)k03902

is heterozygous in the presence of Gal4e22c, UASt Da1expression, the associated lethality is substantially in-creased at 25� (Table 4). In addition, surviving Da1-expressing, Dcasl(2)k03902 heterozygous flies exhibited anew defect in tergite development such that tergitesappear thinner and retained only the posterior pig-

TABLE 3

Ectopic expression of importin a-transgenes at 25�

Genotypea % tergite defectb Viability indexc

UASt Da1/Gal4e22C 96 0.35(n ¼ 111) (111/310)

UASt Da2/Gal4e22C 0 1.5(n ¼ 169) (169/115)

UASt Da3/Gal4e22C 65 0.8(n ¼ 162) (162/202)

a Gal4e22C/CyO females were crossed to homozygous UAStDa1, Da2, or Da3 males at 25�.

b Percentage of flies with dorsal clefts in their tergiteswas determined for offspring expressing the UASt importina-transgenes.

c Viability indexes were calculated by dividing the numberof offspring of the genotype UASt Da1, -a2, or -a3/Gal4e22C

by the number of sibling offspring of the genotype UAStDa1, -a2, or -a3/CyO.

TABLE 4

Mutations in Dcas enhance the lethality associated with Da1 expression

Crossa Genotypeb Viability indexc

1 UASt Da1, Gal4e22C/Sco 0.65 (63/97) P , 0.0001UASt Da1, Gal4e22C/DcasDf(2L)H20 0 (0/72)

2 UASt Da1, Gal4e22C/Sco 0.83 (158/189) P , 0.0001UASt Da1, Gal4e22C/DcasI(2)k03902 0.12 (28/229)

3 UASt Da1, Gal4e22C/Sco 0.76 (97/127) P , 0.8538UASt Da1, Gal4e22C/Dcas16-1 0.79 (111/140)

a UASt Da1, Gal4e22C/CyO females were crossed to DcasDf(2L)H20/Sco (cross 1), Dcasl(2)k03902/Sco (cross 2), or Dcas16-1/Sco (cross 3) males at 25�.

b DcasDf(2L)H20 is a deficiency with breakpoints 36A8–9; 361, Dcasl(2)k03902 is a P element in the 59 region of Dcas,and Dcas16-1 is a precise excision of Dcasl(2)k03902.

c Viability indexes were calculated for the Sco (control) or Dcas (experimental) mutant backgrounds by di-viding the number of offspring that inherited the UASt Da1, Gal4e22C chromosome (non-CyO) by the numberof sibling offspring that did not inherit the UASt Da1, Gal4e22C (CyO). P-values were calculated as described inmaterials and methods.

Drosophila Importin a1 Mutant 845

mented band, which resulted in an apparent expansionof the intertergal region (Figure 4F). Significantly, theenhancement of the Da1 ectopic expression pheno-types is eliminated by precise excision of the P elementwithin Dcas (Dcas16-1) (Tekotte et al. 2002) demonstrat-ing that the enhancement by Dcasl(2)k03902 is specific forthe P-element insertion (Table 4). To further testwhether Dcas interacts with the Da1 overexpressionphenotype we created a UASt Dcas transgene. Con-sistent with the observation that mutations in Dcasenhance Da1 expression phenotypes, we found thatectopic expression of Dcas and Da1 at 27.5� caused asignificant suppression of lethality (Table 5). However,the expression of UASt Dcas at 25� with the Gal4e22c

driver also caused a failure of the tergites to fuse (notshown). Therefore, Dcas seems to interact with thelethality phenotype in a consistent manner, but it is stillunclear as to the precise nature of the interaction ofDcas with the tergite phenotype.

The findings that mutations in Dcas increase andoverexpression of Dcas decreases the severity of Da1overexpression phenotypes suggest that high nuclearlevels of Da1 may cause developmental defects. If true,then mutations that reduce the entry of Da1 into thenucleus should suppress the Da1 ectopic expressionphenotype. To examine this possibility, genetic inter-actions with mutations in the Drosophila importin b1homolog Ketel were examined (Erdelyi et al. 1997).

As predicted, mutations in Ketel produced effects onectopic Da1 expression in the opposite direction tothose of Dcas. Expression of the Da1 transgene in fliesheterozygous for the KetelRe34 or KetelRx41 loss-of-functionalleles resulted in a slight increase in viability of animalsat 25� (not shown) and a significantly increased viabilityat 27.5� (Table 5). In addition, less severe defects intergite morphology were present in Da1-overexpressingflies heterozygous for Ketel mutations (Figure 4). In flies

where Gal4e22c, UASt Da1 is expressed in a wild-typebackground, almost 70% of progeny displayed defectsin two or more abdominal segments while only 20% hadnormal tergites. In contrast, sibling controls that ex-press Da1 in a heterozygous KetelRx41 background re-sulted in nearly 70% of progeny with normal abdominalmorphology. A third allele of Ketel, KetelRx22, does notsuppress the Da1 expression phenotypes (not shown),indicating that this allele behaves differently for un-known reasons. Nonetheless, we conclude that animalswith heightened levels of Da1 expression fare better ifthey have a simultaneous reduction in the level ofimportin b1.

To further test the model that high levels of nuclearimportin a are deleterious, we attempted to drive im-portin a into the nucleus by increasing the expressionof cNLS cargo. The ectopic expression of an importina-cargo enhanced the lethality associated with ectopicexpression of Da1. Specifically, coexpression of a UAStcNLS GFP construct and UASt Da1 caused completelethality at 25� ½viability index ¼ 0 (0/189), P , 0.0001compared to viability index of 0.76 calculated from thepooled Gal4e22c, UASt Da1/Sco at 25� data set�. Thisappears to be specific for cNLS–GFP and is not a con-sequence of overexpressing GFP since coexpression of aUASt GFP construct and Da1 did not significantly en-hance the lethality Da1 overexpression at 25� ½viabilityindex¼ 0.7 (102/145), P¼ 0.5530 compared to viabilityindex of 0.76 calculated from the pooled Gal4e22c, UAStDa1/Sco at 25� data set�. In conclusion, genetic inter-actions between ectopic expression of Da1 and alteredexpression of Dcas, Ketel, and cNLS cargo suggest thatelevated nuclear levels of importin a are deleteriousand cause death during pupation. These studies indi-cate that both the expression and nucleocytoplasmictrafficking of importin a’s during development must bemaintained under tight control.

TABLE 5

Suppression of lethality associated with Da1 expression at 27.5�

Crossa Genotypeb Viability indexc

1 UASt Da1, Gal4e22C/1 0.02 (4/196)2 UASt Da1, Gal4e22C/Sco 0.07 (6/85) P , 0.0001

UASt Da1, Gal4e22C/KetelRe34 0.52 (65/125)3 UASt Da1, Gal4e22C/Sco 0.04 (5/135) P , 0.0001

UASt Da1, Gal4e22C/KetelRx41 0.42 (80/190)4 UASt Da1, Gal4e22C/Sco 0.07 (6/85) P , 0.0001

UASt Da1, Gal4e22C/UASt Dcas 0.88 (99/112)

a UASt Da1, Gal4e22C/CyO females were crossed to w1118/y; 1/1 (Cross 1), KetelRe34/Sco (Cross 2), KetelRx41/Sco(Cross 3), or UASt Dcas/Sco males at 27.5�.

b KetelRe34 and KetelRx41 are loss-of-function alleles of the Drosophila importin b1 gene. UASt Dcas contains thefull-length Dcas cDNA in the pUASt vector.

c Viability indexes were calculated for the Sco (control) or Ketel mutant or UASt Dcas (experimental) back-grounds by dividing the number of offspring that inherited the UASt Da1, Gal4e22C chromosome (non-CyO)by the number of sibling offspring that did not inherit the UASt Da1, Gal4e22C chromosome (CyO). P-valueswere calculated as described in materials and methods.

846 R. Ratan et al.

DISCUSSION

Cargo adapters such as importin a may have evolvedto provide a greater range of control over nucleartransport in response to variable environmental con-ditions (see Riddick and Macara 2007). The evolutionof multiple importin a-genes would seem to extend theutility of these adapters by allowing the independentcontrol of distinct sets of cargo repertoires. We havetaken a genetic approach in Drosophila to analyze thein vivo function of the conserved family of animalimportin a1’s, a2’s, and a3’s. In addition to bindingunique repertoires of NLS cargoes, all three types likelyshare housekeeping duties in cNLS cargo import. Thecontribution of individual importin a’s to redundantactivities is influenced by their differing temporal andspatial expression patterns in various cells and tissues. Inthis study we describe the first animal importin a1mutant.

The key finding here is that Da1 mutant flies develop(almost) normally to adulthood but both males andfemales are sterile due to defects in gametogenesis. Da1null flies also exhibit a minor wing defect, so Da1’snonredundant activities extend in this small way tosomatic development. In contrast to Da1 and Da2, Da3is required for somatic development and Da3 mutantsarrest as larvae. Interestingly, Da1 and Da2 mutantsdisplay distinct phenotypes in gametogenesis. Sper-matogenesis is more severely affected than oogenesisin Da1 mutants, while Da2 mutants have more severedefects in oogenesis (Mason et al. 2002). Da2 is notabsolutely essential for spermatogenesis—some motilesperm and viable progeny are produced by mutantmales—and the defect can be rescued by Da1, Da2, orDa3 transgenes. In contrast, no viable sperm are pro-duced in Da1 mutants, and only a Da1 transgene canrescue the defect. Therefore, Da1 serves a paralog-specific role in spermatogenesis that is distinct from therole of Da2 in this process.

Da1 and Da2 are both required for gametogenesisand have no significant roles in somatic development. Itseems likely, therefore, that the evolutionary expansionof the importin a-gene family occurred to serve theuniquely complex processes of spermatogenesis andoogenesis, both of which involve the differentiation ofgerm-line stem cells using analogous signaling pathways(Gilboa and Lehmann 2004). Da1 plays an especiallyimportant paralog-specific role in spermatogenesis. Allthree importin a’s are expressed in the fly testes,although in distinct, partially overlapping patterns thatcorrespond to different stages of spermatogenesis,which include stem cell division, spermatogonial divi-sions, growth, meiotic divisions, and spermatid differ-entiation (reviewed in Gilboa and Lehmann 2004;Hogarth et al. 2005). The expression of Da1 overlapswith Da2 expression during meiosis, and later with Da3during differentiation and individualization (Giarre

et al. 2002). Da1 is expressed at low levels in testes untilthe growth stage, when it appears cytoplasmic. Da1levels rise during meiosis when it accumulates inspermatid nuclei. Da1 levels are lower during differen-tiation and, by the time spermatid heads become alignedtoward the wall of the testes, are equally distributedbetween the nucleus and cytoplasm. Da1 was not de-tectable in sperm with elongated heads. The defectsexhibited by Da1 and Da2 mutants are manifested atdifferent stages of sperm differentiation, although thetiming and nature of these defects do not necessarilycorrespond to when and where during spermatogenesisthese factors are actually required (see Fuller 1998).

The oogenesis defects of Da1 and Da2 mutant fliesare also distinct from one another, and both phenotypesare due to paralog-specific activities. The cause of thesevere Da2 mutant phenotype (deflated oocytes) islikely related to the Da2-dependent targeting of Kelchto ring canals, through which nurse cell cytoplasm isdumped into the developing oocyte (Gorjanacz et al.2002). Kelch localization and dumping appear normalin Da1 mutant females. Giarre et al. (2002) reportedthat Da1 expression in ovaries is weaker than that of Da2or Da3, and is, therefore, unlikely to play a major role.This prediction is partially supported by our finding thatthe ovaries and eggs of Da1 null flies are only mildlydefective. Still, Da1 must have an important role inoogenesis since almost all mutant females are sterile. Itremains possible that the female sterility is due to abehavioral phenotype in egg laying or mating or someother defect that was too subtle for us to notice.

The finding that two of the three conventional Droso-phila importin a’s are specialized to serve importantroles in gametogenesis has a strong parallel in C. elegans(reviewed in Goldfarb et al. 2004; Hogarth et al.2005). The C. elegans genome encodes three importina’s, IMA-1, IMA-2, and IMA-3, two of which (IMA-1 andIMA-2) localize exclusively to the germ line and arerequired for gametogenesis (Geles and Adam 2001;Geles et al. 2002). Therefore, two of the importin a’s inboth fly and worm are required for gametogenesis. IMA-3, a conventional a3 type, is expressed in both somaticand germ-line cells, and like Da3, is required for somaticdevelopment (Geles and Adam 2001). Although IMA-1and IMA-2 are highly divergent and dissimilar to any ofthe conventional types, their exclusive expression in thegerm line and important role in gametogenesis suggestthey may be functional homologs of Da1 and Da2. Also,like Da2, IMA-2 displays cell cycle-dependent shiftsbetween the nucleus and cytoplasm in the gonads, andboth accumulate around chromosomes at the onset ofnuclear envelope breakdown (Geles et al. 2002). Takentogether, these results suggest the possibility that thespecial needs of gametogenesis may have driven theearly expansion and specialization of the metazoananimal importin a-gene family. The complex temporalexpression patterns of the five mouse importin a1’s,

Drosophila Importin a1 Mutant 847

a2’s, and a3’s in testes indicate that this role likelyextends to mammalian spermatogenesis, which, inmany ways, is similar to spermatogenesis in flies (Fuller

1998; Hogarth et al. 2005).Because importin a1’s are very similar both by se-

quence and gene structure to ancestral plant and fungala1-like genes (A. Mason and D. Goldfarb, unpub-lished results), we originally expected that the loss ofDa1 would cause defects in the nuclear transport ofmany important proteins with catastrophic consequen-ces. Therefore, we were initially surprised to find thatDa1 null flies developed normally to adulthood withonly a slight wing defect. Phenotypically, then, Da1 ismore similar to Da2, whose loss also primarily affectsgametogenesis. At gene structure and primary sequencelevels Da2 is more similar to Da3 (A. Mason and D.Goldfarb, unpublished results). Thus the evolutionaryhistory of the three genes does not predict the nature oftheir mutant phenotypes. We hypothesize that theancient and essential role the importin a’s play in cNLScargo import is redundantly supported in somatic tis-sues by the partially overlapping coexpression of thethree paralogous proteins. The loss of any one is ap-parently masked by the activity of one or both of theothers. Most of the phenotypes that appear in singlegene mutants are likely due to paralog-specific func-tions that were divided among the genes following theduplications that gave rise to the extant importin a-genefamily. An exception is the spermatogenesis defect ofDa2 mutant flies that is rescued by any of the threeparalogs (Mason et al. 2002). It is established thatimportin a1’s each have both shared and distinct cargorepertoires (Michaud and Goldfarb 1993; Prieve et al.1996; Miyamoto et al. 1997; Prieve et al. 1998; Kohler

et al. 1999; Talcott and Moore 2000; Fagerlund

et al. 2002; Quensel et al. 2004; Lange et al. 2007). Thesimplest explanations for the paralog-specific pheno-types associated with Da1, Da2, and Da3 mutants in-voke deficiencies in the nuclear import of their distinctNLS cargoes.

The genetic interactions between coectopic expres-sion of Da1 and Dcas and Ketel are consistent with theidea that the tergite defects and lethality are the result ofincreases in the levels of importin a in nuclei. Geneticmanipulations that would be expected to decreasenuclear levels of Da1 (overexpression of Dcas or loss-of-function Ketel mutants) mitigated the effects of over-expressing Da1. Likewise, manipulations that would beexpected to increase nuclear levels of Da1 (overexpres-sion of Ketel or loss-of-function Dcas mutants) enhancedDa1 overexpression phenotypes. Interestingly, an in-crease in cNLS cargo levels also enhanced the Da1overexpression defects. Here, higher cNLS cargo levelscould be expected to recruit more Da1 into targetingcomplexes with importin b1 (Ketel), resulting in highersteady state nuclear levels of Da1. Taken together, theseresults argue that higher than normal nuclear levels of

Da1 are deleterious, and that the nucleocytoplasmictrafficking of nuclear transport factors must be carefullybalanced during development.

The defect in tergite development observed in Da1-overexpressing flies may lend insight into the mecha-nisms underlying the deleterious effects of excessnuclear importin a. Development of the tergites in-volves a tightly coordinated process of epithelial cellsheet replacement during which the adult tergites arisefrom histoblast nests that proliferate and spread toreplace larval epidermal cells during pupal morpho-genesis (Madhavan and Madhavan 1980; Ninov et al.2007). The tergite defects observed in Da1-expressingabdomens may be attributable either to the failure ofthe adult histoblast nests to proliferate or spread cor-rectly or to a failure of the larval epidermal cells toundergo apoptosis since both of these processes arethought to be codependent (Madhavan and Madhavan

1980; Ninov et al. 2007). The genetic interactionsbetween Dcas and Da1 may be especially relevant tounderstanding the tergite phenotypes associated withDa1 overexpression. Expression of CAS antisense RNAin MCF-7 breast carcinoma cells, which likely leads toincreased nuclear levels of importin a, inhibits apopto-sis (Brinkmann et al. 1995). It is possible, then, thatelevated levels of nuclear importin a inhibit apoptosis inthese cells. By analogy, it is possible that elevated levelsof nuclear Da1 interfere with the apoptosis of larvalepidermal cells, the persistence of which might impairthe ability of the adult cuticle to properly proliferateand spread. Consistent with this hypothesis, blockingcell death in the larval epidermal cells of the abdomenresult in defects in spreading of the histoblast nests andresulted clefts in the abdominal cuticle (Ninov et al.2007). Alternatively, these tergite phenotypes may becaused by defects in tergite development since thermo-cautery of histoblast nests also produces similar tergitedefects (Bryant 1978). Nonetheless, it is intriguing tospeculate that the regulated subcellular localization ofimportin a-proteins affects susceptibility to proapop-totic signals.

This analysis of Da1 complements our previousanalyses of Da2 and Da3 (Mason et al. 2002, 2003).We can now say that two of the three conserved Droso-phila importin a-genes are required almost exclusivelyfor gametogenesis (Da1 and Da2), and only one (Da3)is required for general viability. The larger pictureemerges of a gene family that likely arose by geneduplication to serve the newly evolving requirements ofgametogenesis. Following their initial establishment,each of the three paralogous genes was available toevolve specialized (derived) roles and, in mammals,undergo further gene duplications and specializations.It is curious that Da1, which is more similar to ancientplant and fungal importin a1-like genes than to Da2or Da3, only exhibits paralog-specific phenotypes inderived processes such as gametogenesis and wing

848 R. Ratan et al.

development. We hypothesize that a1 genes are notfunctionally constrained; rather, ancestral a2/a3 genessimply diverged. Why ancestral a2 and a3 genes evolvedmore rapidly remains a mystery, although importantclues no doubt lie among their largely unexplored NLScargo repertoires. It will be extremely interesting tolearn if these roles and relationships are conserved inthe more complex mouse and human importin a-genefamily.

This research was supported in part by National Institutes of Healthgrant RO1 GM067838 (D.S.G.) and National Research Foundationgrant IBN-0234751 (R.J.F).

LITERATURE CITED

Brand, A. H., and N. Perrimon, 1993 Targeted gene expression asa means of altering cell fates and generating dominant pheno-types. Development 118: 401–415.

Brinkmann, U., E. Brinkmann, M. Gallo and I. Pastan,1995 Cloning and characterization of a cellular apoptosis sus-ceptibility gene, the human homologue to the yeast chromosomesegregation gene CSE1. Proc. Natl. Acad. Sci. USA. 92: 10427–10431.

Bryant, P. J., 1978 Pattern formation in imaginal discs, pp. 230–325in The Genetics and Biology of Drosophila, Vol. 2C, edited by M.Ashburner and T. R. F. Wright. Academic Press, London.

Crosby, M. A. J. L. Goodman, V. B. Strelets, P. Zhang, W. M.Gelbart and The FlyBase Consortium, 2007 FlyBase: ge-nomes by the dozen. Nucleic Acids Res. 35: D486–D491.

Erdelyi, M., E. Mathe and J. Szabad, 1997 Genetic and develop-mental analysis of mutant Ketel alleles that identify the Drosoph-ila importin-beta homologue. Acta Biol. Hung. 48: 323–338.

Fagerlund, R., K. Melen, L. Kinnunen and I. Julkunen,2002 Arginine/lysine-rich NLSs mediate interactions betweendimeric STATs and importin a5. J. Biol. Chem. 277: 30072–30078.

Fuller, M. T., 1998 Genetic control of cell proliferation and differ-entiation in Drosophila spermatogenesis. Semin. Cell Dev. Biol.9: 433–444.

Geles, K. G., and S. A. Adam, 2001 Germline and developmentalroles of the nuclear transport factor importin alpha3 in C. ele-gans. Development 128: 1817–1830.

Geles, K. G., J. J. Johnson, S. Jong and S. A. Adam, 2002 A role forCaenorhabditis elegans importin IMA-2 in germ line and embry-onic mitosis. Mol. Biol. Cell 13: 3138–3147.

Giarre, M., I. Torok, R. Schmit, M. Gorjanacz, I. Kiss et al.,2002 Patterns of importin alpha expression during Drosophilaspermatogenesis. J. Struct. Biol. 140: 279–290.

Gilboa, L., and R. Lehmann, 2004 How different is Venus fromMars? The genetics of germ-line stem cells in Drosophila femalesand males. Development 131: 4895–4905.

Goldfarb, D. S., A. H. Corbett, D. A. Mason, M. T. Harreman andS. A. Adam, 2004 Importin a: a multipurpose nuclear transportreceptor. Trends Cell Biol. 14: 505–514.

Gorjanacz, M., G. Adam, I. Torok, B. M. Mechler, T. Szlanka et al.,2002 Importin-alpha 2 is critically required for the assembly ofring canals during Drosophila oogenesis. Dev. Biol. 251: 271–282.

Gray, Y., M. Tanakaand J. A. Sved, 1996 P-element-induced recom-bination in Drosophila melanogaster: hybrid element insertion. Ge-netics 144: 1601–1610.

Hanz, S., E. Perlson, D. Willis, J. Q. Zheng, R. Massarwa et al.,2003 Axoplasmic importins enable retrograde injury signalingin lesioned nerve. Neuron 40: 1095–1104.

Harel, A., and D. J. Forbes, 2004 Importin beta: conducting amuch larger cellular symphony. Mol. Cell. 16: 319–330.

Hogarth, C., C. Itman, D. A. Jans and K. L. Loveland, 2005 Reg-ulated nucleocytoplasmic transport in spermatogenesis: A driverof cellular differentiation? BioEssays 27: 1011–1025.

Hogarth, C. A., S. Calanni, D. A. Jans and K. L. Loveland,2006 Importin alpha mRNAs have distinct expression profilesduring spermatogenesis. Dev. Dyn. 235: 253–262.

Hubner, S., H. M. Smith, W. Hu, C. K. Chan, H. P. Rihs et al.,1999 Plant importin alpha binds nuclear localization sequenceswith high affinity and can mediate nuclear import independentof importin beta. J. Biol. Chem. 274: 22610–22617.

Kamei, Y., S. Yuba, T. Nakayma and Y. Yoneda, 1999 Three distinctclasses of the alpha-subunit of the nuclear pore-targeting com-plex (importin-alpha) are differentially expressed in adult mousetissues. J. Histochem. Cytochem. 47: 363–372.

Kohler, M., S. Ansieau, S. Prehn, A. Leutz, H. Haller et al.,1997 Cloning of two novel human importin-alpha subunitsand analysis of the expression pattern of the importin-alpha pro-tein family. FEBS Lett. 417: 104–108.

Kohler, M., C. Speck, M. Christiansen, F. R. Bischoff, S. Prehn

et al., 1999 Evidence for distinct substrate specificities of impor-tin alpha family members in nuclear protein import. Mol. CellBiol. 19: 7782–7791.

Kotera, I., T. Sekimoto, Y. Miyamoto, T. Saiwaki, E. Nagoshi et al.,2005 Importin alpha transports CaMKIV to the nucleus withoututilizing importin beta. EMBO J. 24: 942–951.

Lange, A., R. E. Mills, C. J. Lange, M. Stewart, S. E. Devine et al.,2007 Classical nuclear localization signals: definition, function,and interaction with importin alpha. J. Biol. Chem. 282: 5101–5105.

Madhavan, M. M., and K. Madhavan, 1980 Morphogenesis of theepidermis of adult abdomen of Drosophila. J. Embryol. Exp.Morphol. 60: 1–31.

Malik, H. S., T. Eickbush and D. S. Goldfarb, 1997 Evolutionaryspecialization of the nuclear targeting apparatus. Proc. Natl.Acad. Sci. USA 94: 13738–13742.

Mason, D. A., R. J. Fleming and D. S. Goldfarb, 2002 Drosophilamelanogaster importin a1 and a3 can replace importin a2 duringspermatogenesis but not oogenesis. Genetics 161: 157–170.

Mason, D. A., E. Mathe, R. J. Fleming and D.S. Goldfarb,2003 The Drosophila melanogaster importin a3 locus encodes anessential gene required for the development of both larval andadult tissues. Genetics 165: 1943–1958.

McCartney, B. M., H. A. Dierick, C. Kirkpatrick, M. M. Moline, A.Baas et al., 1999 Drosophila APC2 is a cytoskeletally-associatedprotein that regulates wingless signaling in the embryonic epider-mis. J. Cell Biol. 146: 1303–1318.

Michaud, N., and D. S. Goldfarb, 1993 Most nuclear proteins areimported by a single pathway. Exp. Cell Res. 208: 128–136.

Miyamoto, Y., N. Imamoto, T. Sekimoto, T. Tachibana, T. Seki et al.,1997 Differential modes of nuclear localization signal (NLS)recognition by three distinct classes of NLS receptors. J. Biol.Chem. 272: 26375–26381.

Miyamoto, Y., M. Hieda, M. T. Harreman, M. Fukumoto, T. Saiwaki

et al., 2002 Importin alpha can migrate into the nucleus in animportin beta- and Ran-independent manner. EMBO J. 21: 5833–5842.

Mosammaparast, N., and L. F. Pemberton, 2004 Karyopherins:from nuclear-transport mediators to nuclear-function regulators.Trends Cell Biol. 14: 547–556.

Ninov, N., D. A. Chiarelli and E. Martin-Blanco, 2007 Extrinsicand intrinsic mechanisms directing epithelial cell sheet replace-ment during Drosophila metamorphosis. Development 134: 367–379.

Preston, C. R., and W. R. Engels, 1996 P-element induced male re-combination and gene conversion in Drosophila. Genetics 144:1611–1622.

Prieve, M. G., K. Guttridge, J. E. Munguia and M. L. Waterman,1996 The nuclear localization signal of lymphoid enhancerfactor-1 is recognized by two differentially expressed Srp1-nuclear lo-calization sequence receptor proteins. J. Biol. Chem. 13: 7654–7658.

Prieve, M. G., K. Guttridge, J. E. Munguia and M. L. Waterman,1998 Differential importin-alpha recognition and nuclear trans-port by nuclear localization signals within the high-mobility-group DNA binding domains of lymphoid enhancer factor 1and T-cell factor 1. Mol. Cell Biol. 18: 4819–4832.

Quensel, C., B. Friedrich, T. Sommer, E. Hartmann and M.Kohler, 2004 In vivo analysis of importin alpha proteins re-veals cellular proliferation inhibition and substrate specificity.Mol. Cell Biol. 24: 10246–10255.

Drosophila Importin a1 Mutant 849

Riddick, G., and I. G. Macara, 2007 The adapter importin-alphaprovides flexible control of nuclear import at the expense of ef-ficiency. Mol. Syst. Biol. 3: 118.

Rorth, P., 1998 Gal4 in the Drosophila female germline. Mech.Dev. 78: 113–118.

Schatz, C. A., R. Santarella, A. Hoenger, E. Karsenti, I. W.Mattaj et al., 2003 Importin alpha-regulated nucleation of mi-crotubules by TPX2. EMBO J. 22: 2060–2070.

Stewart, M., 2007 Molecular mechanism of the nuclear protein im-port cycle. Nat. Rev. Mol. Cell Biol. 8: 195–208.

Struhl, G., D. A. Barbash and P. A. Lawrence, 1997 Hedgehogacts by distinct gradient and signal relay mechanisms to organisecell type and cell polarity in the Drosophila abdomen. Develop-ment 124: 2155–2165.

Tabb, M. M., P. Tongaonkar, L. Vu and M. Nomura, 2000 Evidencefor separable functions of Srp1p, the yeast homolog of importinalpha (Karyopherin alpha): role for Srp1p and Sts1p in proteindegradation. Mol. Cell Biol. 16: 6062–6073.

Talcott, B., and M. S. Moore, 2000 The nuclear import of RCC1requires a specific nuclear localization sequence receptor, karyo-pherin a3/Qip. J. Biol. Chem. 275: 10099–10104.

Tekotte, H., D. Berdnnik, T. Torok, M. Buszczak, L. M. Jones et al.,2002 Dcas is required for importin a3 nuclear export andmechano-sensory organ cell fate specification in Drosophila.Dev. Biol. 244: 396–406.

Tran, E. J., and S. R. Wente, 2006 Dynamic nuclear pore com-plexes: life on the edge. Cell 125: 1041–1053.

Tsuji, L., T. Takumi, N. Imamoto and Y. Yoneda, 1997 Iden-tification of novel homologues of mouse importin alpha, the al-pha subunit of the nuclear pore-targeting complex, and theirtissue-specific expression. FEBS Lett. 416: 30–34.

Yasuhara, N., N. Shibazaki, S. Tanaka, M. Nagai, Y. Kamikawa et al.,2007 Triggering neural differentiation of ES cells by subtypeswitching of importin-alpha. Nat. Cell Biol. 9: 72–79.

Communicating editor: K. Golic

850 R. Ratan et al.