Draft - University of Toronto T-Space · Draft 4 before the active uptake of Vtg, i.e. zonagenesis...

Draft

Dynamics of ovarian maturation throughout the

reproductive cycle of the Neotropical cichlid fish Cichlasoma dimerus (Teleostei, Cichliformes).

Journal: Canadian Journal of Zoology

Manuscript ID cjz-2016-0198.R1

Manuscript Type: Article

Date Submitted by the Author: 02-Jan-2017

Complete List of Authors: Varela, María Luisa; Consejo Nacional de Investigaciones Cientificas y Tecnicas, Instituto de Biodiversidad y Biología Experimental; Universidad de Buenos Aires Facultad de Ciencias Exactas y Naturales, Dto Biodiversidad y Biología Experimental, Lab. de Ecotoxicología Acuática Ferreira, María Florencia; Consejo Nacional de Investigaciones Cientificas y Tecnicas, Instituto de Biodiversidad y Biología Experimental; Universidad de Buenos Aires Facultad de Ciencias Exactas y Naturales, Dto Biodiversidad y Biología Experimental, Lab. de Ecotoxicología Acuática Da Cuña, Rodrigo; Consejo Nacional de Investigaciones Cientificas y Tecnicas, Instituto de Biodiversidad y Biología Experimental; Universidad de Buenos Aires Facultad de Ciencias Exactas y Naturales, Dto Biodiversidad y Biología Experimental, Lab. de Ecotoxicología Acuática Lo Nostro, Fabiana; Consejo Nacional de Investigaciones Cientificas y Tecnicas, Instituto de Biodiversidad y Biología Experimental; Universidad de Buenos Aires Facultad de Ciencias Exactas y Naturales, Dto Biodiversidad y Biología Experimental, Lab. de Ecotoxicología Acuática Genovese, Griselda; Consejo Nacional de Investigaciones Cientificas y Tecnicas, Instituto de Biodiversidad y Biología Experimental; Universidad de Buenos Aires Facultad de Ciencias Exactas y Naturales, Dto Biodiversidad y Biología Experimental, Lab. de Ecotoxicología Acuática Meijide, Fernando; Consejo Nacional de Investigaciones Cientificas y Tecnicas, Instituto de Biodiversidad y Biología Experimental; Universidad de Buenos Aires Facultad de Ciencias Exactas y Naturales, Dto Biodiversidad y Biología Experimental, Lab. de Ecotoxicología Acuática

Keyword: Reproductive cycle, Gene expression, Plasma steroids, Gonadal histology, Asynchronous ovarian development, <i>Cichlasoma dimerus</i>, Acará cichlid

https://mc06.manuscriptcentral.com/cjz-pubs

Canadian Journal of Zoology

Draft

1

Dynamics of ovarian maturation throughout the reproductive cycle of the Neotropical

cichlid fish Cichlasoma dimerus (Teleostei, Cichliformes).

Varela, M.L.1,2,3

, Ferreira, M.F.1,2,4

, Da Cuña, R.H.1,2,5

, Lo Nostro, F.L.1,2,6

, Genovese,

G1,2,7

, and Meijide, F.J.1,2,8.

1Universidad de Buenos Aires, Facultad de Ciencias Exactas y Naturales, Departamento de

Biodiversidad y Biología Experimental, Laboratorio de Ecotoxicología Acuática. Buenos

Aires, Argentina.

2CONICET-Universidad de Buenos Aires. Instituto de Biodiversidad y Biología

Experimental-CONICET (IBBEA). Buenos Aires, Argentina.

[email protected];

[email protected];

[email protected];

[email protected];

[email protected];

[email protected]

Corresponding author:

Dr. Fernando J. Meijide and Dr. Griselda Genovese. Laboratorio de Ecotoxicología

Acuática, Departamento de Biodiversidad y Biología Experimental, Facultad de Ciencias

Exactas y Naturales, Universidad de Buenos Aires. Int. Güiraldes 2160, Ciudad

Universitaria, C1428EGA, Ciudad Autónoma de Buenos Aires, Argentina.

Phone: (5411) 45763348. Fax: (5411) 45763384.

E-mail: [email protected]; [email protected]

Condensed title: The ovarian cycle of a neotropical fish.

Page 1 of 48



Draft

2

Dynamics of ovarian maturation throughout the reproductive cycle of the Neotropical

cichlid fish Cichlasoma dimerus (Teleostei, Cichliformes).

Varela, M.L.1, Ferreira, M.F.

1, Da Cuña, R.H.

1, Lo Nostro, F.L.

1, Genovese, G

1 and

Meijide, F.J.1.

Abstract

In this study, we analyzed gene expression profiles, plasma steroids concentrations and

gonadal morphology throughout the reproductive cycle of female Cichlasoma dimerus

(Heckel, 1840), a monogamous cichlid fish exhibiting social hierarchies. Fish were

analyzed at six phases encompassing their annual cycle, namely resting (during the non-

reproductive period); pre-spawning, 30 hours post-spawning (ps), 4 days ps, 10 days ps and

subordinate (during the reproductive period). The histological and histomorphometric

analysis showed that C. dimerus exhibits asynchronous ovarian development. Similarly to

resting females, subordinate females showed low gonadosomatic index, reduced expression

levels of vitellogenin (vtgAb), zona pellucida (zpB), gonadal aromatase (cyp19a1A) and low

levels of plasma sex steroids, thus indicating that social intimidation by dominant

conspecifics elicited reproductive arrest. In reproductively active females, a direct positive

correlation between plasma estradiol, vtgAb expression, the percentage of late vitellogenic

oocytes and the gonadosomatic index was observed. These parameters were maximal at the

pre-spawning phase, decreased at 30 h and 4 d ps, and then reached a peak on day 10 ps.

Our results indicate that C. dimerus females become spawning capable after 10 days

following spawning, coincidently with the shortest time interval between successive

spawns recorded in captivity.

Key words: Reproductive cycle, Gene expression, Plasma steroids, Gonadal histology,

Asynchronous ovarian development, Cichlasoma dimerus, Acará cichlid.

Page 2 of 48



Draft

3

1. Introduction

In fish, as in other vertebrates, the brain-pituitary-gonadal axis operates as a cascade

system that regulates the entire reproductive process, promoting gametogenesis and

subsequent gamete maturation. In oviparous species, vitellogenin (Vtg) is the egg yolk

precursor protein, which serves as a nourishment source for the developing embryo and

also as a major supply of minerals. Vtg is a phospholipoglycoprotein whose enzymatic

cleavage generates three yolk proteins inside the oocyte: lipovitellin, phosvitin, and β-

component (Babin et al. 2007; Hiramatsu et al. 2015). Three forms of Vtg are encoded in a

Vtg gene cluster (VtgAa, VtgAb and the ancestral gene VtgC) being VtgAb the most

expressed one (Finn et al. 2009). Several studies have shown that synchronous spawning

fish exhibit well-defined vtg expression patterns, which closely parallel seasonal changes in

steroid hormones. However, variations in vtg expression in asynchronous species have been

less analyzed, especially in relation with stage-specific oocyte development (Connolly et al.

2014).

The zona pellucida (ZP) is an extracellular matrix that covers the oocyte and

participates in species-specific sperm-egg binding during fertilization in most vertebrates.

(Goudet et al. 2008). In teleost fishes, sperm interaction occurs at the micropyle level, a

funnel shaped channel located at the animal pole, through which the sperm reaches the

oocyte. The ZP not only protects the embryo from physical damage during development but

also has bactericidal effects (Kudo et al. 2000). This envelope is composed of four groups

of glycoproteins for which Spargo and Hope (2003) and Goudet et al. (2008) proposed a

unified system of nomenclature for vertebrates: ZPA, ZPB, ZPC and ZPX.

The expression of ZP and Vtg is under multiple hormones control, with levels rising

steadily in females during sexual maturation. The deposition of ZP proteins takes place

Page 3 of 48



Draft

4

before the active uptake of Vtg, i.e. zonagenesis precedes vitellogenesis (Hyllner et al.

1994, Celius and Walther 1998, Corriero et al. 2004). Both processes are initiated after

hypothalamic stimulation with a precise feedback control. In teleosts, direct innervation by

hypothalamic fibers of GnRH, dopamine and other neuromodulators affect gonadotrope

cells, located within the proximal pars distalis of the pituitary, regulating the production of

the gonadotropins, follicle-stimulating hormone (FSH) and luteinizing hormone (LH)

(Cerdá-Reverter and Canosa 2009; Zohar et al. 2010). Gonadotropins exhibit distinct

patterns of expression throughout the reproductive cycle, which may vary between species.

Upon reaching the ovaries, they stimulate the activity of steroidogenic enzymes, such as

3β-hydroxysteroid dehydrogenase (3β-hsd) and P450 aromatase, as well as their gene

expression (Nakamura et al. 2003; Lubzens et al. 2010). Secreted sex steroids promote

oogenesis and influence brain and sex organs development. Among them, 17β-estradiol

(E2) is the main sex steroid involved in the regulation of oocyte development (Babin et al.

2007; Lubzens et al. 2010). In addition, E2 has been reported to modulate reproductive

behaviour (Specker and Kishida 2000, Huffman et al. 2013). This estrogen is synthesized

by P450 aromatase from its androgen precursor, testosterone (T). Two types of aromatase

genes have been described in teleosts, namely cyp19a1A (mainly expressed in gonads) and

cyp19a1B (mainly expressed in brain) (Kobayashi et al. 2004; Chang et al. 2005).

Conversion of T to E2 by gonadal aromatase in follicle cells represents a major source of

circulating E2 that regulates ovarian development in teleosts (Van Der Kraak 2009). Upon

reaching the liver, E2 diffuses freely across the membrane of the hepatocytes and binds to

estrogen receptors, initiating the transcription of Vtg and ZP encoding genes (Polzonetti-

Magni et al. 2004; Modig et al. 2006). These proteins are produced by the hepatocytes,

released into the bloodstream and transported to the ovaries, where they become

Page 4 of 48



Draft

5

incorporated into the developing oocytes (Le Menn et al. 2007). The egg envelope is

formed as ZP proteins are deposited around microvilli that extend from the oocyte surface

towards the surrounding follicle cells (Modig et al. 2007). Vtg uptake by the oocyte is

mediated by a receptor-mediated endocytosis mechanism. Within the oocyte cytoplasm,

Vtg is proteolitically cleaved into smaller yolk proteins (Babin et al. 2007).

The acará, Cichlasoma dimerus (Heckel, 1840), is a South American cichlid fish that

has recently emerged as a well-established laboratory model for the study of reproduction,

neuroendocrinology and behaviour (see Pandolfi et al. 2009a and Ramallo et al. 2014 for

review) and also for toxicological studies (Rey Vázquez et al. 2009; Genovese et al. 2012,

2014; Da Cuña et al. 2013, 2016; Piazza et al. 2015; Meijide et al. 2016). This species

exhibits a hierarchical social system established and sustained through agonistic

interactions. Both males and females can be found in one of two basic alternative

phenotypes that are linked to both social and reproductive status. Territorial or dominant

fish display bright body coloration and aggressively guard a territory that is critical for

reproduction; in contrast, non-territorial or subordinate fish have opaque coloration and are

socially denied immediate access to reproduction by the dominant conspecifics (Ramallo et

al. 2012, 2014). Under laboratory conditions, C. dimerus proves to be a multiple spawner

throughout the year, with a season of higher reproductive activity extending from

September to March, during which fish can spawn on average every 30 days (Rey Vázquez

et al. 2012). However, shorter time intervals between successive spawns, namely of only 10

days, have been recorded. Following spawning, C. dimerus exhibits biparental care of the

progeny, guarding both eggs and larvae from predators (Meijide and Guerrero 2000;

Alonso et al. 2011). In previous studies, hormone levels and gonadal histology were

assessed in territorial and non-territorial males, as well as in males and females at different

Page 5 of 48



Draft

6

phases within the parental care period (Tubert et al. 2012; Ramallo et al. 2014, 2015; Birba

et al. 2015). However, gene expression and ovarian morphometry throughout the

reproductive cycle of C. dimerus have not been assessed thus far. Here, we provide a

comprehensive characterization of the whole reproductive cycle in female C. dimerus,

integrating gene expression, plasma steroids and gonadal histology at distinct phases

including both the reproductive and non-reproductive periods. Thus, this study provides

baseline information for future studies in C. dimerus and other teleost species with similar

reproductive features, and contributes to a further understanding of the molecular and

morphological patterns that underlie ovarian development in fishes.

2. Materials and Methods

2.1. Animals

Adult specimens of C. dimerus (30 females, standard length: 7.2-9.1 cm, weight: 20-43

g; 24 males, standard length: 8.5-10.5 cm; weight: 27-52 g) were collected from wild

populations in Esteros del Riachuelo, Corrientes, Argentina (27º22’ S, 58º20’ W) by local

fishermen during spring and summer months, and transferred to the laboratory, where they

were housed in large community tanks. Fish were allowed to acclimate to aquarium

conditions for at least one month before their incorporation into the experimental set up. All

experiments were conducted in accordance with international standards on animal welfare

(Canadian Council on Animal Care, 2005) as well as being in compliance with the local

Ethical Committee (CICUAL, Facultad de Ciencias Exactas y Naturales, Universidad de

Buenos Aires).

2.2. Experimental design

Page 6 of 48



Draft

7

Fish were distributed in 70-90 L aquaria in which 5 to 8 specimens, including both

females and males, were housed. Sexes were distinguished based on the external

dimorphism described for C. dimerus, with the males growing larger than females and

having soft rays of the distal edge of the dorsal fin extended as filaments (Pandolfi et al.,

2009a). Fish were maintained under conditions mimicking the fluctuations of temperature

and light in the natural habitat. Temperature was regulated so that water temperature ranged

from 18 to 22 ºC from April to September and from 24 to 30 ºC during the rest of the year.

Photoperiod conditions were set at 12:12 h during the low temperature period and 14:10 h

during the remaining period, and overlapped with the natural occurring light-dark cycle.

Fish were fed pelleted commercial food once daily (Tetra® Pond Variety Blend).

Experimental aquaria were well-aerated and provided with a layer of gravel and flat stones

for egg deposition on the bottom. In addition, artificial plants and stones of various shapes

were placed in the aquaria which fish used to delimit their territories. Under these

conditions, spontaneous spawning took place regularly during the reproductive season.

Female fish were analysed at six phases (n 4-5 per phase) encompassing the annual

reproductive cycle. “Resting” females were sampled within the non-reproductive period

(June-August, 18-20 ºC), during which sexual activity and pair’s formation were not

evidenced. Five other phases were defined during the reproductive period (December-

March, 26-30 ºC) and were referred to as “pre-spawning”: the female showed agonistic

behavior towards conspecifics while defending a territory, “30 hours post-spawning (ps)”:

the female guarded for the recently spawned eggs along with the male, “4 days ps”: the

female guarded for the non-swimming larvae along with the male, “10 days ps”: the female

no longer guarded for the swimming larvae, either because they were eaten by the other fish

or otherwise artificially removed from the aquarium, “subordinate”: the female of lowest

Page 7 of 48



Draft

8

rank was recognized as the one showing pronounced submission while receiving most of

the aggressive displays performed by the other fish within the aquarium.

2.3. Samples collection

Fish were removed from the aquaria and immediately after, peripheral blood was

collected by puncture of the caudal vein with heparin-coated 27 gauge x ½” needle attached

to a 1 mL syringe. Blood samples were collected in heparin-coated tubes for the

measurements of steroid hormones. A small fraction was separated for vitellogenin (Vtg)

and zona pellucida (ZP) protein analysis, to which 2.5 µL of 1 mM PMSF

(phenylmethylsulfonyl fluoride, protease inhibitor) were added. To minimize possible

effects of circadian variation, all samples were taken between 15:00 and 17:00 h. Blood

was stored overnight at 4 ºC and centrifuged at 800 x g for 15 min. Finally, the plasma was

collected and stored at -20 ºC until assayed. After blood collection, fish were anesthetized

by immersion in a 0.1% benzocaine solution. Body mass, total length and standard length

of each animal were recorded. Fish were then euthanized by decapitation and the ovaries,

liver and pituitary of each specimen were rapidly dissected. The ovaries and liver were

weighed for calculation of the gonadosomatic index (GSI: [gonad weight/total body

weight] x 100) and hepatosomatic index (HSI: [liver weight/total body weight] x 100). The

whole pituitary and fragments of the ovary and liver of each fish were conserved at 4 ºC for

24 h in RNA stabilizing solution (RNA later, Thermo Fisher Scientific, USA) and stored at

-20 ºC until further processing for gene expression analysis. In addition, middle portions of

the ovaries were fixed in Bouin’s solution for 24 h at room temperature for histological

processing.

Page 8 of 48



Draft

9

2.4. Hormone assays

Steroid hormones, 17β-estradiol (E2), testosterone (T), and cortisol (F), were measured

from plasma samples using commercial ELISA kits (DRG Instruments, Germany). Cortisol

was only quantified from blood samples for which drawing time was less than 4 min after

netting to avoid an increase in circulating levels due to fish manipulation. In all cases,

samples were assayed in duplicates and analyses were carried on samples for which

coefficients of variation were below 20%, following the manufacturer’s instructions. Intra-

assay variation was 4.2% for T (detection limit: 0.08 ng/mL), 6% for E2 (detection limit:

9.7 pg/mL), and 8.1% for F (detection limit: 2.46 ng/mL), while inter-assay variation was

15.6%, 5.3% and 10.3% respectively. A standard curve was plotted using the mean

absorbance obtained from each standard (supplied by the manufacturer) against its

concentration, adjusted to a 4 parameter logistic curve fit. The sample concentration was

read from the standard curve. Correlation coefficients were above 0.99 for all measured

steroids. Since plasma levels of 11-ketotestosterone (11-KT) in female cichlids proved to

be negligible compared to the levels of T (lower than 10%; Taves et al. 2009) and the

percentage of cross reaction between both androgens is minimal, determinations were

considered to correspond only to T.

2.5. Semiquantitative gene expression analysis

RNA was extracted and purified from 50 mg fragments of liver and ovary, as well

as from whole pituitary following Trizol reagent instructions (Thermo Fisher Scientific,

USA). Each tissue sample was homogenized with a Bio-Gen PRO200 homogenizer

connected to a 5 mm generator probe (Pro Scientific, USA). RNA integrity was determined

by electrophoresis in a 1.5 % agarose gel (Mini-Sub Cell GT Cell, BioRad, USA) with the

Page 9 of 48



Draft

10

addition of SYBR safe (Thermo Fisher Scientific, USA). The RNA concentration was

measured with a Qubit fluorometer (Thermo Fisher Scientific, USA). RNA samples were

incubated with DNase I Amplification Grade kit (Thermo Fisher Scientific, USA) to digest

contaminating genomic DNA. RNA samples (2 µg for liver or ovary and 0.5 µg for

pituitary) were reverse transcribed to single-stranded cDNA with M-MLV Reverse

Transcriptase following manufacturer instructions (Promega, USA) and using oligo (dT) as

primer (Biodynamics, Argentina). cDNA was stored at -20 °C until used.

Previously published partial sequences for C. dimerus were used to design specific

primers of zona pellucida protein B (zpB) (Genovese et al, 2011), vitellogenin Ab (vtgAb)

(Genovese et al, 2012), β subunit of luteinizing hormone (β-lh) and β subunit of follicle

stimulating hormone (β-fsh) (Pandolfi et al. 2009b, Di Yorio et al. 2015), gonadal

aromatase (cyp19a1A) (Ramallo et al. unpublished) and β-actin (GenBank, NCBI) using

Primer-BLAST software (Table 1).

For 3β-hydroxysteroid dehydrogenase (3β-hsd), a phylogenetic related sequence

(GenBank accession number EU827279) of Oreochromis niloticus L., 1758 (Perciformes,

Cichlidae) was used. Lyophilized oligos synthesized by Integrated DNA Technologies were

resuspended in TE (10 mM Tris-HCl pH 8 and 1 mM EDTA) buffer. For each primer pair,

the appropriate annealing temperature and concentration was determined in conventional

PCR using a Multigene Thermical Cycler (Labnet, USA). The thermal profile for PCR

consisted of an activation step at 95 °C for 5·min, 40 cycles of denaturing at 94 °C for 1

min, annealing for 30s and elongation at 72 °C for 2 min. After the last amplification cycle,

the program was ended at 72 °C for 5 min and cooled at 4 °C. Amplicon size, non-specific

bands, and dimers formation were determined in 1.5 % agarose gel electrophoresis at

constant 100 V using DNA molecular weight marker (QuantiMarker, Biodynamics,

Page 10 of 48



Draft

11

Argentina). In the case of 3β-hsd, the PCR product was purified with a gel extraction kit

(AccuPrep Gel Purification Kit Bioneer, Korea) and sent for sequencing. The obtained

sequences were edited with Chromas Lite (Technelysium, Australia) and blasted at NCBI.

Specific primers for 3β-hsd of C. dimerus were designed (Table 1).

A semiquantitative retrotranscriptase polimerase chain reaction (RT-PCR) was

performed with GoTaq DNA Polymerase (Promega, USA) using 1 µL of template in a final

volumen of 15 µL. Primer final concentration was 3 µM. PCR products were separated in

agarose gels as detailed above and digital images were captured under UV light (G Box,

Syngene). Gene expression was estimated by measuring the optical density of the bands

using Image J (National Institutes of Health). β-actin of C. dimerus was used as a

housekeeping gene (Yang et al. 2013) (Table 1).

2.6. Vitellogenin and zona pellucida protein immunoblot

Plasma samples were analyzed by reducing sodium dodecyl sulfate polyacrylamide gel

electrophoresis (SDS/PAGE) using a 5% stacking gel and 8% resolving gel followed by

Western blot. Samples were diluted in sample buffer containing 0.3 M Tris/HCl, pH 6.8,

3% SDS, 10% glycerol, 1% β-mercaptoethanol and 2% bromophenol blue. Equal amounts

of protein (60 µg), as measured by Lowry et al. (1951), were loaded into each lane.

Molecular mass was estimated using pre-stained molecular mass standards (Thermo Fisher

Scientific, USA). Following separation by electrophoresis, proteins were transferred to a

nitrocellulose membrane (Hybond, Amersham Pharmacia, USA) for 90 min at 4 °C and

100 V in transfer buffer (25 mM Tris, 187 mM glycine, 20% (v/v) methanol). Non-specific

binding of membranes was blocked with 3% non-fat powdered milk and 3% BSA in TTBS

(100 mM Tris–HCl, 0.9% NaCl, 0.1% Tween 20, pH 7.5) overnight at 4 °C. For Vtg

Page 11 of 48



Draft

12

detection, membranes were incubated with a primary antiserum, rabbit anti-perch Vtg

(donated by Dr. B. Allner, Hessisches Landesamt für Umwelt und Geologie, Germany)

1:5000 in TTBS for 90 min at room temperature. After three 5 min washes in TTBS,

membranes were incubated with a biotinylated anti-rabbit IgG antibody (Sigma-Aldrich,

USA) diluted 1:10000 for 1 h and washed again. For ZP protein detection, membranes were

incubated with a primary antibody, mouse anti-salmon ZP (MN-8C4, Biosense, Norway)

1:250 for 4 h at room temperature. After washing in TTBS, membranes were incubated

with a biotinylated anti-mouse IgG antibody (Dako, Denmark) diluted 1:2000 for 2 h and

washed again. Membranes were then incubated with alkaline phosphatase-conjugated

streptavidin (Promega, USA) diluted 1:5000 for 1 h in the dark. Immunoreactivity was

developed with bromo chloro indolyl phosphate/nitroblue tetrazolium (Bio-Rad Kit, USA).

Omission of primary antisera was performed for Western blot as specificity control.

2.7. Histological and histomorphometric analysis

After fixation, ovary samples were dehydrated through an ascending series of ethanol

solutions and embedded in glycol methacrylate (Leica Historesin, Germany) during 72 h.

Samples were serially sectioned at 5 µm in the transverse plane, mounted on gelatin-coated

slides and stained with hematoxylin-eosin or the periodic acid Schiff (PAS) method. The

slides were examined under a Zeiss Primo Star microscope and images were captured using

a Canon PowerShot A640 digital camera. In order to better understand the reproductive

dynamics in females of this multiple spawning species, we performed a histomorphometric

analysis, recording the percentage of each stage of oocyte development within ovarian

sections from females at the different reproductive phases. The stages of oogenesis were

classified in accordance with Grier et al. (2009) with some modifications, and recognized

Page 12 of 48



Draft

13

as indicated in Table 2. Oocytes were visually quantified under the microscope in three

randomly chosen sections, separated by at least 2 mm, from each fish ovary. Percentages

for each cell type were then calculated from the three examined sections.

2.8. Data analysis

All statistical analyses were performed using GraphPad Prism 5.03 (GraphPad

Software Inc., USA). All data fulfilled the criteria for parametric statistics. Gene expression

levels and plasma steroid concentrations were compared by one-way analysis of variance

(ANOVA). When significant differences were found, the analyses were followed by

Tukey’s test. Pearson’s correlation coefficients were used to study the linear relation

between gene expression, hormone levels, GSI and the percentage of late vitellogenic

oocytes (LVO). When non linearity was observed, Spearman’s correlation coefficients were

used. Data are presented as mean ± SEM and the statistical significance we set at p<0.05.

3. Results

3.1. Gonadosomatic and hepatosomatic indexes

The gonadosomatic index (GSI) of female C. dimerus at the pre-spawning phase was

significantly higher than those of females at any of other phases, except for the 10 days

post-spawning (ps) group. Following spawning, the GSI decreased significantly, showing

low values at 30 h and 4 days ps. At 10 days ps, the GSI increased relative to the two

previous phases and approached the value recorded prior to spawning, although differences

with the previous phases were not significant. Subordinate females, as well as females at

the resting phase, presented the lowest GSI values, although they were not significantly

different from those of post-spawning phases (Fig. 1A). Hepatosomatic index (HSI) values

Page 13 of 48



Draft

14

were variable throughout the reproductive cycle and differences between phases were not

significant (Fig. 1B).

3.2. Plasma steroids

Females at the pre-spawning phase showed significantly higher levels of estradiol (E2)

than females at 30 h and 4 days ps, and comparable levels to those of 10 days ps females.

Resting and subordinate females exhibited low levels of E2, comparable to those recorded

at 30 h and 4 days ps, with no differences between them (Fig. 2A). Pre-spawning females

showed significantly higher levels of testosterone (T) than females of any other group

excepting 10 days ps. No differences were observed between the remaining groups (Fig.

2B). Cortisol (F) levels were higher in pre-spawning females than in the other groups,

although this difference was not significant when compared to 10 days ps females. Females

at the other four phases showed low and comparable levels of F (Fig. 2C).

3.3. Gene expression

The highest levels of vtgAb expression were recorded in pre-spawning and 10 days ps

females, followed by 30 h and 4 days ps females, which in turn showed higher vtgAb

expression than resting and subordinate females (Fig. 3A). zpB expression was significantly

higher among 10 days ps females than in the remaining groups. Females at 30 h and 4 days

ps showed higher zpB expression than pre-spawning females, while the lowest levels were

recorded in resting and subordinate females (Fig. 3B). Females at 10 days ps exhibited the

highest level of cyp19a1A expression. Pre-spawning and 4 days ps females showed

relatively high levels of cyp19a1A expression, which did not differ between them but were

significantly higher than those of resting, subordinate and 30 h ps females (Fig. 3C).

Page 14 of 48



Draft

15

Regarding 3β-hsd expression, no clear differences were observed between the reproductive

phases, i.e. comparable values were recorded in most of them. Significant differences were

recorded only between resting and subordinate or pre-spawning females (Fig. 3D). Pre-

spawning females exhibited an elevated β-lh expression, which was significantly higher

than in the other groups. The lowest levels of β-lh expression were recorded in resting and

subordinate females, while the other groups showed intermediate values (Fig. 3E). No

differences between groups were evidenced in the expression of β-fsh (Fig. 3F).

3.4. Vitellogenin and zona pellucida protein detection

No Vtg immunoreactive bands were detected in plasma samples of resting and

subordinate females. In contrast, six bands with molecular masses of 155, 110, 98, 92, 72,

and 65 kDa were evidenced in pre-spawning females. In 30 h ps females, only the two

bands of lower mass were detected, while there were no detectable bands in 4 days ps

females. Finally, at 10 days after spawning, four bands were evidenced, namely those of

low and intermediate molecular mass (Fig. 4A). ZP protein immunoreactivity was only

clearly evidenced in plasma samples of 10 days ps females, in which two major bands

weighting 57 and 59 kDa, and a minor band of 73 kDa were detected. These bands were

less defined in pre-spawning females, while no immunoreactive bands were observed in the

other reproductive phases (Fig. 4B).

3.5. Ovarian histology and histomorphometry

Ovarian histology from a representative individual at each phase of the reproductive

cycle is shown in Fig. 5, while quantification of the percentages of stages of oogenesis at

each phase is displayed in Fig. 6.

Page 15 of 48



Draft

16

At all phases of the reproductive cycle, the highest percentage of oocytes were at pre-

vitellogenic stages. Among these, the perinucleolar stage was the one represented in greater

proportion. Excepting for chromatin-nucleolus oocytes, all stages of oogenesis up to early

vitellogenesis were well represented in ovaries from females at the resting phase.

Occasionally, mid vitellogenic oocytes were observed in some of these fish (Figs. 5A, 6A).

In subordinate females, the latest stage recorded was early vitellogenesis, and this stage was

represented in a low proportion with respect to pre-vitellogenic stages. Atretic oocytes were

also present (Figs. 5B, 6B). In females at the pre-spawning phase, the percentage of

vitellogenic oocyes was relatively high (27.85 ± 3.20) and in turn, most of them were at the

late vitellogenic stage (17.67 ± 2.81). Atretic oocytes were recorded as well (Figs. 5C, 6C).

In females at 30 h ps, vitellogenic oocytes were represented only by the early vitellogenic

stage (24.23 ± 2.85). Post-ovulatory follicles as well as atretic oocytes were observed

during this phase (Figs. 5D, 6D). Four days after spawning, the percentage of vitellogenic

oocytes was similar to that recorded at the previous phase (23.14 ± 2.03), although the mid

vitellogenic stage was already represented among them (Figs. 5E, 6E). At 10 days ps, the

percentage of vitellogenic oocytes was similar to that recorded at the pre-spawning phase

(29.99 ± 1.73). Among them, the late vitellogenic stage was the most represented (14.64 ±

6.01) (Figs. 5F, 6F), with a value comparable to that of pre-spawning females. Melano

macrophagic centers, related to reabsorptive processes, were observed in association with

atretic oocytes, typically in subordinate, pre-spawning and 30 h ps females (Fig. 5B, D).

3.6. Correlations

The GSI positively correlated with plasma levels of E2 (Pearson's correlation

coefficient = 0.8546, R2 = 0.7304 p < 0.0001; Fig. 7A) and T (Pearson's correlation

Page 16 of 48



Draft

17

coefficient = 0.7514, R2 = 0.5645, p < 0.0001; Fig. 7B). Positive correlations were also

found between the percentage of late vitellogenic oocytes (LVO) and E2 levels (Pearson's

correlation coefficient = 0.8464, R2 = 0.7163, p < 0.001; Fig. 7C) and between LVO and

the GSI (Pearson's correlation coefficient = 0.7768, R2 = 0.6034, p < 0.001; Fig. 7D). Liver

vtgAb expression correlated positively with E2 levels (Pearson's correlation coefficient =

0.8332, R2 = 0.6942, p < 0.0001; Fig. 7E), LVO (Pearson's correlation coefficient = 0.6789,

R2 = 0.4609, p = 0.0003; Fig. 7F) and the GSI (Pearson's correlation coefficient = 0.6803,

R2 = 0.4628, p = 0.0002; Fig. 7G). Finally, non-linear correlations were determined

between the expression of cyp19a1A and T levels (Spearman's correlation coefficient =

0.5684, p = 0.0072; Fig. 7H) and between cyp19a1A and LVO (Spearman's correlation

coefficient = 0.4477, p = 0.0477; Fig. 7I). Nevertheless, no significant correlation was

found between E2 levels and cyp19a1A expression (data not shown).

4. Discussion

Cichlasoma dimerus is a cichlid fish capable of spawning multiple batches of eggs

during a protracted breeding season (Rey Vázquez et al. 2012). We herein studied the

dynamics of the ovary maturation along different phases of the annual reproductive cycle,

including both the reproductive and non-reproductive periods. The ovarian histological and

morphometric analysis performed in this study allowed us to classify C. dimerus as a

species exhibiting asynchronous ovarian development. During the reproductive period, the

ovaries of spawning-capable females appear to be a random mixture of oocytes at every

conceivable stage, without dominant populations (Wallace and Selman 1981). Eggs are

recruited from this heterogeneous population of developing oocytes as a continuous

ongoing process, and are subsequently ovulated in several batches during each breeding

Page 17 of 48



Draft

18

season (Tyler and Sumpter 1996). This pattern of ovarian development has also been

reported in other tropical species, such as the killifish Fundulus heteroclitus L., 1766

(Wallace and Selman 1980), the tilapias, Oreochromis mossambicus (Peters, 1852) and O.

niloticus (Rocha and Reis-Henriques 1996; Costa Melo et al. 2014), the spotted metynnis,

Metynnis maculatus (Kner, 1858) (Pereira et al. 2013) and the zebrafish, Danio rerio

(Hamilton, 1822) (Connolly et al. 2014). However, unlike them, late vitellogenic oocytes

were not observed in the ovary of C. dimerus during the first days following spawning.

This means that full grown oocytes within the ovary undergo maturation and ovulation at

each spawning event, which in turn is related to the possibility that the standing stock of

pre-vitellogenic and early vitellogenic oocytes could develop and be recruited into the late

yolked oocyte stock at any time during the season (indeterminate fecundity) (Murua and

Saborido-Rey 2003). The small percentage of late vitellogenic oocytes that is not ovulated

regresses by atresia.

A different pattern between vitellogenin (vtgAb) and zona pellucida protein (zpB) gene

expression was found in our study. While zpB reached the highest level at 10 days ps, vtgAb

expression was maximal in the pre-spawning phase. These results are congruent with

previous studies which report a different timing between zonagenesis and vitellogenesis in

teleosts (Hyllner et al. 1994; Corriero et al. 2004). In C. dimerus, the elevated level of

vtgAb expression in pre-spawning and 10 days ps females is probably related with the

incorporation of Vtg in early and mid vitellogenic oocytes. Similarly to vtgAb, zpB

expression tends to increase progressively after spawning, but unlike vtgAb, it declines at

the pre-spawning phase, despite the elevated 17β-estradiol (E2) levels. This seems to

indicate that ZPB is incorporated into the zona pellucida early during oocyte development

but does not contribute significantly to its formation at later stages. The different pattern

Page 18 of 48



Draft

19

observed in vtgAb and zpB expression could be explained by a differential response of these

genes to E2 regulation and/or the modulation by different types of estrogen receptors (ERs).

It has been shown that low levels of plasma E2 are sufficient to elicit the ZP expression, but

Vtg expression requires higher E2 levels (Hyllner et al. 1994; Corriero et al. 2004; Nelson

and Habibi 2013). In addition, while Vtg expression occurs via ERα, and increases as E2

levels raise, sustained high levels of E2 would inhibit ERβ (Yost et al. 2014), which

appears to be the main receptor mediating ZP expression. A detailed study of ERs

expression throughout the reproductive cycle of C. dimerus is needed to confirm our

hypothesis. At the protein level, both plasma ZP and Vtg could be detected with antisera

previously proven useful in this species (Moncaut et al. 2003; Rey Vázquez et al. 2009;

Genovese et al. 2011). It should be noted that these antisera were not specific for any of the

ZP and Vtg types, so Western blot (WB) bands revealed the presence of any of them in

circulation. For VtgAb, a fairly good correspondence was observed between the level of

gene expression and the number and intensity of WB protein bands. At 30 hours ps, some

Vtg bands were detected, even though gene expression had dropped. This could be

explained by a remnant level of Vtg present in the blood stream, given the high gene

expression at pre-spawning and a time delay between gene expression and protein synthesis

and secretion. Similarly, zpB maximal gene expression was coincident with its most

pronounced protein detection, on day 10 after spawning. Moreover, some protein bands

were detected in the pre-spawning phase, even when gene expression was low, probably

due to the previous elevated level of expression.

In our study, pre-spawning females showed the highest E2, testosterone (T) and

cortisol (F) levels throughout the reproductive cycle, as well as the highest gonadosomatic

index (GSI) and vtgAb expression. These parameters also reached a peak at 10 days ps. Vtg

Page 19 of 48



Draft

20

gene expression in the liver is known to be induced by E2 (Babin et al. 2007) and a positive

correlation between E2 and vtgAb was readily observed in our study. Moreover, Vtg

upregulation by E2 was found to be potentiated by F co-exposure in the fathead minnow,

Pimephales promelas (Rafinesque, 1820) (Brodeur et al. 2005) and the gilthead seabream,

Sparus aurata L., 1758 (Modig et al. 2006). In the latter study, the authors did not detect

any effect of F on ZP mRNA levels. Due to the concomitant increase in E2, F and vtgAb

expression, it might be suggested that F participates in the regulation of C. dimerus

vitellogenesis but not in zonagenesis. In a previous study, Tubert et al. (2012) analyzed

steroids fluctuations during the parental care of C. dimerus using isolated pairs.

Coincidently with our study, they reported a significant increase in androgen and estrogen

levels in the pre-spawning phase; however, the highest F levels were recorded in females

guarding eggs (from spawning until 48 h ps). This contrasting result of F levels could be

explained by the difference in the experimental design, since isolation of the pair from the

social group may suppress social stressors associated with territorial behavior. In our study,

subordinate females presented lower F levels than those of dominant females in the pre-

spawning phase, thus contradicting the common assumption that subordination is

associated with a higher stress degree. The higher F levels in pre-spawning females could

be explained by the stress response related to territorial behavior and dominance

demonstration towards conspecifics. In fact, data regarding F levels as a marker of stress

response in cichlids are not conclusive. A similar response to that of our study was

observed in males and females of the daffodil cichlid, Neolamprologus pulcher (Trewavas

& Poll, 1952), in which dominant fish showed higher F levels than subordinates, probably

due to the stress associated with the maintenance of social status (Mileva et al. 2009).

Conversely, Morandini et al. (2014) reported that territorial males of C. dimerus had lower

Page 20 of 48



Draft

21

levels of F than non-territorial males, while Ramallo et al. (2015) found no difference

between them. Finally and unlike our study, Alonso et al. (2011) recorded higher F levels in

non-territorial females than in territorial ones. Although variations in F levels could be

influenced by experimental designs, the relationship between F and social status is still

unclear and needs to be further explored.

In several teleost species, FSH was shown to be involved in the regulation of early

oogenesis, with mRNA levels increasing as vitellogenesis progresses; whereas LH is

responsible for final oocyte maturation and ovulation, with mRNA levels being very low or

undetectable during Vtg uptake and increasing just before maturation (Gomez et al. 1999;

Hassin et al. 1999; Sohn et al. 1999; Levavi-Sivan et al. 2010). In our study, β-lh

expression was higher in reproductive females than in non-reproductive ones (resting and

subordinate females). In addition, pre-spawning females exhibited an elevated β-lh

expression, which was coincident with the presence of mature oocytes in the ovary, and this

expression was significantly higher than in the other groups. In turn, no differences

between groups were evidenced in the expression of β-fsh. According to these results, we

speculate that LH is the key gonadotropin that regulates gametogenesis in female C.

dimerus, whereas FSH may not play an important role during oogenesis. Our results are

coincident with those reported for the African catfish, Clarias gariepinus (Burchell, 1822)

(Schulz et al. 1997) and the red seabream, Pagrus major (Temminck & Schlegel, 1843)

(Gen et al. 2003) in which β-LH mRNA was maintained at high levels from early

gametogenesis until the spawning season, while β-FSH mRNA levels remained low

throughout oocyte development.

Changes in gonadal aromatase (cyp19a1A) mRNA levels during oocyte growth and

maturation were reported in teleosts (Tanaka et al. 1992; Roy Moulik et al. 2016). Analysis

Page 21 of 48



Draft

22

of the sequence of gonadal and brain aromatase of cichlids revealed that these genes

contain several androgen response elements in addition to the estrogen response element in

the conserved upstream regions (Böhne et al. 2013). The positive non-linear correlation

between cyp19a1A expression and T levels found in female C. dimerus might reveal a

regulation of gonadal aromatase expression by T in this species. On the other hand, studies

using isolated follicles revealed low expression of cyp19a1A in early vitellogenic follicles,

elevated expression in late vitellogenic follicles and non-detectable in post-ovulatory

follicles (Chang et al. 1997; Gohin et al. 2011). In accordance with these observations, our

analyses showed a positive non-linear correlation between cyp19a1a expression and the

proportion of late vitellogenic oocytes (LVO) in the ovary of C. dimerus.

The expression of 3β-hydroxysteroid dehydrogenase (3β-hsd) in the ovary showed no

significant differences throughout C. dimerus reproductive cycle. This enzyme is located

fairly upstream in the steroidogenic pathway, so that it is involved in the synthesis of both

androgens and progestins. This may explain the rather uniform 3β-hsd expression observed

at different phases, unlike cyp19a1A, which is restricted to the production of estrogens and

showed shifts in its expression level along the cycle. In accordance with our results, no

variation of 3β-hsd expression was reported throughout the reproductive cycle of the

channel catfish, Ictalurus punctatus (Rafinesque, 1818) (Kumar et al. 2000). Also it should

be noted that steroid production could be regulated by modulation of the enzyme activity

and not of its de novo synthesis. Females in the resting phase had the lowest 3β-hsd

expression level, raising the possibility that enzymatic units respond to seasonal regulation,

whereas regulation during the reproductive period would depend on the enzymatic activity.

As a remarkable result of our study, subordinate females exhibited features indicative

of reproductive arrest. They presented small ovaries (low GSI) in which oogenesis did not

Page 22 of 48



Draft

23

surpass the early vitellogenic stage, and these gonadal features were in accordance with low

levels of sex steroids and the concomitant reduced levels of vtgAb and zpB expression. In

fact, subordinate females showed many similarities to females at the resting phase. It is

highly probable that the constant intimidation and attacks performed by fish of higher rank

within the aquarium caused an inhibition of the reproductive axis, thus impairing gonadal

development. A sort of “social contraceptive” effect in terms of immediate access to

reproduction has already been reported in subordinate males of C. dimerus (Ramallo et al.

2015). However, testes of lowest-ranked males still possessed every spermatogenic cell

type, which pointed for a still ongoing spermatozoa development. Thus, even though

dominant males were better suited for immediate reproduction, subordinate males still hold

reproductive potential (Ramallo et al. 2015). This seems not to be the situation of

subordinate females, who actually exhibited impaired oogenesis, thus indicating that the

effects exerted by conspecific aggression are more pronounced than in males. This

dissimilarity could be explained by the difference in the amount of energy required by the

gametogenic process in both sexes. Current research is ongoing in our laboratory in order to

analyze the dynamics of oogenesis reactivation and the endocrine and molecular processes

involved as subordinate females are transferred to a new environment in which they can

become territorial.

Connolly et al. (2014) analyzed the temporal dynamics of oocyte growth and vtg

expression in D. rerio. Differently from our findings, no correlation was evidenced between

the size of the ovary or its oocyte-stage composition and vtg expression in zebrafish.

Although C. dimerus and D. rerio both exhibit asynchronous ovarian development, they

differ in the pattern of ovulation and egg release. Sexually mature zebrafish can spawn in

the laboratory continuously all year at a frequency of two or three times a week (Eaton and

Page 23 of 48



Draft

24

Farley 1974). Evidence from the natural environment also shows that wild zebrafish spawn

every 2-3 days (Spence et al. 2007). Moreover, when optimal laboratory conditions are

provided, females can even spawn daily for a limited period of time (Spence and Smith

2005), thus characterizing zebrafish as a continuous spawner (Nasiadka and Clark 2012).

This is in accordance with the low relative changes in vtg expression observed at different

times after spawning, as well as the presence of all stages of oogenesis (including late

vitellogenic oocytes) at any time throughout the ovarian cycle (Connolly et al. 2014). Thus,

vitellogenesis in D. rerio appears to be a relatively steady process, differently from C.

dimerus, in which it shows cyclic changes that parallel fluctuations in E2 levels and

gonadal size. Another difference observed between both species is related to oocyte

regression; while in D. rerio follicular atresia is most common at the onset of vitellogenesis

(Connolly et al. 2014), our results indicate that atrectic follicles in C. dimerus are mainly

derived from late vitellogenic oocytes that are not ovulated.

In the present study, we observed a direct positive correlation between plasma E2,

vtgAb expression, LVO frequency and the GSI. All these parameters were maximum at the

pre-spawning phase and reached a peak on day 10 following spawning. At the pre-

spawning phase, high levels of T and an elevated cyp19a1A expression caused maximal E2

levels, which in turn induced vtgAb expression at the highest values. At 10 days ps, T levels

were lower than in the pre-spawning phase, but the higher cyp19a1A expression led to

similar E2 and vtgAb expression levels. In addition, ovarian histology of 10 day ps females

was quite comparable to that of pre-spawning females. The difference in gonadal weight

observed between these two phases, though not statistically significant, can be explained by

the slightly higher proportion of early vitellogenic oocytes and lower proportion of late

vitellogenic oocytes in 10 day ps ovaries, as compared to pre-spawning ones. These results

Page 24 of 48



Draft

25

indicate that female C. dimerus would be ready to spawn again after a 10-day period, which

in turn is coincident with the shortest time interval between successive spawns recorded

under laboratory conditions (Meijide, unpublished results).

In conclusion, we have provided a characterization of the whole reproductive cycle in

female C. dimerus, in which we could establish relationships between changes in gene

expression, plasma steroids and gonadal histology at distinct phases that included both the

reproductive and non-reproductive periods. In addition, we could contrast

morphophysiological parameters of subordinate and territorial females. In this way, our

study contributes to a broader understanding of the endocrine control of reproduction in

fishes.

Acknowledgements

This manuscript is a humble tribute to the memory of our colleague Jorge Osvaldo

Fernández Santos, a recognized ichthyologist from Argentina whose loss is mourned by all

the people lucky to have known him.

We thank Dr. B. Allner for donation of rabbit anti-perch Vtg antiserum and Dr. Di

Yorio for donation of β-fsh and β-lh primers. This work was supported by grants from

Universidad de Buenos Aires (UBACyT X056) and CONICET (PIP 1021).

References

Alonso, F., Cánepa, M., Guimarães Moreira, R., and Pandolfi, M. 2011. Social and

reproductive physiology and behavior of the Neotropical cichlid fish Cichlasoma

dimerus under laboratory conditions. Neotrop. Ichthyol. 9(3): 559-570.

doi:10.1590/S1679-62252011005000025.

Page 25 of 48



Draft

26

Babin, P.J., Carnevali, O., Lubzens, E., and Schneider, W.J. 2007. Molecular aspects of

oocyte vitellogenesis in fish. In The Fish Oocyte. From Basic Studies to

Biotechnological Applications. Edited by P.J. Babin, J. Cerda and E. Lubzens.

Springer, Dordrecht. pp. 39-76. doi:10.1007/978-1-4020-6235-3-2.

Birba, A., Ramallo, M.R., Lo Nostro, F., Guimarães Moreira, R., and Pandolfi, M. 2015.

Reproductive and parental care physiology of Cichlasoma dimerus males. Gen. Comp.

Endocrinol. 221: 193-200. doi:10.1016/j.ygcen.2015.02.004.

Böhne, A., Heule, C., Boileau, N., and Salzburger, W. 2013. Expression and sequence

evolution of aromatase cyp19a1 and other sexual development genes in east african

cichlid fishes. Mol. Biol. Evol. 30(10): 2268-2285. doi:10.1093/molbev/mst124.

Brodeur, J.C., Woodburn, K.B., and Klecka, G.M. 2005. Potentiation of the vitellogenic

response to 17alpha-ethinylestradiol by cortisol in the fathead minnow Pimephales

promelas. Environ. Toxicol. Chem. 24(5): 1125-1132.

Canadian Council on Animal Care. 2005. Guidelines on the Care and the Use of Fish in

Research, Teaching and Testing. 87 pp. ISBN: 0-919087-43-4. Available from

http://www.ccac.ca/Documents/Standards/Guidelines/Fish.pdf.

Celius, T., and Walther, B.T. 1998. Oogenesis in Atlantic salmon (Salmo salar L.) occurs

by zonagenesis preceding vitellogenesis in vivo and in vitro. J. Endocrinol. 158(2):

259-266. doi:10.1677/joe.0.1580259.

Cerdá-Reverter, J.M., and Canosa, L.F. 2009. Chapter 1 Neuroendocrine Systems of the

Fish Brain. Fish Neuroendocrinol. 28(09): 3-74. doi:http://dx.doi.org/10.1016/S1546-

5098(09)28001-0.

Chang, X., Kobayashi, T., Senthilkumaran, B., Kobayashi-Kajura, H., Sudhakumari, C.C.,

and Nagahama, Y. 2005. Two types of aromatase with different encoding genes, tissue

Page 26 of 48



Draft

27

distribution and developmental expression in Nile tilapia (Oreochromis niloticus).

Gen. Comp. Endocrinol. 141(2): 101-115. doi:10.1016/j.ygcen.2004.11.020.

Chang, X.T., Kobayashi, T., Kajiura, H., Nakamura, M., and Nagahama, Y. 1997. Isolation

and characterization of the cDNA encoding the tilapia (Oreochromis niloticus)

cytochrome P450 aromatase (P450arom): changes in P450arom mRNA, protein and

enzyme activity in ovarian follicles during oogenesis. J. Mol. Endocrinol. 18(1): 57-

66. doi:10.1677/jme.0.0180057.

Connolly, M.H., Dutkosky, R.M., Heah, T.P., Sayker, G.S., and Henry, T.B. 2014.

Temporal dynamics of oocyte growth and vitellogenin gene expression in zebrafish

(Danio rerio). Zebrafish, 11(2): 107-114. doi:10.1089/zeb.2013.0938.

Corriero, A., Acone, F., Desantis, S., Zubani, D., Deflorio, M., Ventriglia, G., Bridges,

C.R., Labate, M., Palmieri, G., McAllister, B.G., Kime, D.E., and De Metrio, G. 2004.

Histological and immunohistochemical investigation on ovarian development and

plasma estradiol levels in the swordfish (Xiphias gladius L.). Eur. J. Histochem. 48(4):

413-422.

Costa Melo, R.M., Martins, Y.S., de Alencar Teixeira, E., Luz, R.K., Rizzo, E., and

Bazzoli, N. 2014. Morphological and quantitative evaluation of the ovarian

recrudescence in Nile Tilapia (Oreochromis niloticus) after spawning in captivity. J.

Morphol. 275: 348-356. doi:10.1002/jmor.20214.

Da Cuña, R.H., Rey Vázquez, G., Dorelle, L., Rodríguez, E.M., Guimarães Moreira, R.,

and Lo Nostro, F.L. 2016. Mechanism of action of endosulfan as disruptor of gonadal

steroidogenesis in the cichlid fish Cichlasoma dimerus. Comp. Biochem. Physiol. C

187: 74-80. doi:10.1016/j.cbpc.2016.05.008.

Da Cuña, R.H., Pandolfi, M., Genovese, G., Piazza, Y., Ansaldo, M., and Lo Nostro, F.L.

Page 27 of 48



Draft

28

2013. Endocrine disruptive potential of endosulfan on the reproductive axis of

Cichlasoma dimerus (Perciformes, Cichlidae). Aquat. Toxicol. 126: 299-305.

doi:10.1016/j.aquatox.2012.09.015.

Di Yorio, M.P., Delgadin, T.H., Pérez Sirkin, D.I., and Vissio, P.G. 2015. Growth

hormone, luteinizing hormone, and follicle-stimulating hormone regulation by

neuropeptide Y in both sexes of the cichlid fish, Cichlasoma dimerus. Fish Physiol.

Biochem. 41(4): 843-852. doi:10.1007/s10695-015-0051-z.

Eaton, R.C., and Farley, R.D. 1974. Growth and reduction of depensation of the zebrafish,

Brachydanio rerio, reared in the laboratory. Copeia, 1: 204-209. doi:

10.2307/1443024.

Finn, R.N., Kolarevic, J., Kongshaug, H., and Nilsen, F. 2009. Evolution and differential

expression of a vertebrate vitellogenin gene cluster. BMC Evol. Biol. 9: 2.

doi:10.1186/1471-2148-9-2.

Gen, K., Yamaguchi, S., Okuzawa, K., Kumakura, N., Tanaka, H., and Kagawa, H. 2003.

Physiological roles of FSH and LH in red seabream, Pagrus major. Fish Physiol.

Biochem. 28(1-4): 77-80. doi:10.1023/B:FISH.0000030480.97947.ba.

Genovese, G., Regueira, M., Da Cuña, R.H., Ferreira, M.F., Varela, M.L., and Lo Nostro,

F.L. 2014. Nonmonotonic response of vitellogenin and estrogen receptor α gene

expression after octylphenol exposure of Cichlasoma dimerus (Perciformes,

Cichlidae). Aquat. Toxicol. 156: 30-40. doi:10.1016/j.aquatox.2014.07.019.

Genovese, G., Regueira, M., Piazza, Y., Towle, D.W., Maggese, M.C., and Lo Nostro, F.

2012. Time-course recovery of estrogen-responsive genes of a cichlid fish exposed to

waterborne octylphenol. Aquat. Toxicol. 114-115: 1-13.

doi:10.1016/j.aquatox.2012.02.005.

Page 28 of 48



Draft

29

Genovese, G., Da Cuña, R., Towle, D.W., Maggese, M.C., and Lo Nostro, F. 2011. Early

expression of zona pellucida proteins under octylphenol exposure in Cichlasoma

dimerus (Perciformes, Cichlidae). Aquat. Toxicol. 101(1): 175-185.

doi:10.1016/j.aquatox.2010.09.017.

Gohin, M., Bodinier, P., Fostier, A., Chesnel, F., and Bobe, J. 2011. Aromatase is

expressed and active in the rainbow trout oocyte during final oocyte maturation. Mol.

Reprod. Dev. 78(7): 510-518. doi:10.1002/mrd.21335.

Gomez, J.M., Weil, C., Ollitrault, M., Le Bail, P.Y., Breton, B., and Le Gac, F. 1999.

Growth hormone (GH) and gonadotropin subunit gene expression and pituitary and

plasma changes during spermatogenesis and oogenesis in rainbow trout

(Oncorhynchus mykiss). Gen. Comp. Endocrinol. 113(3): 413-428.

doi:10.1006/gcen.1998.7222.

Goudet, G., Mugnier, S., Callebaut, I., and Monget, P. 2008. Phylogenetic analysis and

identification of pseudogenes reveal a progressive loss of zona pellucida genes during

evolution of vertebrates. Biol. Reprod. 78(5): 796-806.

doi:10.1095/biolreprod.107.064568.

Grier, H.J., Uribe Aranzabal, M.C., and Patino, R. 2009. The ovary, folliculogenesis and

oogenesis in teleosts. In Reproductive Biology and Phylogeny of Fishes (Agnathans

and Bony Fishes): Phylogeny, Reproductive System, Viviparity, Spermatozoa. Edited

by B.G.M. Jamiesom. Science Publishers, Enfield. pp. 25-84.

Hassin, S., Claire, M., Holland, H., and Zohar, Y. 1999. Ontogeny of follicle-stimulating

hormone and luteinizing hormone gene expression during pubertal development in the

female striped bass, Morone saxatilis (Teleostei). Biol. Reprod. 61(6): 1608-1615. doi:

10.1095/biolreprod61.6.1608.

Page 29 of 48



Draft

30

Hiramatsu, N., Todo, T., Sullivan, C. V., Schilling, J., Reading, B.J., Matsubara, T., Ryu,

Y.W., Mizuta, H., Luo, W., Nishimiya, O., Wu, M., Mushirobira, Y., Yilmaz, O., and

Hara, A. 2015. Ovarian yolk formation in fishes: Molecular mechanisms underlying

formation of lipid droplets and vitellogenin-derived yolk proteins. Gen. Comp.

Endocrinol. 221: 9-15. doi:10.1016/j.ygcen.2015.01.025.

Huffman, L.S., O’Connell, L.A., and Hofmann, H.A. 2013. Aromatase regulates aggression

in the African cichlid fish Astatotilapia burtoni. Physiol. Behav. 112-113: 77-83.

doi:10.1016/j.physbeh.2013.02.004.

Hyllner, S.J., Silversand, C., and Haux, C. 1994. Formation of the vitelline envelope

precedes the active uptake of vitellogenin during oocyte development in the rainbow

trout, Oncorhynchus mykiss. Mol. Reprod. Dev. 39(2): 166-175.

doi:10.1002/mrd.1080390208.

Kobayashi, Y., Kobayashi, T., Nakamura, M., Sunobe, T., Morrey, C.E., Suzuki, N., and

Nagahama, Y. 2004. Characterization of two types of cytochrome P450 aromatase in

the serial-sex changing gobiid fish, Trimma okinawae. Zool. Sci. 21(4): 417-425.

doi:10.2108/zsj.21.417.

Kudo, N., Miura, T., Miura, C., and Yamauchi, K. 2000. Expression and localization of eel

testicular ZP-homologues in female Japanese eels (Anguilla japonica). Zool. Sci.

17(9): 1297-1302. doi:10.2108/zsj.17.1297.

Kumar, R.S., Ijiri, S., and Trant, J.M. 2000. Changes in the expression of genes encoding

steroidogenic enzymes in the channel catfish (Ictalurus punctatus) ovary throughout a

reproductive cycle. Biol. Reprod. 63(6): 1676-1682. doi:

10.1095/biolreprod63.6.1676.

Le Menn, F., Cerdà, J., and Babin, P.J. 2007. Ultrastructural aspects of the ontogeny and

Page 30 of 48



Draft

31

differentiation of ray-finned fish ovarian follicles. In The Fish Oocyte. From Basic

Studies to Biotechnological Applications. Edited by P.J. Babin, J. Cerda and E.

Lubzens. Springer, Dordrecht. pp. 1-37. doi:10.1007/978-1-4020-6235-3-1

Levavi-Sivan, B., Bogerd, J., Mañanós, E.L., Gómez, A., and Lareyre, J.J. 2010.

Perspectives on fish gonadotropins and their receptors. Gen. Comp. Endocrinol.

165(3): 412-437. doi:10.1016/j.ygcen.2009.07.019.

Lowry, O.H., Rosebrough, N.J., Farr, A.L., and Randall, R.J. 1951. Protein measurement

with the Folin phenol reagent. J. Biol. Chem. 193(1): 265-275. doi:10.1016/0304-

3894(92)87011-4.

Lubzens, E., Young, G., Bobe, J., and Cerdà, J. 2010. Oogenesis in teleosts: How fish eggs

are formed. Gen. Comp. Endocrinol. 165(3): 367-389.

doi:10.1016/j.ygcen.2009.05.022.

Meijide, F.J., and Guerrero, G.A. 2000. Embryonic and larval development of a substrate-

brooding cichlid Cichlasoma dimerus (Heckel, 1840) under laboratory conditions. J.

Zool. (Lond.) 252(4): 481-493. doi:10.1017/S0952836900000248.

Meijide, F.J., Rey Vázquez, G., Grier, H.J., Lo Nostro, F.L., and Guerrero, G.A. 2016.

Development of the germinal epithelium and early folliculogenesis during ovarian

morphogenesis in the cichlid fish Cichlasoma dimerus (Teleostei, Perciformes). Acta

Zool. 97: 18-33. doi:10.1111/azo.12101.

Mileva, V.R., Fitzpatrick, J.L., Marsh-Rollo, S., Gilmour, K.M., Wood, C.M., and

Balshine, S. 2009. The stress response of the highly social African cichlid

Neolamprologus pulcher. Physiol. Biochem. Zool. 82(6): 720-729.

doi:10.1086/605937.

Modig, C., Westerlund, L., and Olsson, P.E. 2007. Oocyte zona pellucida proteins. In The

Page 31 of 48



Draft

32

Fish Oocyte. From Basic Studies to Biotechnological Applications. Edited by P.J.

Babin, J. Cerda and E. Lubzens. Springer, Dordrecht. pp. 113-139. doi:10.1007/978-1-

4020-6235-3-5

Modig, C., Modesto, T., Canario, A., Cerdà, J., von Hofsten, J., and Olsson, P.-E. 2006.

Molecular characterization and expression pattern of zona pellucida proteins in

gilthead seabream (Sparus aurata). Biol. Reprod. 75(5): 717-25.

doi:10.1095/biolreprod.106.050757.

Moncaut, N., Nostro, F. Lo, and Maggese, M.C. 2003. Vitellogenin detection in surface

mucus of the South American cichlid fish Cichlasoma dimerus (Heckel, 1840) induced

by estradiol-17β. Effects on liver and gonads. Aquat. Toxicol. 63(2): 127-137.

doi:10.1016/S0166-445X(02)00175-3.

Morandini, L., Honji, R.M., Ramallo, M.R., Guimarães Moreira, R., and Pandolfi, M. 2014.

The interrenal gland in males of the cichlid fish Cichlasoma dimerus: Relationship

with stress and the establishment of social hierarchies. Gen. Comp. Endocrinol. 195:

88-98. doi:10.1016/j.ygcen.2013.10.009.

Murua, H., and Saborido-Rey, F. 2003. Female Reproductive Strategies of Marine Fish

Species of the North Atlantic. J. Northwest Atl. Fish. Sci. 33: 23-31.

doi:10.2960/J.v33.a2.

Nasiadka, A., and Clark, M.D. 2012. Zebrafish breeding in the laboratory environment.

ILAR J. 53(2): 161-168. doi:10.1093/ilar.53.2.161.

Nakamura, I., Kusakabe, M., and Young, G. 2003. Regulation of steriodogenic enzyme

mRNAs in rainbow trout (Oncorhynchus mykiss) ovarian follicles in vitro. Fish

Physiol. Biochem. 28(1-4): 355-356. doi:10.1023/B:FISH.0000030586.74085.0f.

Nelson, E.R., and Habibi, H.R. 2013. Estrogen receptor function and regulation in fish and

Page 32 of 48



Draft

33

other vertebrates. Gen. Comp. Endocrinol. 192: 15-24.

doi:10.1016/j.ygcen.2013.03.032.

Pandolfi, M., Canepa, M.M., Meijide, F.J., Alonso, F., Vazquez, G.R., Maggese, M.C., and

Vissio, P.G. 2009a. Studies on the reproductive and developmental biology of

Cichlasoma dimerus (Percifomes, Cichlidae). Biocell, 33(1): 1-18.

Pandolfi, M., Pozzi, A.G., Cánepa, M., Vissio, P.G., Shimizu, A., Maggese, M.C., and

Lobo, G. 2009b. Presence of β-follicle-stimulating hormone and β-luteinizing

hormone transcripts in the brain of Cichlasoma dimerus (Perciformes: Cichlidae):

Effect of brain-derived gonadotropins on pituitary hormone release.

Neuroendocrinology, 89(1): 27-37. doi:10.1159/000152833.

Pereira, T.S.B., Guimarães Moreira, R., and Batlouni, S.R. 2013. Dynamics of ovarian

maturation during the reproductive cycle of Metynnis maculatus, a reservoir invasive

fish species (teleostei: Characiformes). Neotrop. Ichthyol. 11(4): 821-830.

doi:10.1590/S1679-62252013000400010.

Piazza, Y., Pandolfi, M., Da Cuña, R., Genovese, G., and Lo Nostro, F. 2015. Endosulfan

affects GnRH cells in sexually differentiated juveniles of the perciform Cichlasoma

dimerus. Ecotoxicol. Environ. Saf. 116: 150-159. doi:10.1016/j.ecoenv.2015.03.013.

Polzonetti-Magni, A.M., Mosconi, G., Soverchia, L., Kikuyama, S., and Carnevali, O.

2004. Multihormonal control of vitellogeneis in lower vertebrates. Int. Rev. Cytol.

239: 1-46. doi:10.1016/S0074-7696(04)39001-7.

Ramallo, M.R., Birba, A., Honji, R.M., Morandini, L., Guimarães Moreira, R., Somoza,

G.M., and Pandolfi, M. 2015. A multidisciplinary study on social status and the

relationship between inter-individual variation in hormone levels and agonistic

behavior in a Neotropical cichlid fish. Horm. Behav. 69: 139-151.

Page 33 of 48



Draft

34

doi:10.1016/j.yhbeh.2015.01.008.

Ramallo, M.R., Morandini, L., Alonso, F., Birba, A., Tubert, C., Fiszbein, A., and Pandolfi,

M. 2014. The endocrine regulation of cichlids social and reproductive behavior

through the eyes of the chanchita, Cichlasoma dimerus (Percomorpha; Cichlidae). J.

Physiol. Paris 108(2): 194-202. doi:10.1016/j.jphysparis.2014.08.004.

Ramallo, M.R., Grober, M., Cánepa, M.M., Morandini, L., and Pandolfi, M. 2012.

Arginine-vasotocin expression and participation in reproduction and social behavior in

males of the cichlid fish Cichlasoma dimerus. Gen. Comp. Endocrinol. 179(2): 221-

231. doi:10.1016/j.ygcen.2012.08.015.

Rey Vázquez, G., Da Cuña, R.H., Meijide, F.J., and Guerrero, G.A. 2012. Spermatogenesis

and changes in testicular structure during the reproductive cycle in Cichlasoma

dimerus (Teleostei, Perciformes). Acta Zool. 93(3): 338-350. doi:10.1111/j.1463-

6395.2011.00508.x.

Rey Vázquez, G., Meijide, F.J., Da Cuña, R.H., Lo Nostro, F.L., Piazza, Y.G., Babay, P.A.,

Trudeau, V.L., Maggese, M.C., and Guerrero, G.A. 2009. Exposure to waterborne 4-

tert-octylphenol induces vitellogenin synthesis and disrupts testis morphology in the

South American freshwater fish Cichlasoma dimerus (Teleostei, Perciformes). Comp.

Biochem. Physiol. C 150(2): 298-306. doi:10.1016/j.cbpc.2009.05.012.

Rocha, M.J., and Reis-Henriques, M.A. 1996. Plasma and urine levels of C sub(18), C

sub(19) and C sub(21) steroids in an asynchronous fish, the tilapia Oreochromis

mossambicus (Teleostei, Cichlidae). Comp. Biochem. Physiol. C 115(3): 257-264.

doi:10.1016/S0742-8413(96)00133-8

Roy Moulik, S., Pal, P., Majumder, S., Mallick, B., Gupta, S., Guha, P., Roy, S., and

Mukherjee, D. 2016. Gonadotropin and sf-1 regulation of cyp19a1a gene and

Page 34 of 48



Draft

35

aromatase activity during oocyte development in the rohu, L. rohita. Comp. Biochem.

Physiol. A 196: 1-10. doi:10.1016/j.cbpa.2016.02.004.

Schulz, R.W., Zandbergen, M.A., Peute, J., Bogerd, J., van Dijk, W., and Goos, H.J. 1997.

Pituitary gonadotrophs are strongly activated at the beginning of spermatogenesis in

African catfish, Clarias gariepinus. Biol. Reprod. 57(1): 139-147.

doi:10.1095/biolreprod57.1.139.

Sohn, Y.C., Yoshiura, Y., Kobayashi, M., and Aida, K. 1999. Seasonal changes in mRNA

levels of gonadotropin and thyrotropin subunits in the goldfish, Carassius auratus.

Gen. Comp. Endocrinol. 113(3): 436-44. doi:10.1006/gcen.1998.7224.

Spargo, S., and Hope, R. 2003. Evolution and nomenclature of the zona pellucida gene

family. Biol. Reprod. 68(2): 358-362. doi: 10.1095/biolreprod.102.008086.

Specker, J.L., and Kishida, M. 2000. Mouthbrooding in the black-chinned tilapia,

Sarotherodon melanotheron (Pisces: Cichlidae): The presence of eggs reduces

androgen and estradiol levels during paternal and maternal parental behavior. Horm.

Behav. 38(1): 44-51. doi:10.1006/hbeh.2000.1601.

Spence, R, and Smith, C. 2005. Male territoriality mediates density and sex ratio effects on

oviposition in the zebrafish, Danio rerio. Anim. Behav. 69(6): 1317-1323. doi:

10.1016/j.anbehav.2004.10.010.

Spence, R., Ashton, R., and Smith, C. 2007. Oviposition decisions are mediated by

spawning site quality in wild and domesticated zebrafish, Danio rerio. Behaviour,

144(8): 953-966. doi:10.1163/156853907781492726.

Tanaka, M., Telecky, T.M., Fukada, S., Adachi, S., Chen, S., and Nagahama, Y. 1992.

Cloning and sequence analysis of the cDNA encoding P-450 aromatase (P450arom)

from a rainbow trout (Oncorhynchus mykiss) ovary; relationship between the amount

Page 35 of 48



Draft

36

of P450arom mRNA and the production of oestradiol-17β in the ovary. J. Mol.

Endocrinol. 8(1): 53-61. doi:10.1677/jme.0.0080053.

Taves, M.D., Desjardins, J.K., Mishra, S., and Balshine, S. 2009. Androgens and

dominance: Sex-specific patterns in a highly social fish (Neolamprologus pulcher).

Gen. Comp. Endocrinol. 161(2): 202-207. doi:10.1016/j.ygcen.2008.12.018.

Tubert, C., Lo Nostro, F., Villafañe, V., and Pandolfi, M. 2012. Aggressive behavior and

reproductive physiology in females of the social cichlid fish Cichlasoma dimerus.

Physiol. Behav. 106(2): 193-200. doi:10.1016/j.physbeh.2012.02.002.

Tyler, C.R., and Sumpter, J.P. 1996. Oocyte growth and development in teleosts. Rev. Fish

Biol. Fish. 6(3): 287-318. doi:10.1007/BF00122584.

Van Der Kraak, G. 2009. The GnRH System and the Neuroendocrine Regulation of

Reproduction. In Fish Physiology, vol. 28. Fish Neuroendocrinology. Edited by N.J.

Bernier, G.Van Der Kraak, A.P.Farrell and C.J. Brauner. Academic Press, Burlington.

pp. 115-149. doi:10.1016/S1546-5098(09)28003-4.

Wallace, R.A., and Selman, K. 1981. Cellular and Dynamic Aspects of Oocyte Growth in

Teleosts. Am. Zool. 21(2): 325-343. doi: 10.1093/icb/21.2.325.

Wallace, R.A., and Selman, K. 1980. Oogenesis in Fundulus heteroclitus II. The transition

from vitellogenesis into maturation. Gen. Comp. Endocrinol. 42(3): 345-354.

doi:10.1016/0016-6480(80)90165-3.

Yang, C.G., Wang, X.L., Tian, J., Liu, W., Wu, F., Jiang, M., and Wen, H. 2013.

Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene

expression in Nile tilapia (Oreochromis niloticus). Gene, 527(1): 183-192.

doi:10.1016/j.gene.2013.06.013.

Yost, E.E., Lee Pow, C., Hawkins, M.B., and Kullman, S.W. 2014. Bridging the gap from

Page 36 of 48



Draft

37

screening assays to estrogenic effects in fish: Potential roles of multiple estrogen

receptor subtypes. Environ. Sci. Technol. 48(9): 5211-5219. doi:10.1021/es404093n.

Zohar, Y., Muñoz-Cueto, J.A., Elizur, A., and Kah, O. 2010. Neuroendocrinology of

reproduction in teleost fish. Gen. Comp. Endocrinol. 165(3): 438-455.

doi:10.1016/j.ygcen.2009.04.017.

Page 37 of 48



Draft

38

Table 1. Primers designed for gene expression analysis in female Cichlasoma dimerus,

based on sequences published in GenBank and unpublished data.

Gen name

GenBank

accession

No.

Forward (5’-3’) Reverse (5’-3’)

Vitellogenin Ab EU081907.1 GGCGTCTCTACAACTGTGCT TCCAAGCCGATGTCCTTCAC

Zona pellucida protein B EU081905.1 CAGAAACGCCACTCTACCCAACA TCCTCCTCTTCAATGCAACCCT

Luteinizing hormone

β subunit EU315919.1 ACACTGCATCACCAAGGAC ACAGTCGGGAAGCTCAAATG

Follicle stimulating

hormone β subunit EU315918.1 GTGAAGGACAGTGCTACCAG GGACATCGCTCTGTGTACTTC

Cyp19a1A Gonadal

aromatase Unpublished GCGTGCTGGAGATGGTGAT TGCATTCGGCCTGTGTTCA

3β-hydroxysteroid

dehydrogenase/isomerase Unpublished TTCATACGCATCATCCCGCC CCCAGCTGTATTTGGGGACA

β-actin EU158257.1 GCTGTCCCTGTATGCCTCTG CGAGGAAGGAAGGCTGGAAG

Page 38 of 48



Draft

39

Table 2. Stages of oogenesis in Cichlasoma dimerus.

Stage Histological characteristics

Chromatin-nucleolus

The cytoplasm is translucent, chromosome threads are visible within the

nucleoplasm.

Perinucleolar

The cytoplasm becomes highly basophilic, multiple nucleoli are

observed in the peripheral nucleoplasm.

Cortical alveolar

Cytoplasm basophilia decreases, cortical alveoli appear in the peripheral

cytoplasm, a thin zona pellucida is observed.

Early vitellogenic

Cortical alveoli increase in number, oil droplets are visible, round yolk

vesicles are incorporated from the periphery to the center but do not

occupy all the cytoplasm, the zona pellucida becomes thicker.

Mid vitellogenic

Larger, round yolk vesicles occupy the whole cytoplasm, thickness of

the zona pellucida augments.

Late vitellogenic

Poliedric yolk vesicles of maximal size occupy the whole cytoplasm, the

zona pellucida attains its maximal thickness and becomes striated.

Mature

The oocyte reaches its maximal size, the nucleus becomes polarized

towards the animal pole.

Page 39 of 48



Draft

40

Figure captions

Figure 1. Gonadosomatic (GSI) and hepatosomatic (HSI) indexes (%) at each phase of the

reproductive cycle in female Cichlasoma dimerus. Bars represent the mean + standard

error. Different letters indicate significant differences (p<0.05). n=4-5 per phase.

Figure 2. Levels of plasmatic steroids (ng/mL) at each phase of the reproductive cycle in

female Cichlasoma dimerus. Bars represent the mean + standard error. Different letters

indicate significant differences (p<0.05). n=4-5 per phase.

Figure 3. Relative gene expression (optic density, o.d.) recorded at each phase of the

reproductive cycle in female Cichlasoma dimerus. The genes analyzed were vitellogenin

Ab (vtgAb), zona pellucida protein B (zpB), β subunit of luteinizing hormone (β-lh), β

subunit of follicle stimulating hormone (β-fsh), gonadal aromatase (cyp19a1A) and 3β-

hydroxysteroid dehydrogenase (3β-hsd). Values were determined by densitometric analysis

of PCR products relative to β-actin. Bars represent the mean + standard error. Different

letters indicate significant differences (p<0.05). n=4-5 per phase.

Figure 4. Immunodetection of vitellogenin (A) and zona pellucida protein (B) in plasma

samples of female Cichlasoma dimerus at each phase of the reproductive cycle. Western

blot analysis using an anti-perch Vtg primary antiserum and an anti-salmon ZP primary

antibody. Each lane represents the plasma of a representative fish. Numbers on the side

represent molecular weight in kilodaltons (kDa). Replacement of the primary antiserum by

TTBS resulted in the suppression of immunoreactivity (not shown).

Figure 5. Histological sections of the ovary of Cichlasoma dimerus at each phase of the

reproductive cycle. A representative cross section corresponding to each phase is shown. A.

Resting; B. Subordinate; C. Pre-spawning; D. 30 h post-spawning (ps); E. 4 days ps; F. 10

days ps. A: atretic follicle; CA: cortical alveoli oocyte; CN: chromatin-nucleolus oocyte;

Page 40 of 48



Draft

41

EV: early vitellogenic oocyte; LV: late vitellogenic oocyte; M: mature oocyte (with

polarized germinal vesicle); MC: melano macrophagic center; MV: mid vitellogenic

oocyte; PN: perinucleolar oocyte; POF: post-ovulatory follicle. Staining: hematoxylin-eosin

(A, C, F); PAS (B, D, E). Scale bars: 100 µm (A, B, D, E), 200 µm (C, F).

Figure 6. Percentage of oocyte development stages recorded at each phase of the

reproductive cycle in female Cichlasoma dimerus. CN, chromatin-nucleolus oocyte; PN:

perinucleolar oocyte; CA: cortical alveoli oocyte; EV: early vitellogenic oocyte; LV: late

vitellogenic oocyte; MV: mid vitellogenic oocyte; M: mature oocyte (with polarized

germinal vesicle). Dotted and grey backgrounds represent pre-vitellogenic oocyte stages

and vitellogenic oocyte stages, respectively. Bars represent the mean + standard error. n=4-

5 per phase.

Figure 7. Correlations between reproductive parameters in female Cichlasoma dimerus.

A. GSI vs. E2; B. GSI vs. T; C. E2 vs. LVO; D. GSI vs. LVO; E. vtgAb vs. E2; F. vtgAb

vs.LVO; G. vtgAb vs. GSI; H. T vs. cyp19a1A; I. LVO vs. cyp19a1A. A-G. Pearson’s

correlations; H-I. Spearman’s correlations. GSI: gonadosomatic index (%); E2: plasmatic

levels of estradiol (ng/mL); T: plasmatic levels of testosterone (ng/mL); LVO: percentage

of late vitellogenic oocytes (%); vtgAb: vtgAb relative gene expression (o.d.); cyp19a1A:

cyp19a1A relative gene expression (o.d.).

Page 41 of 48



Draft

Gonadosomatic (GSI) and hepatosomatic (HSI) indexes (%) at each phase of the reproductive cycle in female Cichlasoma dimerus. Bars represent the mean + standard error. Different letters indicate significant

differences (p<0.05). n=4-5 per phase.

175x259mm (300 x 300 DPI)

Page 42 of 48



Draft

Levels of plasmatic steroids (ng/mL) at each phase of the reproductive cycle in female Cichlasoma dimerus. Bars represent the mean + standard error. Different letters indicate significant differences (p<0.05). n=4-5

per phase.

117x231mm (300 x 300 DPI)

Page 43 of 48



Draft

Relative gene expression (optic density, o.d.) recorded at each phase of the reproductive cycle in female Cichlasoma dimerus. The genes analyzed were vitellogenin Ab (vtgAb), zona pellucida protein B (zpB), β

subunit of luteinizing hormone (β-lh), β subunit of follicle stimulating hormone (β-fsh), gonadal aromatase

(cyp19a1a) and 3β-hydroxysteroid dehydrogenase (3β-hsd). Values were determined by densitometric analysis of PCR products relative to β-actin. Bars represent the mean + standard error. Different letters

indicate significant differences (p<0.05). n=4-5 per phase.

209x272mm (300 x 300 DPI)

Page 44 of 48



Draft

Immunodetection of vitellogenin (A) and zona pellucida protein (B) in plasma samples of female Cichlasoma dimerus at each phase of the reproductive cycle. Western blot analysis using an anti-perch Vtg primary antiserum and an anti-salmon ZP primary antibody. Each lane represents the plasma of a representative

fish. Numbers on the side represent molecular weight in kilodaltons (kDa). Replacement of the primary antiserum by TTBS resulted in the suppression of immunoreactivity (not shown).

110x168mm (300 x 300 DPI)

Page 45 of 48



Draft

Histological sections of the ovary of Cichlasoma dimerus at each phase of the reproductive cycle. A representative cross section corresponding to each phase is shown. A. Resting; B. Subordinate; C. Pre-spawning; D. 30 h post-spawning (ps); E. 4 days ps; F. 10 days ps. A: atretic follicle; CA: cortical alveoli

oocyte; CN: chromatin-nucleolus oocyte; EV: early vitellogenic oocyte; LV: late vitellogenic oocyte; M: mature oocyte (with polarized germinal vesicle); MC: melano macrophagic center; MV: mid vitellogenic

oocyte; PN: perinucleolar oocyte; POF: post-ovulatory follicle. Staining: hematoxylin-eosin (A, C, F); PAS (B, D, E). Scale bars: 100 µm (A, B, D, E), 200 µm (C, F).

233x322mm (300 x 300 DPI)

Page 46 of 48



Draft

Percentage of oocyte development stages recorded at each phase of the reproductive cycle in female Cichlasoma dimerus. CN, chromatin-nucleolus oocyte; PN: perinucleolar oocyte; CA: cortical alveoli oocyte; EV: early vitellogenic oocyte; LV: late vitellogenic oocyte; MV: mid vitellogenic oocyte; M: mature oocyte

(with polarized germinal vesicle). Dotted and grey backgrounds represent pre-vitellogenic oocyte stages and vitellogenic oocyte stages, respectively. Bars represent the mean + standard error. n=4-5 per phase.

83x225mm (300 x 300 DPI)

Page 47 of 48



Draft

Correlations between reproductive parameters in female Cichlasoma dimerus � �. A. GSI vs. E2; B. GSI vs. T; C. E2 vs. LVO; D. GSI vs. LVO; E. vtgAb vs. E2; F. vtgAb vs.LVO; G. vtgAb vs. GSI; H. T vs. cyp19a1A; I. LVO vs. cyp19a1A. A-G. Pearson’s correlations; H-I. Spearman’s correlations. GSI: gonadosomatic index

(%); E2: plasmatic levels of estradiol (ng/mL); T: plasmatic levels of testosterone (ng/mL); LVO: percentage of late vitellogenic oocytes (%); vtgAb: vtgAb relative gene expression (o.d.); cyp19a1A:

cyp19a1A � �relative gene expression (o.d.).

208x153mm (300 x 300 DPI)

Page 48 of 48



Draft - University of Toronto T-Space · Draft 4 before the active uptake of Vtg, i.e. zonagenesis...

Documents

Transcript of Draft - University of Toronto T-Space · Draft 4 before the active uptake of Vtg, i.e. zonagenesis...