Draft - University of Toronto T-Space · Draft 2 Abstract The water-borne Gram-negative bacterium...

Draft

Role of the LuxR family transcriptional regulator Lpg2524 in

the survival of Legionella pneumophila in water

Journal: Canadian Journal of Microbiology

Manuscript ID cjm-2016-0780.R1

Manuscript Type: Article

Date Submitted by the Author: 02-Mar-2017

Complete List of Authors: Li, Laam; McGill University, Department of Natural Resource Sciences Faucher, Sébastien; McGill University, Natural Resource Sciences

Keyword: <i>Legionella pneumophila</i>, freshwater, survival, LuxR family protein, cell density

https://mc06.manuscriptcentral.com/cjm-pubs

Canadian Journal of Microbiology

Draft

1

Role of the LuxR family transcriptional regulator Lpg2524 in the survival of Legionella

pneumophila in water

Laam Li1 and Sébastien P. Faucher

1*

1) Department of Natural Resource Sciences, Faculty of Agricultural and Environmental

Sciences, McGill University, Montreal, QC, Canada.

* Corresponding author

Address: 21,111 Lakeshore Road, Ste-Anne-de-Bellevue, Montreal, QC, Canada, H9X 3V9.

Email: [email protected]

Tel: 514-398-7886

Fax: 514-398-7990

Page 1 of 35



Draft

2

Abstract

The water-borne Gram-negative bacterium Legionella pneumophila (Lp) is the causative agent of

Legionnaires’ disease. Lp is typically transmitted to human from water systems, where it grows

inside amoebae. Survival of Lp in water is central to its transmission to humans. A transcriptomic

study previously identified many genes induced by Lp in water. One of such gene, lpg2524,

encodes a putative LuxR family transcriptional regulator. It was hypothesized that this gene

could be involved in the survival of Lp in water. Deletion of lpg2524 does not affect the growth

of Lp in rich medium, in the amoeba Acanthamoeba castellanii or in human macrophage-like

THP-1 cells, showing that Lpg2524 is not required for growth in vitro and in vivo. Nevertheless,

deletion of lpg2524 results in a faster CFU reduction in an artificial freshwater medium, Fraquil,

indicating that Lpg2524 is important for Lp to survive in water. Over-expression of Lpg2524 also

results in a survival defect, suggesting that a precise level of this transcriptional regulator is

essential for its function. However, our result shows that Lpg2524 is dispensable for survival in

water when Lp is at a high cell density (109 CFU ml

-1), suggesting that its regulon is regulated by

another regulator activated at high cell density.

Key words: Legionella pneumophila, freshwater, survival, LuxR family protein, cell density

Page 2 of 35



Draft

3

Résumé

La bactérie Gram-négative Legionella pneumophila (Lp) est l’agent étiologique de la maladie du

Légionnaire. Lp est transmis à l’humain à partir de systèmes hydriques dans lesquels il se

multiplie à l’intérieur d’amibes. La survie de Lp dans l’eau est essentielle à sa transmission à

l’humain. Une étude transcriptionnelle a permis d’identifier plusieurs gènes induits par Lp dans

l’eau, comme lpg2524 qui code pour un présumé régulateur transcriptionel de la famille de LuxR.

L’hypothèse a été émise que ce gène pourrait être impliqué dans la survie de Lp dan l’eau. La

délétion de lpg2524 n’affecte pas la croissance de Lp dans un milieu riche, dans l’amibe

Acanthamoeba castellanii ou dans les macrophages humains en culture THP-1, démontrant que

Lpg2524 est dispensable pour la croissance in vitro et in vivo. Cependant, la délétion de ce gène

engendre un défaut de survie dans l’eau, révélant son rôle dans la survie de Lp dans l’eau. La

surexpression de ce gène engendre aussi un défaut de survie, probablement parce qu’un niveau

d’expression précis est requis. De plus, la délétion de Lpg2524 n’a pas d’effet sur la survie de Lp

lorsque la densité bactérienne est élevée (109 CFU ml

-1), ce qui suggère que son régulon est

régulé par un autre régulateur activé lorsque la densité bactérienne est élevé.

Mots-clés: Legionella pneumophila, eau, survie, protéine de la famille de LuxR, densité

cellulaire

Page 3 of 35



Draft

4

Introduction

Legionella pneumophila (Lp) is an opportunistic human pathogen that can infect the

alveolar macrophages of susceptible individuals, resulting in a severe pneumonia called

Legionnaires’ disease (Fields et al. 2002). As a bacterium inhabiting freshwater environments, Lp

is frequently exposed to fluctuating conditions and experienced various stresses such as nutrient

limitation, temperature and pH. Bacteria tend to reorganize their transcriptomic profile to better

adapt to environmental changes (Leaphart et al. 2006; Stintzi 2003). Such changes in overall

gene expression are usually achieved by the modulation of transcriptional and post-

transcriptional regulators, which control a pool of genes.

Several transcriptional regulators in Lp have been well studied due to their significant

contribution to the regulation of virulence genes, such as the two-component systems CpxRA,

PmrAB, LetAS as well as LqsRS (Gal-Mor and Segal 2003; Hammer et al. 2002; Spirig et al.

2008; Tanner et al. 2016; Zusman et al. 2007). Together, they regulate the expression of over 70

genes encoding Type IVB secretion system and effector proteins, which are essential for

intracellular growth (reviewed by Segal 2013). Moreover, the alternative sigma factor RpoS

modulates the expression of 739 genes, which is approximately one-fourth of the total annotated

genes in Lp. (Hovel-Miner et al. 2009). Apart from controlling multiple pathways associated with

intracellular growth, RpoS is also important for the survival of Lp in water (Trigui et al. 2014).

Our previous transcriptomic studies have showed that RpoS positively regulates two genes

significantly induced in water, bdhA and lpg1659 (lasM), that contribute to the long-term

survival of Lp in water (Li and Faucher 2016; Li et al. 2015).

Our previous microarray analysis showed that another gene, lpg2524, was also

significantly induced in Lp after 6 hours (Log2 ratio =1.52) and 24 hours (Log2 ratio =1.73) in

Page 4 of 35



Draft

5

water when compared to the control grown in rich medium (Li and Faucher 2016). The

expression of this gene is positively regulated by RpoS in the post-exponential phase of growth

(Hovel-Miner et al. 2009). The protein encoded by lpg2524 is composed of 287 aa and is

annotated as a LuxR family transcriptional regulator in the NCBI database due to the presence of

a DNA-binding domain similar to LuxR-like protein at the C-terminal. LuxR is a transcriptional

regulator in the LuxIR quorum sensing (QS) system that regulates bioluminescence in Vibrio

fischeri (Engebrecht and Silverman 1984). Briefly, LuxI is the autoinducer synthase that

synthesizes acylated homoserine lactone (AHL), while LuxR is activated by AHL and then binds

to the regulatory region of target genes to alter gene expression (Nasser and Reverchon 2007). In

Proteobacteria, incomplete QS systems were also found, with a LuxR family sensor/regulator but

no cognate LuxI family synthase (Case et al. 2008). These unpaired LuxR family proteins, also

called LuxR solos, may respond to endogenous or exogenous AHLs with a lower specificity

(Subramoni and Venturi 2009). For instance, the LuxR solo QscR of Pseudomonas aeruginosa

interacts with two different AHLs produced by LasI, namely 3-oxo-decanoyl-homoserine lactone

(3OC10-HSL) and 3-oxododecanoyl-homoserine lactone (3OC12-HSL), and regulates genes

involved in metabolism, transport and virulence (Lee et al. 2006; Lequette et al. 2006). LuxR

solos may also respond to non-AHL molecules (Subramoni and Venturi 2009). For example,

Xanthomonas campestris possesses a LuxR solo named XccR, which responds to a plant factor

(Zhang et al. 2007).

In Lp, there are another four proteins that show sequence similarity to LuxR family

transcriptional regulators, including LpnR1 (Lpg2557), LpnR2 (Lpg1946), LpnR3 (Lpg1448)

and LetA (Lpg2646) (Hammer et al. 2002; Lebeau et al. 2004). Their importance on host

invasion and intracellular multiplication has been characterized, but the function of Lpg2524 has

Page 5 of 35



Draft

6

not been studied yet. Since lpg2524 is induced in water and positively regulated by RpoS, we

hypothesize that this gene is important for Lp to survive in water. In this study, we investigate the

function of Lpg2524 on the growth of Lp in vitro and in vivo as well as its survival in water.

Materials and methods

Bacterial strains and culture conditions

The wild-type (WT) strain we used for constructing the mutant and over-expression

strains was KS79, which is a constitutively competent strain derived from Lp Philadelphia-1

strain JR32 (de Felipe et al. 2008; Sadosky et al. 1993). Lp was grown on charcoal yeast extract

(CYE) agar with 0.25 mg ml-1

ferric pyrophosphate, 0.4 mg ml-1

L-cysteine and 0.1% α-

ketoglutarate at 37°C for three days (Edelstein 1981; Feeley et al. 1979). Liquid cultures were

grown in ACES-buffered yeast extract (AYE) broth (Horwitz and Silverstein 1983). If needed,

this medium was further supplemented with 5 µg ml-1

chloramphenicol or 25 µg ml-1

kanamycin.

The strains of Escherichia coli were derived from DH5α. They were grown overnight on Luria-

Bertani agar at 37°C and the medium was supplemented with 25 µg ml-1

chloramphenicol if

needed. Bacterial strains used in this study are described in Table 1.

Construction of mutant, complemented and over-expression strains

For the construction of deletion mutant SPF258 (∆lpg2524), 1 kb of the sequence

upstream of lpg2524 was amplified from KS79 by PCR using Taq polymerase (Invitrogen) and

the primer set 2524_UpF/2524_UpR, and 1 kb of the sequence downstream of lpg2524 was

amplified using the primer set 2524_DownF/2524_DownR. A kanamycin cassette was then

amplified using pSF6 as template and Kn-F/Kn-R as primers. Using the purified kanamycin

Page 6 of 35



Draft

7

cassette as template, a 1 kb kanamycin fragment with 5’ end complementary to the 3’ end of

upstream fragment and 3’ end complementary to the 5’ end of downstream fragment was

amplified using the primer set 2524_KnF/2524_KnR. Subsequently, a 3 kb mutant allele was

amplified from a mixture of the three 1 kb fragments using the primer set

2524_UpF/2524_DownR and Phusion DNA polymerase (NEB). The amplicon was purified and

introduced into KS79 through natural transformation (de Felipe et al. 2008). Successful

recombinants in which lpg2524 is replaced by the kanamycin cassette were confirmed by

kanamycin resistance and PCR.

For the construction of plasmid pSF84 (plpg2524) for complementation, the lpg2524

gene and a 500 bp upstream sequence was amplified using KS79 as template and

Com2524F_SacI/Com2524R_XbaI as primers. Both the plasmid pXDC39 and purified amplicon

were digested with SacI and XbaI (NEB), following by ligation using T4 DNA ligase (NEB).

Ligation mixture was then transformed into E. coli DH5α and transformants were selected based

on resistance against chloramphenicol. The plasmid was extracted from the transformant and

correct insertion was confirmed by PCR using pXDC39-F/Com2524R_XbaI as primers.

Subsequently, the plasmid was introduced into the deletion mutant ∆lpg2524 by electroporation,

as described previously (Chen et al. 2006), to construct the complemented strain SPF295

(∆lpg2524+plpg2524). Successful recombinants were confirmed by kanamycin and

chloramphenicol resistance as well as PCR.

For the construction of plasmid pSF93 (plpg2524i) for over-expression of lpg2524, the

gene was amplified using KS79 as template and Com2524F2_SacI/Com2524R_XbaI as primers.

Both the plasmid pMMB207c and purified amplicon were digested with SacI and XbaI (NEB),

following by ligation using T4 DNA ligase (NEB). Ligation mixture was then transformed into E.

Page 7 of 35



Draft

8

coli DH5α and the transformants were selected based on resistance against chloramphenicol. The

plasmid was extracted from the transformant and correct insertion (lpg2524) was confirmed by

PCR using PromF/Com2524R_XbaI as primers. Subsequently, the plasmid was introduced into

KS79 by electroporation to construct the over-expression strain SPF311 (WT+plpg2524i).

Successful recombinants were confirmed by kanamycin and chloramphenicol resistance as well

as PCR validation. The sequence of all primers is listed in Table 2.

Extracellular growth assay

The WT strain KS79 and the deletion mutant ∆lpg2524 were suspended at an OD600 of

0.1 in AYE broth. Twenty-five ml of each culture, with three replicates per culture, was grown in

125 ml Erlenmeyer flask at 37°C shaking (250 rpm). The optical density at 600 nm (OD600) of

each culture was monitored for 32 hours at intervals of 4 hours.

Cell lines and infection assays

The amoeba Acanthamoeba castellanii was first grown in 20 ml of peptone yeast glucose

(PYG) broth at 30°C in a 75 cm2 tissue culture flask (Sarstedt). PYG broth is composed of 2%

proteose peptone, 0.1% yeast extract, 0.1% sodium citrate dihydrate, 0.4 M CaCl2, 0.1 M glucose,

4 mM MgSO4, 2.5 mM NaH2PO3, 2.5 mM K2HPO3 and 0.05 mM Fe(NH4)2(SO4)2 (Moffat and

Tompkins 1992). When the culture became confluent, the spent medium with any non-adherent

amoebae was discarded. Ten ml of fresh PYG broth was added into the flask, which was then

shaken sharply to allow detachment of the adherent amoebae from the inner surface of the flask.

Subsequently, the suspension of amoebae was diluted to 5×105 cells ml

-1 and 1 ml was added to

the wells of a 24-well plate (Sarstedt). The plate was settled for two hours to allow adhesion of

Page 8 of 35



Draft

9

amoebae. Then, the medium was replaced with Ac buffer that does not support the growth of Lp

(Moffat and Tompkins 1992) and the plate was settled for another two hours.

To prepare the human monocyte-like cell line THP-1 for infection, cells were first grown

in 30 ml of RPMI 1640 (Life Technologies) with 2 mM glutamine and 10% fetal bovine serum at

37°C under 5% CO2 (Kim et al. 2009). The culture was diluted to 5×105 cells ml

-1 and 1×10

-7 M

phorbol 12-myristate 13-acetate (PMA) (Fisher Scientific) was added. One ml of this culture was

added to the wells of a 24-well plate (Sarstedt) and the plate was incubated for three days to

allow differentiation of monocytes into adherent macrophage-like cells. Fresh medium was used

to replace the spent medium two hours before infection.

To start the infection, the strains KS79, ∆lpg2524 and the dotA mutant were first

suspended in AYE broth at an OD600 of 0.1 and diluted 10 times (to approximately 2.5×106 cells

ml-1

). The dotA mutant is a negative control known to be defective in intracellular growth (Roy

and Isberg 1997). Two µl of each bacterial culture was added to three replicate wells in the 24-

well plate containing either A. castellanii or THP-1 cells (i.e. MOI of 0.1). The plate with A.

castellanii was incubated at 30°C and the plate with THP-1 cells was incubated at 37°C under

5% CO2. The growth of each bacterial strain was monitored every 24 hours by CFU counts and

their intracellular growth was determined by comparing the CFU on individual day with the

initial CFU.

Survival assays in water

In the survival assays, an artificial freshwater medium Fraquil, which does not support

the growth but allows long-term survival of Lp (Mendis et al. 2015), was used. Fraquil contains

0.25 µM CaCl2, 0.15 µM MgSO4, 0.15 µM NaHCO3, 0.1 µM NaNO3, 23 nM MnCl2, 10 nM

Page 9 of 35



Draft

10

K2HPO4, 10 nM FeCl3, 4 nM ZnSO4, 2.5 nM CoCl2, 1 nM CuSO4 and 0.22 nM (NH4)6Mo7O24

dissolved in ultra-pure Milli-Q water (Morel et al. 1975). Strains grown on CYE agar were first

washed with Fraquil for three times before suspending in fresh Fraquil at an OD600 of 0.1. One

ml of suspension was mixed with 4 ml of fresh Fraquil (to obtain an OD600 of approximately 0.02)

and then incubated in a 25 cm2 plastic flask (Sarstedt). Three biological replicates were prepared

for each strain and they were incubated at 25°C, 37°C and 42°C. CFU of each sample was

monitored once per three weeks, once per two weeks and once per week, respectively. For the

samples incubated at 42°C, Live/Dead staining and flow cytometry were used to determine the

membrane integrity of Lp after 7 weeks as described previously (Li et al. 2015). Freshly grown

KS79 was used as the control for viable cells and KS79 boiled in a water bath for 10 minutes

was used as the control for dead cells. Both the samples and controls were diluted to an OD600 of

0.01 in Fraquil. One ml of the dilution was then stained with 1.5 µl of SYTO 9 at 3.34 mM and

1.5 µl of propidium iodide at 20 mM. The Guava easyCyte flow cytometer (EMD Millipore) was

used for fluorescence signal measurement (green fluorescence from SYTO 9 and red

fluorescence from propidium iodide). Unstained cells and stained Fraquil were used as a

reference for instrument setting to eliminate background signals. For data analysis, the guavaSoft

2.7 software was used. The sample cells that followed the fluorescence profile of viable control

and dead control were considered as viable cells and dead cells, respectively. Noteworthy, the

cells that fell in the small overlap region between the profiles of the two controls were

considered as undefined. To study the effects of high cell density on the survival of Lp in water,

the strains were suspended in Fraquil at an OD600 of 1.0 instead of 0.02 before incubating at

42°C.

Page 10 of 35



Draft

11

Results

Deletion of lpg2524 does not affect the growth of Lp in vitro

Since transcriptional regulator controls the expression of other genes, Lpg2524 could be a

critical protein involved in various functions such as growth, infection and survival in water. To

study the importance of lpg2524 in those functions, we constructed a mutant by allelic exchange

(∆lpg2524). No significant differences were observed between the growth of WT strain and the

mutant ∆lpg2524 in rich medium (Fig. 1). Both strains showed exponential growth between 8 to

20 hours and their growth curve remained similar for 32 hours. This result indicates that lpg2524

is dispensable for optimal growth of Lp in complex medium in vitro at 37°C.

Deletion of lpg2524 does not affect the growth of Lp in vivo

Next, we tested if the deletion of lpg2524 would alter the ability of Lp to infect host cells

and to grow intracellularly. Since Lp infects amoebae in the natural environment and infects

human macrophages on occasion (Fields et al. 2002), the amoeba A. castellanii and human

macrophage-like THP-1 cells were used as host cells. In both infection assays, the WT strain and

∆lpg2524 showed a similar increase in CFU ratio, while the negative control (dotA mutant)

showed a decreasing ratio as expected (Fig. 2a and 2b). There were no significant differences

between the WT and ∆lpg2524 in both assays, suggesting that Lp does not require lpg2524 for

host infection and intracellular growth.

lpg2524 is important for Lp to survive in water at warm temperatures

Since Lp induces expression of lpg2524 in water (Li et al. 2015), we hypothesized that

this gene could be important for survival in water and thus that the deletion of lpg2524 could

Page 11 of 35



Draft

12

result in a survival defect. Therefore, we exposed the WT strain, mutant strain ∆lpg2524 and

complemented strain ∆lpg2524+plpg2524 to water at different temperatures and monitored their

survival by CFU count.

At 25°C, no significant reductions in CFU were detected within 24 weeks (Fig. 3a). At

37°C, the CFU of all strains decreased faster than at 25°C and eventually became undetectable

after 22 weeks of exposure in water (Fig. 3b). The mutant ∆lpg2524 showed a faster CFU

reduction than the WT and significant differences in CFU between the two strains were observed

since the 14th

week. In contrast, the complemented strain maintained similar CFU as the WT,

indicating that lpg2524 is important for the survival of Lp in water. At 42°C, the trend was

similar to that at 37°C, though the survival defect of ∆lpg2524 was only partially recovered in

the complemented strain (Fig. 3c). Also, the CFU of all strains dropped quicker than at 37°C and

became undetectable after 5 weeks of exposure to water. Taken together, the results suggest that

lpg2524 is important for Lp to survive in water at temperatures of 37°C and above.

The viability of the WT, mutant and complemented strains was then analyzed using

Live/Dead staining and flow cytometry. For all three strains, over 90% of the cells were viable

and less than 8% were dead (Fig. 3d). Since the CFU of all strains already dropped below

detection limit at this time point (the 7th

week in water at 42°C), the result suggests that most

cells became viable but non-culturable (VBNC).

Over-expression of Lpg2524 affects the survival of Lp in water

Recently, we have shown that LasM (Lpg1659) is important for Lp to survive in water

and that over-expression of this gene further promotes the survival (Li and Faucher 2016).

Therefore, we tested if the over-expression of lpg2524 would have a beneficial effect on the

Page 12 of 35



Draft

13

survival of Lp in water. To test this, a plasmid containing an inducible Ptac promoter upstream of

the lpg2524 ORF was introduced into the WT strain (WT+plpg2524i). The WT strain and

WT+plpg2524i ON/OFF were then exposed to water at 42°C. In contrast to our initial hypothesis,

the CFU became undetectable two weeks earlier than the WT when the over-expression of

Lpg2524 was induced with IPTG (WT+plpg2524i ON) (Fig. 4). When Lpg2524 was not over-

expressed (WT+plasMi OFF), the CFU dropped faster than the WT and became undetectable one

week earlier, probably due to the leaky expression of Ptac. These results indicate that a higher

level of Lpg2524 interferes with the survival of Lp in water.

Lp does not require lpg2524 for survival in water at high cell density

Since LuxR family proteins are sometimes involved in QS-mediated regulation (Nasser

and Reverchon 2007), we hypothesized that Lpg2524 could have such a role in Lp. As QS

involves the regulation of gene expression as a function of cell density (Nasser and Reverchon

2007), bacteria at different densities may show distinct phenotypes. Lpg2524 may be needed to

regulate the genes for survival in water only when Lp is at a particular cell density. Therefore, we

suspended the WT strain, mutant strain ∆lpg2524 and complemented strain ∆lpg2524+plpg2524

in water at a cell density 100 times superior to what was tested in Fig. 3 (i.e. 109

cells ml-1

, an

OD600 of 1.0) and monitored their survival at 42°C. This temperature was used because the

survival defect previously observed in ∆lpg2524 was the greatest.

At a higher cell density, the CFU of all strains dropped below detection limit after 7

weeks of water exposure at 42°C (Fig. 5). This is 2 weeks longer than the suspensions at a lower

cell density (107 cells ml

-1, an OD600 of 0.02) (Fig. 3c), which was expected for a larger

population. All strains showed a similar survival curve and the mutant ∆lpg2524 did not show a

Page 13 of 35



Draft

14

survival defect even at this temperature (Fig. 5), demonstrating that lpg2524 is no longer

important for Lp to survive in water at 42°C when at high cell density.

Discussion

LuxR family proteins are usually composed of around 250 aa with two functional

domains, a N-terminal domain for AHL-binding and a C-terminal helix-turn-helix DNA-binding

domain for transcriptional regulation (Nasser and Reverchon 2007). These LuxR family

transcriptional regulators can manipulate the expression of downstream genes in order to regulate

certain functions, such as LuxR regulating bioluminescence in V. fischeri (Engebrecht and

Silverman 1984). In Lp, the LuxR solo LetA regulates virulence in Lp and the shift between the

replicative and transmissive phases (Hammer et al. 2002). Here, we revealed the functions of a

previously unknown LuxR family transcriptional regulator, Lpg2524, on the survival of Lp in

water.

First, we found that the deletion of lpg2524 does not affect the growth of Lp in vitro. This

is consistent with a previous study showing that the insertion of transposon in this gene did not

result in growth advantages or disadvantages in rich medium (O’Connor et al. 2011). Also,

lpg2524 is dispensable for invasion and intracellular growth in amoeba A. castellanii and human

macrophage-like THP-1 cells. Noteworthy, the other four LuxR family proteins in Lp (LpnR1,

LpnR2, LpnR3 and LetA) were found to be involved in virulence to some extent. It is known that

LpnR2, LpnR3 and LetA promote the expression of flagellin, which is needed for efficient host

cell infection (Hammer et al. 2002; Lebeau et al. 2004; Pruckler et al. 1995). All three LpnR

proteins are dispensable for intracellular multiplication in human macrophage-like U937 cells,

but LpnR2 is needed for invasion and LpnR3 is needed for intracellular multiplication in A.

Page 14 of 35



Draft

15

castellanii (Lebeau et al. 2004). Furthermore, LetA is needed for Lp to evade phagosome-

lysosome fusion, but not important for intracellular multiplication in bone marrow derived

macrophages from A/J mouse (Hammer et al. 2002). Considering our result, it is possible that: 1)

Lpg2524 is not involved in the regulation of virulence at all; 2) due to functional redundancy,

deletion of lpg2524 would not result in any observable effects; and 3) the importance of Lpg2524

is host-specific, so the mutant ∆lpg2524 may have a defect in other host cells, such as primary

macrophages.

Survival defect was observed in ∆lpg2524 exposed to water at 37°C and 42°C, but not at

25°C, suggesting that lpg2524 is important for Lp to survive in warm water. Similar results were

found for bdhA and lasM, which are required for survival in water only when the temperature is

above 25°C (Li and Faucher 2016; Li et al. 2015). Since ∆lpg2524 did not show a defect in water

during short-term exposure at 55°C when compared to the WT (data not shown), it is unlikely

that the defects we observed at 37°C and 42°C were due to a lower tolerance to high temperature.

Therefore, it is possible that ∆lpg2524 could have a survival defect at 25°C over longer period of

time.

In addition, the result of Live/Dead staining showed that the major population of

∆lpg2524 did not die after exposure to water at 42°C for 7 weeks. Instead, it entered a VBNC

state earlier than the WT. VBNC cells are known to be cells in a quiescent status, waiting for

revival or transitioning to death (Li et al. 2014). For example, VBNC cells of Lp induced by

starvation could be resuscitated by co-inoculation with A. castellanii (Steinert et al. 1997).

However, those induced by monochloramine treatment could not be resuscitated using the same

method (Alleron et al. 2013). Since we were unable to resuscitate the VBNC cells in our samples

and they remained non-infectious (data not shown), we consider the cells to be dying, indicating

Page 15 of 35



Draft

16

that ∆lpg2524 started dying in water at an earlier time point than the WT.

Although Lpg2524 is important for Lp to survive in water, the precise level of this

transcriptional regulator seems to be critical for optimal survival. Over-expression of Lpg2524

induced by IPTG greatly hindered the survival of Lp in water at 42°C, whereas slight increase in

the level of Lpg2524 caused by the leaky expression of Ptac also resulted in a mild but

significant survival defect. It is known that over-expression of transcriptional regulators may

disrupt normal pathways and activities in bacteria (reviewed by MacRitchie et al. 2008). For

example, RpoS is important for the virulence of Lp (Hovel-Miner et al. 2009), but its over-

expression was found to repress LetAS-dependent virulence traits, including motility,

cytotoxicity and infectivity (Bachman and Swanson 2004). In fact, most of the LuxR family

transcriptional regulators act as activators by recruiting RNA polymerase to the promoter of their

target genes (Nasser and Reverchon 2007). It is likely that Lpg2524 could activate genes

required for Lp to survive in water. Therefore, the deletion mutant had a survival defect, probably

due to its inability to activate critical genes, whereas the over-expression strain also had a

survival defect, perhaps due to excessive quantity of Lpg2524 that bind non-specifically to genes

that should not be activated when Lp is under nutrient limitation in water (e.g. genes involved in

replication and translation).

Noteworthy, the importance of Lpg2524 to the survival of Lp in water appears to be

dependent on cell density. Lpg2524 is needed for the survival of Lp when at a cell density of 107

CFU ml-1

(OD600 of 0.02) but is dispensable when at a cell density of 109 CFU ml

-1 (OD600 of

1.0). In the natural environment, it is more likely to find Lp at a lower cell density than at cell

density as high as 109 CFU ml

-1. Previous studies found 10

6 CFU ml

-1 of Lp in water basin of

cooling towers and 104 CFU ml

-1 of Lp in hot-water tank (Stout et al. 1985; Türetgen et al. 2005).

Page 16 of 35



Draft

17

However, it is possible that the cell density reaches a higher level in biofilm or during

intracellular multiplication. In both cases, Lp may not require Lpg2524 to maintain survival

because it is not in direct contact with water.

The fact that Lpg2524 belongs to the LuxR family and is important for the survival of Lp

at low cell density suggests a link with a QS system. Such systems have been observed in both

Gram-positive and Gram-negative bacteria to allow interspecies and intraspecies communication

to synchronize group behavior through controlling gene expression (Nasser and Reverchon

2007). Most QS systems involve an autoinducer synthase and a cognate response regulator, while

there are exceptions that involve an extra component, a sensor kinase, which helps signal

detection and transmission (Tiaden et al. 2007). For example, based on the gene cluster

homology to cqsAS QS system in Vibrio cholerae, the first QS system identified in Lp includes

an autoinducer synthase LqsA, a response regulator LqsR and a sensor kinase LqsS (Tiaden et al.

2007). In this system, LqsA produces the α-hydroxyketone autoinducer LAI-1 that does not bind

to the regulator directly but to the sensor, whereas the sensor transfers the phosphoryl group to

the regulator to activate the regulation of target genes (reviewed by Schell et al. 2016).

Nevertheless, Lpg2524 is required at low cell density, which would suggest a model

where Lpg2524 binds to and activates transcription of target genes when the autoinducer is

absent or at a low concentration. At high cell density, the binding of the autoinducer to Lpg2524

may render it inactive. This would result in a similar phenotype between the WT and the mutant

strains at high cell density. Since there are no LuxI homologues in Lp, it is not clear what signal

Lpg2524 senses. None of the five LuxR family proteins (LpnR1, LpnR2, LpnR3, LetA and

Lpg2524) have been shown to interact with autoinducers and it is not clear if they are genuine

QS regulators. One possibility is that Lpg2524 senses an as yet unknown metabolic product that

Page 17 of 35



Draft

18

accumulates extracellularly as the cell density increases. This signaling molecule could be an as

yet unknown molecule or LAI-1 produced by the Lqs system, since LuxR solos are known to

bind to autoinducer produced by other systems (Subramoni and Venturi 2009). Since Lp is not

growing in water, but merely surviving, it is not clear if an autoinducer could be produced and

accumulated extracellularly in sufficient quantity to bind to the response regulators. It is known

that Lp is metabolically active in water since deletion of bdhA, a gene involved in the utilization

of energy reserves, result in a survival defect in water starting at 6th

week (Li et al. 2015).

However, transcription is drastically reduced after 24 hours in water, which would require that

Lpg2524 inhibition by autoinducers occurs within a few days to have an impact on induction of

genetic program required for survival in water, which is likely improbable. Therefore, it is

unlikely that Lpg2524 is involved in typical QS-mediated regulation of genes involved in

survival of water, thus we do not favor this model.

Alternatively, it is possible that another regulator is activated at high cell density, which

bypasses the function of Lpg2524. In this case, Lpg2524 would not be, directly, involved in QS.

This other regulator might not be necessarily a typical QS regulator since other molecules that

accumulate extracellularly can also play a role in sensing the density of the population. In P.

aeruginosa, the siderophore pyoverdine regulates the production of exotoxin A and the PrpL

protease in a dose-dependent manner (Lamont et al. 2002). Such mechanism would be more

consistent with the situation presented here. In water, Lp could produce a siderophore, a secreted

proteins or another type of molecule that accumulates extracellularly. At high density, this

molecule could accumulate to a concentration level sufficient to initiate a response and bypass

the requirement for Lpg2524. It is unlikely that this molecule is a siderophore since the genes

involved in the production of legiobactin and HGA-melanin (Cianciotto 2015) are repressed in

Page 18 of 35



Draft

19

water at high cell density (Li et al. 2015). More likely, it is possible that a micronutrient is

exhausted faster at high cell density, which leads to activation of the alternative regulator that

bypasses the requirement for Lpg2524. Previously, we have shown that the putative transporter

LasM is required for Lp to survive in water and that supplementation with 10 times the normal

amount of trace metal rescues this requirement (Li and Faucher 2016). Hence, it is possible that

exhaustion of trace metals at high cell density serves as a signal during survival of Lp in water.

In conclusion, this study shows that the novel LuxR family transcriptional regulator,

Lpg2524, is important for Lp to survive in water at warm temperature. Absence of Lpg2524 does

not affect the growth of Lp, both in vitro and in vivo. However, both the deletion and over-

expression of lpg2524 result in a survival defect in water, showing that precise level of Lpg2524

is required for maintaining the survival of Lp. Such requirement of Lpg2524 for Lp to survive in

water seems to depend on cell density, as the absence of this protein only cause a survival defect

at low cell density but not at high cell density. Further investigations of the target genes of

Lpg2524 could provide some insight on the underlying regulatory mechanisms.

Acknowledgments

This work was supported by NSERC Discovery grant 418289-2012 and John R. Evans

Leaders Fund – Funding for research infrastructure from the Canadian Foundation for Innovation

to S. P. F.

Page 19 of 35



Draft

20

References

Alleron, L., Khemiri, A., Koubar, M., Lacombe, C., Coquet, L., Cosette, P., et al. 2013. VBNC

Legionella pneumophila cells are still able to produce virulence proteins. Water Res.

47(17): 6606-6617. doi: 10.1016/j.watres.2013.08.032.

Bachman, M.A., and Swanson, M.S. 2004. Genetic evidence that Legionella pneumophila RpoS

modulates expression of the transmission phenotype in both the exponential phase and

the stationary phase. Infect. Immun. 72(5): 2468-2476. doi: 10.1128/iai.72.5.2468-

2476.2004.

Case, R.J., Labbate, M., and Kjelleberg, S. 2008. AHL-driven quorum-sensing circuits: their

frequency and function among the Proteobacteria. ISME J. 2(4): 345-349. doi:

10.1038/ismej.2008.13.

Charpentier, X., Faucher, S.P., Kalachikov, S., and Shuman, H.A. 2008. Loss of RNase R

induces competence development in Legionella pneumophila. J. Bacteriol. 190(24):

8126-8136. doi: 10.1128/jb.01035-08.

Chen, D.-Q., Huang, S.-S., and Lu, Y.-J. 2006. Efficient transformation of Legionella

pneumophila by high-voltage electroporation. Microbiol. Res. 161(3): 246-251. doi:

10.1016/j.micres.2005.09.001.

Cianciotto, N.P. 2015. An update on iron acquisition by Legionella pneumophila: new pathways

for siderophore uptake and ferric iron reduction. Future Microbiol 10(5): 841-851.

de Felipe, K.S., Glover, R.T., Charpentier, X., Anderson, O.R., Reyes, M., Pericone, C.D., et al.

2008. Legionella eukaryotic-like type IV substrates interfere with organelle trafficking.

PLoS Pathog. 4(8): e1000117. doi: 10.1371/journal.ppat.1000117.

Edelstein, P.H. 1981. Improved semiselective medium for isolation of Legionella pneumophila

Page 20 of 35



Draft

21

from contaminated clinical and environmental specimens. J. Clin. Microbiol. 14(3): 298-

303.

Engebrecht, J., and Silverman, M. 1984. Identification of genes and gene products necessary for

bacterial bioluminescence. Proc. Natl. Acad. Sci. 81(13): 4154-4158.

Faucher, S.P., Mueller, C.A., and Shuman, H.A. 2011. Legionella pneumophila transcriptome

during intracellular multiplication in human macrophages. Front. Microbiol. 2: 60. doi:

10.3389/fmicb.2011.00060.

Feeley, J.C., Gibson, R.J., Gorman, G.W., Langford, N.C., Rasheed, J.K., Mackel, D.C., et al.

1979. Charcoal-yeast extract agar: primary isolation medium for Legionella pneumophila.

J. Clin. Microbiol. 10(4): 437-441.

Fields, B.S., Benson, R.F., and Besser, R.E. 2002. Legionella and Legionnaires' disease: 25 years

of investigation. Clin. Microbiol. Rev. 15(3): 506-526. doi: 10.1128/cmr.15.3.506-

526.2002.

Gal-Mor, O., and Segal, G. 2003. Identification of CpxR as a positive regulator of icm and dot

virulence genes of Legionella pneumophila. J. Bacteriol. 185(16): 4908-4919. doi:

10.1128/jb.185.16.4908-4919.2003.

Hales, L.M., and Shuman, H.A. 1999. The Legionella pneumophila rpoS gene is required for

growth within Acanthamoeba castellanii. J. Bacteriol. 181(16): 4879-4889.

Hammer, B.K., Tateda, E.S., and Swanson, M.S. 2002. A two-component regulator induces the

transmission phenotype of stationary-phase Legionella pneumophila. Mol. Microbiol.

44(1): 107-118. doi: 10.1046/j.1365-2958.2002.02884.x.

Horwitz, M.A., and Silverstein, S.C. 1983. Intracellular multiplication of Legionnaires' disease

bacteria (Legionella pneumophila) in human monocytes is reversibly inhibited by

Page 21 of 35



Draft

22

erythromycin and rifampin. J. Clin. Invest. 71(1): 15-26.

Hovel-Miner, G., Pampou, S., Faucher, S.P., Clarke, M., Morozova, I., Morozov, P., et al. 2009.

σS controls multiple pathways associated with intracellular multiplication of Legionella

pneumophila. J. Bacteriol. 191(8): 2461-2473. doi: 10.1128/jb.01578-08.

Kim, E.-H., Charpentier, X., Torres-Urquidy, O., McEvoy, M.M., and Rensing, C. 2009. The

metal efflux island of Legionella pneumophila is not required for survival in

macrophages and amoebas. FEMS Microbiol. Lett. 301(2): 164-170. doi: 10.1111/j.1574-

6968.2009.01813.x.

Lamont, I.L., Beare, P.A., Ochsner, U., Vasil, A.I., and Vasil, M.L. 2002. Siderophore-mediated

signaling regulates virulence factor production in Pseudomonas aeruginosa. Proc Natl

Acad Sci 99(10): 7072-7077. doi: 10.1073/pnas.092016999.

Leaphart, A.B., Thompson, D.K., Huang, K., Alm, E., Wan, X.-F., Arkin, A., et al. 2006.

Transcriptome profiling of Shewanella oneidensis gene expression following exposure to

acidic and alkaline pH. J. Bacteriol. 188(4): 1633-1642. doi: 10.1128/jb.188.4.1633-

1642.2006.

Lebeau, I., Lammertyn, E., De Buck, E., Maes, L., Geukens, N., Van Mellaert, L., et al. 2004.

Novel transcriptional regulators of Legionella pneumophila that affect replication in

Acanthamoeba castellanii. Arch. Microbiol. 181(5): 362-370. doi: 10.1007/s00203-004-

0664-6.

Lee, J.-H., Lequette, Y., and Greenberg, E.P. 2006. Activity of purified QscR, a Pseudomonas

aeruginosa orphan quorum-sensing transcription factor. Mol Microbiol 59(2): 602-609.

doi: 10.1111/j.1365-2958.2005.04960.x.

Lequette, Y., Lee, J.-H., Ledgham, F., Lazdunski, A., and Greenberg, E.P. 2006. A distinct QscR

Page 22 of 35



Draft

23

regulon in the Pseudomonas aeruginosa quorum-sensing circuit. J. Bacteriol. 188(9):

3365-3370. doi: 10.1128/JB.188.9.3365–3370.2006.

Li, L., and Faucher, S.P. 2016. The membrane protein LasM promotes the culturability of

Legionella pneumophila in water. Front. Cell. Infect. Microbiol. 6: 113. doi:

10.3389/fcimb.2016.00113.

Li, L., Mendis, N., Trigui, H., and Faucher, S.P. 2015. Transcriptomic changes of Legionella

pneumophila in water. BMC Genomics 16(1): 1-21. doi: 10.1186/s12864-015-1869-6.

Li, L., Mendis, N., Trigui, H., Oliver, J.D., and Faucher, S.P. 2014. The importance of the viable

but non-culturable state in human bacterial pathogens. Front. Microbiol. 5: 258. doi:

10.3389/fmicb.2014.00258.

MacRitchie, D.M., Buelow, D.R., Price, N.L., and Raivio, T.L. 2008. Two-component signaling

and Gram negative envelope stress response systems. In Bacterial Signal Transduction:

Networks and Drug Targets. Edited by R. Utsumi. Springer New York, New York, NY.

pp. 80-110.

Mendis, N., McBride, P., and Faucher, S.P. 2015. Short-term and long-term survival and

virulence of Legionella pneumophila in the defined freshwater medium Fraquil. PLoS

One 10(9): e0139277. doi: 10.1371/journal.pone.0139277.

Moffat, J.F., and Tompkins, L.S. 1992. A quantitative model of intracellular growth of

Legionella pneumophila in Acanthamoeba castellanii. Infect. Immun. 60(1): 296-301.

Morel, F.M.M., Westall, J.C., Rueter, J.G., and Chaplick, J.P. 1975. Description of the algal

growth media “Aquil” and “Fraquil”. In Technical Note 16. Massachusetts Institute of

Technology, Cambridge.

Nasser, W., and Reverchon, S. 2007. New insights into the regulatory mechanisms of the LuxR

Page 23 of 35



Draft

24

family of quorum sensing regulators. Anal. Bioanal. Chem. 387(2): 381-390. doi:

10.1007/s00216-006-0702-0.

O’Connor, T.J., Adepoju, Y., Boyd, D., and Isberg, R.R. 2011. Minimization of the Legionella

pneumophila genome reveals chromosomal regions involved in host range expansion.

Proc. Natl. Acad. Sci. 108(36): 14733-14740. doi: 10.1073/pnas.1111678108.

Pruckler, J.M., Benson, R.F., Moyenuddin, M., Martin, W.T., and Fields, B.S. 1995. Association

of flagellum expression and intracellular growth of Legionella pneumophila. Infect.

Immun. 63(12): 4928-4932.

Roy, C.R., and Isberg, R.R. 1997. Topology of Legionella pneumophila DotA: an inner

membrane protein required for replication in macrophages. Infect. Immun. 65(2): 571-

578.

Sadosky, A.B., Wiater, L.A., and Shuman, H.A. 1993. Identification of Legionella pneumophila

genes required for growth within and killing of human macrophages. Infect. Immun.

61(12): 5361-5373.

Schell, U., Simon, S., Sahr, T., Hager, D., Albers, M.F., Kessler, A., et al. 2016. The α-

hydroxyketone LAI-1 regulates motility, Lqs-dependent phosphorylation signalling and

gene expression of Legionella pneumophila. Mol. Microbiol. 99(4): 778-793. doi:

10.1111/mmi.13265.

Segal, G. 2013. The Legionella pneumophila two-component regulatory systems that participate

in the regulation of Icm/Dot effectors. In Molecular Mechanisms in Legionella

Pathogenesis. Edited by H. Hilbi. Springer-Verlag Berlin Heidelberg. pp. 35-52.

Spirig, T., Tiaden, A., Kiefer, P., Buchrieser, C., Vorholt, J.A., and Hilbi, H. 2008. The

Legionella autoinducer synthase LqsA produces an α-hydroxyketone signaling molecule.

Page 24 of 35



Draft

25

J. Biol. Chem. 283(26): 18113-18123. doi: 10.1074/jbc.M801929200.

Steinert, M., Emödy, L., Amann, R., and Hacker, J. 1997. Resuscitation of viable but

nonculturable Legionella pneumophila Philadelphia JR32 by Acanthamoeba castellanii.

Appl. Environ. Microbiol. 63(5): 2047-2053.

Stintzi, A. 2003. Gene expression profile of Campylobacter jejuni in response to growth

temperature variation. J. Bacteriol. 185(6): 2009-2016. doi: 10.1128/jb.185.6.2009-

2016.2003.

Stout, J.E., Yu, V.L., and Best, M.G. 1985. Ecology of Legionella pneumophila within water

distribution systems. Appl. Environ. Microbiol. 49(1): 221-228.

Subramoni, S., and Venturi, V. 2009. LuxR-family ‘solos’: bachelor sensors/regulators of

signalling molecules. Microbiology 155(5): 1377-1385. doi: 10.1099/mic.0.026849-0.

Tanner, J.R., Li, L., Faucher, S.P., and Brassinga, A.K.C. 2016. The CpxRA two-component

system contributes to Legionella pneumophila virulence. Mol. Microbiol. 100(6): 1017-

1038. doi: 10.1111/mmi.13365.

Tiaden, A., Spirig, T., Weber, S.S., Brüggemann, H., Bosshard, R., Buchrieser, C., et al. 2007.

The Legionella pneumophila response regulator LqsR promotes host cell interactions as

an element of the virulence regulatory network controlled by RpoS and LetA. Cell.

Microbiol. 9(12): 2903-2920. doi: 10.1111/j.1462-5822.2007.01005.x.

Trigui, H., Dudyk, P., Oh, J., Hong, J.-I., and Faucher, S.P. 2014. A regulatory feedback loop

between RpoS and SpoT supports the survival of Legionella pneumophila in water. Appl.

Environ. Microbiol. 81(3): 918-928. doi: 10.1128/AEM.03132-14.

Türetgen, I., Sungur, E.I., and Cotuk, A. 2005. Enumeration of Legionella pneumophila in

cooling tower water systems. Environ. Monit. Assess. 100(1): 53-58. doi:

Page 25 of 35



Draft

26

10.1007/s10661-005-7058-3.

Zhang, L., Jia, Y., Wang, L., and Fang, R. 2007. A proline iminopeptidase gene upregulated in

planta by a LuxR homologue is essential for pathogenicity of Xanthomonas campestris

pv. campestris. Mol Microbiol 65(1): 121-136. doi: 10.1111/j.1365-2958.2007.05775.x.

Zusman, T., Aloni, G., Halperin, E., Kotzer, H., Degtyar, E., Feldman, M., et al. 2007. The

response regulator PmrA is a major regulator of the icm/dot type IV secretion system in

Legionella pneumophila and Coxiella burnetii. Mol. Microbiol. 63(5): 1508-1523. doi:

10.1111/j.1365-2958.2007.05604.x.

Page 26 of 35



Draft

27

Figure captions

Fig.1. Optical density at 600 nm of the WT strain and deletion mutant ∆lpg2524 grown in rich

medium for 32 hours. Data shown are the mean and SD of three biological replicates.

Fig. 2. Growth of the WT strain, mutant ∆lpg2524 and negative control dotA mutant inside (a) A.

castellanii or (b) THP-1 macrophages. CFU was monitored daily and the log ratio between the

CFU on individual day (CFUT) and the initial CFU (CFU0) was calculated. Data shown are the

mean and SD of three biological replicates.

Fig. 3. Survival of the WT strain, mutant strain ∆lpg2524 and complemented strain

∆lpg2524+plpg2524 suspended in water at (a) 25°C, (b) 37°C and (c) 42°C. The initial OD600 of

all samples was approximately 0.02. Significant differences between WT and other strains were

determined by one-tailed unpaired Student’s t test (* p<0.05; ** p<0.005; *** p<0.0005). DL

indicates detection limit. (d) Percentage of viable and dead cells in different strains exposed to

water at 42°C for 7 weeks. Live/Dead staining together with flow cytometry was used to analyze

5000 cells in each replicate. Data shown are the mean (and SD) of three biological replicates.

Fig. 4. Survival of the WT strain and the over-expression strain WT+plpg2524i in water at 42°C.

WT+plpg2524i OFF means the over-expression of lpg2524 was not induced, whereas

WT+plpg2524i ON means the over-expression of lpg2524 was induced with 1 mM IPTG. Data

shown are the mean and SD of three biological replicates. One-tailed unpaired Student’s t test

was used to assess significant differences against WT (* p<0.05; ** p<0.005; *** p<0.0005). DL

indicates detection limit.

Page 27 of 35



Draft

28

Fig. 5. Survival of the WT strain, mutant strain ∆lpg2524 and complemented strain

∆lpg2524+plpg2524 in water at 42°C at an OD600 of 1.0. Data shown are the mean and SD of

three biological replicates. Significant differences between WT and other strains were

determined by one-tailed unpaired Student’s t test (* p<0.05). DL indicates detection limit.

Page 28 of 35



Draft

29

Tables

Table 1. Bacterial strains used in this study

Name Relevant genotype Reference

Legionella pneumophila strain Philadelphia-1

JR32 r-m

+, Sm

R (Sadosky et al. 1993)

KS79 (WT) JR32 ∆comR (de Felipe et al. 2008)

LELA3118 (dotA mutant) JR32 dotA::Tn903dIIlacZ (Sadosky et al. 1993)

LM1376 (rpoS mutant) JR32 rpoS::Tn903dGent, GmR (Hales and Shuman

1999)

SPF176 (prpoS) LM1376 pSF49 (Trigui et al. 2014)

SPF248 (∆lasM) KS79 ∆lpg1659, KnR This work

SPF294 (∆lasM+plasM) SPF248 pSF83, KnRCm

R This work

SPF298 (WT+plasMi) KS79 pSF73, CmR This work

Escherichia coli

DH5α supE44 ∆lacU169 (Φ80 lacZ∆M15)

hsdR17 recA1 endA1 gyrA96 thi-1 relA1

Invitrogen

pMMB207C DH5α, ∆mobA, CmR (Charpentier et al.

2008)

pSF6 DH5α, pGEMT-easy-rrnb (Faucher et al. 2011)

pSF49 DH5α, pMMB207C-ptac-rpoS, CmR (Trigui et al. 2014)

pSF73 DH5α, pMMB207C-ptac-lpg1659, CmR This work

pSF83 DH5α, pXDC39-plpg1659-lpg1659, CmR This work

pXDC39 DH5α, pMMB207c, ∆Ptac,∆lacI, CmR Xavier Charpentier

Page 29 of 35



Draft

30

Table 2. Primer sequences used in this study

Name Sequence (5’�3’)*

2524_UpF GGCAAGACAGTTCTGGAGTCC

2524_UpR CAGTCTAGCTATCGCCATGTAGTTAGAGAACTTCTGATCCCG

2524_DownF GATGCTGAAGATCAGTTGGGTCCCTACTGACTCAAAAACAGC

2524_DownR GAATGATCTTCACTCAACAATGC

2524_KnF CGGGATCAGAAGTTCTCTAACTACATGGCGATAGCTAGACTG

2524_KnR GCTGTTTTTGAGTCAGTAGGGACCCAACTGATCTTCAGCATC

Com2524F_SacI CCGGAGCTCTGAGACAATGCCATTGTCTGG

Com2524F2_SacI CCGGAGCTCATGAATGCCCAATCCAGAATG

Com2524R_XbaI CGCTCTAGATGAGTCAGTAGGGGTTATGTC

Kn-F TACATGGCGATAGCTAGACTG

Kn-R ACCCAACTGATCTTCAGCATC

pXDC39-F GCTTCCACAGCAATGGCATCC

PromF CGTATAATGTGTGGAATTGTGAG

* The underlined bases indicate restriction sites.

Page 30 of 35



Draft

Optical density at 600 nm of the WT strain and deletion mutant ∆lpg2524 grown in rich medium for 32 hours. Data shown are the mean and SD of three biological replicates.

Fig. 1

73x42mm (300 x 300 DPI)

Page 31 of 35



Draft

Growth of the WT strain, mutant ∆lpg2524 and negative control dotA mutant inside (a) A. castellanii or (b) THP-1 macrophages. CFU was monitored daily and the log ratio between the CFU on individual day (CFUT) and the initial CFU (CFU0) was calculated. Data shown are the mean and SD of three biological replicates.

Fig. 2 152x169mm (300 x 300 DPI)

Page 32 of 35



Draft

Survival of the WT strain, mutant strain ∆lpg2524 and complemented strain ∆lpg2524+plpg2524 suspended in water at (a) 25°C, (b) 37°C and (c) 42°C. The initial OD600 of all samples was approximately 0.02.

Significant differences between WT and other strains were determined by one-tailed unpaired Student’s t test (* p<0.05; ** p<0.005; *** p<0.0005). DL indicates detection limit. (d) Percentage of viable and dead

cells in different strains exposed to water at 42°C for 7 weeks. Live/Dead staining together with flow cytometry was used to analyze 5000 cells in each replicate. Data shown are the mean (and SD) of three

biological replicates. Fig. 3

143x76mm (300 x 300 DPI)

Page 33 of 35



Draft

Survival of the WT strain and the over-expression strain WT+plpg2524i in water at 42°C. WT+plpg2524i OFF means the over-expression of lpg2524 was not induced, whereas WT+plpg2524i ON means the over-expression of lpg2524 was induced with 1 mM IPTG. Data shown are the mean and SD of three biological

replicates. One-tailed unpaired Student’s t test was used to assess significant differences against WT (* p<0.05; ** p<0.005; *** p<0.0005). DL indicates detection limit.

Fig. 4 72x36mm (300 x 300 DPI)

Page 34 of 35



Draft

Survival of the WT strain, mutant strain ∆lpg2524 and complemented strain ∆lpg2524+plpg2524 in water at 42°C at an OD600 of 1.0. Data shown are the mean and SD of three biological replicates. Significant

differences between WT and other strains were determined by one-tailed unpaired Student’s t test (* p<0.05). DL indicates detection limit.

Fig. 5 72x36mm (300 x 300 DPI)

Page 35 of 35



Draft - University of Toronto T-Space · Draft 2 Abstract The water-borne Gram-negative bacterium...

Documents

Transcript of Draft - University of Toronto T-Space · Draft 2 Abstract The water-borne Gram-negative bacterium...