Downloaded from on March 3, 2020 by guest · svu aureus strains were grown in tryptic soy broth...

1

1 2 3 4

Staphylococcus aureus hyaluronidase is a 5 CodY-regulated virulence factor 6

7 8 Carolyn B. Ibberson1, Crystal L. Jones2, Shweta Singh2, Matthew C. Wise2, 9

Mark E. Hart3, Daniel V. Zurawski2, Alexander R. Horswill1# 10 11 12

1Department of Microbiology 13 Roy J. and Lucille A. Carver College of Medicine, 14

University of Iowa, Iowa City, IA 15 16

2Department of Wound Infections 17 Walter Reed Army Institute of Research (WRAIR) 18

Silver Spring, MD 19 20

3Division of Microbiology 21 National Center for Toxicological Research 22

Food and Drug Administration 23 Jefferson, AR 24

25 26 27 28 29 30 31 32 #Corresponding author: 33 Alexander R. Horswill, Ph.D. 34 University of Iowa 35 Department of Microbiology 36 540F EMRB 37 Iowa City, IA 52242 38 Phone: (319) 335-7783 39 FAX (319) 335-8228 40 E-mail: [email protected] 41 42 43 44 45 Running Title: S. aureus hyaluronidase is a virulence factor 46 47

IAI Accepts, published online ahead of print on 28 July 2014Infect. Immun. doi:10.1128/IAI.01710-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on March 27, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

2

ABSTRACT 48 Staphylococcus aureus is a Gram-positive pathogen that causes a diverse range 49 of bacterial infections. Invasive S. aureus strains secrete an extensive arsenal of 50 hemolysins, immunomodulators and exo-enzymes to cause disease. Our studies 51 have focused on the secreted enzyme hyaluronidase (HysA), which cleaves 52 hyaluronic acid polymer at the β-1,4 glycosidic bond. In this report, we have 53 investigated the regulation and contribution of this enzyme to S. aureus 54 pathogenesis. Using the Nebraska Transposon Mutagenesis Library (NTML), we 55 identified 8 insertions that modulate extracellular levels of HysA activity. 56 Insertions in the sigB operon, as well as in genes encoding the global regulators 57 SarA and CodY, significantly increased HysA protein levels and activity. By 58 altering the availability of branched chain amino acids, we further demonstrated 59 CodY-dependent repression of HysA activity. Additionally, through mutation of 60 the CodY binding box upstream of hysA, the repression of HysA production was 61 lost, suggesting CodY is a direct repressor of hysA expression. To determine 62 whether HysA is a virulence factor, a ΔhysA mutant of a community-associated 63 methicillin-resistant S. aureus (CA-MRSA) USA300 strain was constructed and 64 found to be attenuated in a neutropenic, murine model of pulmonary infection. 65 Mice infected with this mutant strain exhibited a 4-log reduction in bacterial 66 burden in their lungs, as well as reduced lung pathology and increased levels of 67 pulmonary hyaluronic acid when compared to mice infected with the wild-type, 68 parent strain. Taken together, these results indicate S. aureus hyaluronidase is a 69 CodY-regulated virulence factor. 70


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

3

INTRODUCTION 71 Staphylococcus aureus is a leading cause of both hospital and community 72 associated infections in the developed world, accounting for $14.5 billion dollars 73 in healthcare costs annually in the United States alone (1). These infections 74 range from mild skin and soft tissue infections to potentially fatal infections such 75 as pneumonia, endocarditis, osteomyelitis, sepsis, and toxic-shock syndrome (2). 76 Additionally, the increasing prevalence of methicillin-resistant S. aureus strains in 77 both the hospital and community has exacerbated the problem (3-5). S. aureus 78 is a successful pathogen due to its extensive arsenal of virulence factors that 79 consist of both surface associated proteins, such as microbial surface 80 components recognizing adhesive matrix molecules (MSCRAMMs), as well as 81 secreted proteins including hemolysins, immunomodulators, and a number of 82 exo-enzymes (2, 3). Many emerging MRSA isolates are known for causing 83 tissue-destructive infections (5, 6), and it has been proposed that the excessive 84 damage is due, in part, to the large quantities of toxins and secreted enzymes 85 produced by these new isolates (7). 86

Our studies have focused on the exo-enzyme hyaluronidase (also called 87 hyaluronate lyase) encoded by the gene hysA (8). Hyaluronidases are bacterial 88 enzymes that cleave the β-1,4 glycosidic bond of hyaluronic acid (HA), a high 89 molecular weight polymer composed of repeating disaccharide units of N-90 acetylglucosamine and D-glucuronic acid (9, 10). Hyaluronic acid is synthesized 91 and secreted from the plasma membrane of mammalian cells, and it is abundant 92 in the skin, skeletal tissue, umbilical cord, lungs, heart valves, brain, and a 93


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

4

number of other tissues (9-11). Hyaluronic acid also possesses a multitude of 94 functions for the host including providing structure to tissues, water homeostasis, 95 cell proliferation, and as an immune regulator (10, 11). Many of these tissues 96 with high HA concentrations are frequently infected with S. aureus (2). 97

Cleavage of HA by bacterial hyaluronidases occurs by β-elimination of the 98 β-1,4 glycosidic bond and results in unsaturated disaccharides as the product of 99 complete digestion (9). In contrast, the eukaryotic hyaluronidases hydrolyze the 100 β-1,4 glycosidic bond, producing mostly tetra- and hexasaccharides as end 101 products. For a number of Gram-positive organisms, hyaluronidases have been 102 shown to be essential virulence factors for their ability to disseminate cells and 103 virulence factors through tissue (9). For example μ-toxin, a hyaluronidase of 104 Clostridium perfringens, was found to significantly increase the ability of α-toxin 105 to penetrate tissue (12). Similarly, a mutation in the hyaluronidase of 106 Streptococcus pyogenes showed reduced tissue penetration when compared to 107 wild-type in a murine skin abscess model (13). Additionally, there have been a 108 number of structural studies on the hyaluronidases from Streptococcus 109 pneumoniae and Streptococcus agalactiae (14-16), and the S. aureus enzyme is 110 reported to have a similar structure to these streptococcal enzymes (9). 111

Reports of S. aureus hyaluronidase date back to pioneering 1933 studies 112 performed by Duran-Reynals (17), who identified a “spreading factor” found in 113 the spent media of “invasive” S. aureus strains. This spreading factor increased 114 lesion size in a rabbit skin infection model as measured by the spread of India Ink 115 (17), and it could increase the size of lesions caused by other bacterial 116


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

5

pathogens. Subsequent reports concluded that the enzyme hyaluronidase was 117 responsible for the spreading factor activity (18-21), but Hobby et al. suggested 118 that other agents may contribute to the phenomena (22). A number of follow-up 119 studies investigated the enzymatic properties and expression of S. aureus 120 hyaluronidase (23-25), but in the intervening years, progress stagnated until the 121 hysA gene was identified and sequenced (26). More recently, HysA enzyme was 122 detected in proteomic studies (27) and shown to be required for increased wound 123 size in a murine skin infection model (28). Little is known about hysA regulation, 124 although SarA is thought to repress hysA gene expression and there is some 125 evidence that the agr quorum-sensing system induces expression (28, 29). 126

To expand our knowledge of HysA in S. aureus, we proceeded to 127 investigate the regulation and the contribution of this enzyme to pathogenicity. 128 We identified genes involved in the regulation of hysA utilizing a transposon 129 mutagenesis library, and the most prominent of these was the global regulator 130 CodY. We characterized the role of HysA in the pathogenesis of S. aureus using 131 a murine pulmonary infection model, and we present evidence that HysA 132 promotes virulence through the breakdown of hyaluronic acid during infection. 133 134 135 136 137 138 139


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

6

Materials and Methods 140 Bacterial strains, plasmids, and culture conditions 141 Bacterial strains and plasmids used in this study are described in Table 2. All S. 142 aureus strains were grown in tryptic soy broth (TSB) or tryptic soy agar (TSA) 143 with the appropriate antibiotics for plasmid maintenance or selection (ampicillin 144 100 μg/mL, chloramphenicol 10 μg/mL, erythromycin 10 μg/mL, tetracycline 145 0.625 μg/mL) at 37°C with shaking at 220 rpm with a flask to volume ratio of 146 approximately 5:1 unless otherwise specified. Hyaluronic acid sodium salt 147 purified from Streptococcus equi was purchased from Sigma-Aldrich. Plasmid 148 DNA was purified from Escherichia coli and electroporated into S. aureus 149 RN4220 as previously described (30). Plasmids and transposon insertions were 150 moved from S. aureus RN4220 or S. aureus JE2 with bacteriophage Φ11 to 151 other S. aureus strains by transduction. All of the oligonucleotides used for this 152 study can be found in Table 1. 153 The ΔhysA mutant was constructed using the pJB38-hysA, modified 154 pKOR1 system, as described (31). Briefly, 600-bp flanking regions upstream and 155 downstream of hysA were amplified and joined by overlap PCR extension using 156 genomic DNA from AH1263 as the template and oligonucleotides CBR12-CBR13 157 to generate the upstream fragment, and CBR14-CBR15 to generate the 158 downstream fragment. The outermost primers (CBR12 and CBR15) were 159 engineered to include SbfI and XmaI sites at their 5’ ends, respectively, and the 160 inner primers (CBR13 and CBR14) were similarly engineered with XhoI and MluI 161 sites at their 5’ ends to aid in the overlap extension. PCR products were ligated 162


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

7

with T4 DNA Ligase (Invitrogen) into pJB38 at the SbfI and XmaI sites and 163 electroporated into E. coli strain BW25141. Plasmid DNA was purified from this 164 strain, isolated using a High Speed Plasmid Mini-kit (IBI Scientific), and 165 electroporated into RN4220. The plasmid construct was isolated from S. aureus 166 RN4220 and transduced into AH1263 using bacteriophage Φ11. The hysA 167 mutation was constructed on the chromosome as previously outlined in the 168 pJB38 method (31). The final colonies were screened for plasmid loss by 169 antibiotic susceptibility and confirmed by PCR. 170

The complementing plasmid, pHysA (pCR01), was created by amplifying 171 the hysA promoter region (~600 bp upstream of the putative translational start 172 site) through the stop codon with the flanking primers CBR35 and CBR29. 173 Amplified DNA containing the hysA coding sequence and the promoter region 174 was restriction digested with BamHI-HF and NheI-HF (New England Biolabs) and 175 ligated into linearized pSKerm-MCS plasmid DNA at the BamHI and NheI sites. 176 Ligated DNA was electroporated into E. coli strain BW25141 using standard 177 molecular techniques. 178

To create the HysA overexpression construct pCR03, the hysA gene 179 without the encoded signal sequence was amplified from AH1263 genomic DNA 180 using primers CBR41 and CBR42, which contain NheI and XhoI sites at their 5’ 181 ends, respectively. The resulting PCR product was ligated into pET28a linearized 182 with NheI and XhoI and electroporated into E. coli strain ER2566 to generate 183 strain AH2856. 184


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

8

To mutate the CodY binding box upstream of hysA, plasmids pCR04, 185 pCR05, and pCR06 were constructed using overlap PCR to engineer the six 186 nucleotide changes. A 5’ region introducing the mutations into the CodY box 187 upstream of hysA was amplified using CBR35 and either CBR83, CBR85, or 188 CBR87. A corresponding 3’ region using homologous primers to introduce the 189 same mutations and amplify the remainder of the hysA promoter region and hysA 190 was generated using CBR29 and either CBR82, CBR84 or CBR86. The 5’ and 3’ 191 fragments were mixed at a ratio of 1:1 in the combinations as follows: CBR35-192 CBR83:CBR82-CBR82, CBR35-CBR85:CBR84-CBR29, and CBR35-193 CBR87:CBR29-CBR86. Overlap PCR was done using the mixed fragments as a 194 template and CBR29 and CBR35 to amplify hysA and the promoter region 195 containing the mutated CodY boxes. pSKermMCS and the PCR product inserts 196 were restriction digested with BamHI-HF and NheI-HF and ligated using T4 DNA 197 Ligase. Ligations were transformed into E. coli strain DH5α as previously 198 described. The resulting plasmids were confirmed by sequencing. 199

The spa mutant was generated using the same protocol as described 200 above for deleting hysA. Flanking regions of spa (SAUSA300_0113) were 201 amplified with the primer pairs spa_delA_EcoRI and spa_delB; and spa_delC 202 and spa_delD_SalI. The products were fused using overlap extension PCR with 203 the primers spa_delA_EcoRI and spa_delD_SalI. The resulting fragment was 204 digested with EcoRI and SalI and ligated into pJB38. The spa deletion was 205 confirmed by PCR with primers spa_upstream and spa_downstream. The spa 206 codY double mutation construct was generated by transducing the codY::ΦΝΣ 207


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

9

cassette into S. aureus strain LAC Δspa with bacteriophage Φ11. To generate 208 strain AH3207, the pTet marker switching plasmid was used to replace the 209 erythromycin cassette of the codY::ΦΝΣ transposon insertion in S. aureus strain 210 AH2946 with a tetracycline cassette as described by Bose et al. (32). This 211 construct was then transduced by bacteriophage Φ11 into the spa deletion strain 212 that also harbored the hysA::ΦΝΣ transposon insertion. 213 214 Protein purification 215 AH2856 was grown overnight at 37°C in LB containing kanamycin (50 μg/mL), 216 and subcultured into 1 L of fresh LB medium at a ratio of 1:250. The culture was 217 grown at 30°C to mid-logarithmic phase, IPTG was added to 1 mM final 218 concentration, and the culture was allowed to grow for an additional 4 h. Cells 219 were harvested by centrifugation, washed once with water, pelleted by 220 centrifugation, and frozen at -20°C. Cells were mechanically lysed using a 221 Microfluidics Microfluidizer model LV1 (Newton, MA) at 25,000 psi and running 222 the samples through the machine twice. Cell lysate was clarified by centrifugation 223 for 20 min at 15,000 × g at 4 °C. Protein was purified using Fractogel His-Bind 224 Resin (Novagen) as per the manufacturer’s instructions, dialyzed into PBS, and 225 concentrated using Millipore Centrifugal Filter Unit (30,000 molecular weight cut-226 off), and brought to 10 mg/ml in 1X PBS. The protein suspension was frozen in 227 10% glycerol at -20°C until used. 228 229 230


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

10

231 Transposon library screen 232 The Nebraska Transposon Mutant Library (NTML) was grown overnight in TSB in 233 96-well microtiter plates. Cultures were stamped onto hyaluronic acid (HA) 234 plates (TSB, 1% agarose, 0.4 mg/mL HA, 1% w/v BSA) prepared as described 235 (8) and incubated at 37°C for 4 h. Acetic acid (10%) was added to the plates to 236 visualize zones of clearing. Plates were scored for their hyaluronidase activity, 237 and mutations that increased or decreased activity were rescreened in the same 238 manner. Mutations that affected activity in both screens were quantitatively 239 assessed for hyaluronidase activity by growing each strain overnight in TSB, sub-240 culturing to an OD600 = 1.0, and dispensing the diluted culture as five aliquots (4 241 μL) onto HA plates. After 6 h of incubation, plates were flooded with 10% acetic 242 acid and zones resulting from HA cleavage were enumerated with a caliper. 243 244 Hyaluronidase activity assay 245 The hyaluronidase activity assay was performed as previously described (28) 246 with some modifications. Briefly, S. aureus strains were grown overnight in TSB 247 at 37°C with shaking, sub-cultured 1:1000, and grown at 37°C for the time 248 specified. Spent culture media was isolated with Spin-X filters (0.22 μm) and 249 frozen at -20°C until assayed. Hyaluronic acid (100 μL at 1 mg/mL) was mixed 250 with 50 μL of spent media and allowed to react at 37°C for 15 min. The reaction 251 was stopped by adding 25 μL of potassium tetraborate solution (0.8 M, pH 9.1), 252 vortexed, and boiled for 3 minutes. In parallel, 12.5 μL of spent media was added 253


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

11

to 31.25 μL of T=0 Stop Solution (hyaluronic acid 0.8 mg/mL, 0.8 M potassium 254 tetraborate, pH 9.1), vortexed, and boiled for 3 min. The samples were dispensed 255 into a 96-well microtiter plate in quadruplicate, and freshly prepared DMAB 256 solution (10% (w/v) ρ-dimethylaminobenzaldehyde, 12.5% (v/v) 10 M HCl 257 (Sigma-Aldrich), and 87.5% (v/v) glacial acetic acid (Fisher Scientific) were 258 added to each well. The plate was incubated at 37°C for 20 min to allow the color 259 reaction to take place. A TECAN Infinite M200 plate reader was used to measure 260 the absorbance at 590 nm. Hyaluronidase specific activity is expressed as 261 103×μmol N-acetylglucosamine (Sigma Aldrich) released ml-1 min-1 per OD600 unit 262 and is calculated by the equation: 263

103×3×(1/15)×(1/m)××ΔA590×(1/OD600) 264 where ΔA590 represents the difference in absorbance between the t15 and t0 265 readings for each sample, m represents the slope of the standard curve of NAG, 266 OD600 is the optical density of the culture when the sample was taken, 3 is the 267 dilution factor of the sample tested in substrate, and 1/15 is the reciprocal of the 268 reaction time allowed at 37oC. The assay was performed in triplicate for each 269 condition tested. 270 For the RNAIII impact on hyaluronidase activity, strains with pALC2073 or 271 pALC2073-RNAIII were grown overnight in TSB at 37°C and were sub-cultured 272 1:1000 into fresh TSB with anhydrotetracycline (aTc) at various concentrations. 273 Cultures were grown for 8 hr, cells pelleted, and spent media was filtered and 274 assayed for activity. 275 276


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

12

Limiting to rich media assays 277 Chemically defined medium (CDM) was made as described by Pohl et al. (33) 278 except the group 6 vitamin solution was replaced with nicotinamide (500 μg/L), 279 thiamine (500 μg/L), pantothenate (500 μg/L), and biotin (500 μg/L), final 280 concentrations. Single amino acids were omitted or added in excess as indicated 281 in the figure legends. The medium was buffered to pH 7.0. S. aureus strains 282 were grown overnight in TSB and subcultured 1:1000 into CDM or CDM lacking 283 isoleucine. Bacteria were grown for 5 h at which point cells were pelleted, 284 washed once with 1X PBS, and suspended into fresh CDM. For those cells 285 grown in CDM lacking isoleucine, they were now suspended in fresh CDM 286 containing 5X branched chain amino acids (isoleucine, valine, leucine). Cells 287 were grown in the new medium for an additional two hours. Growth was 288 monitored spectrophotometrically at 600 nm throughout by measuring the optical 289 density of 100 μL of culture in a 96-well microtiter plate and a TECAN infinite 290 M200 plate reader. Additionally, 200 μL of each culture was removed at the 291 designated time points indicated in the figure legend, and spent media was 292 isolated using 0.22 μm Spin-X Centrifuge Tube Filters (Costar). Spent media 293 were used to determine hyaluronidase activity and the presence or absence of 294 PVL (see below). 295 296 Protein Immunoblot for PVL 297 Culture spent media isolated from cells grown in CDM, CDM lacking isoleucine, 298 or CDM with 5X BCAA as described above (5 μL for 4 hr, or 1 μL for other time-299


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

13

points) were brought to a total volume of 10 μL in SDS-loading buffer containing 300 1% β-mercaptoethanol. Proteins were resolved by PAGE using Tricine/SDS gels 301 containing 12% polyacrylamide and 170 kV. Proteins were transferred (160 302 mAmps for 1 h) onto nitrocellulose membranes and blocked overnight at 4°C in in 303 0.1% Tris-buffered saline containing 0.1% Tween 20 (TBST) and 5% skim milk. 304 The membrane was probed for using PVL, Luk-S polyclonal antibody (IBT 305 Bioservices, Gaithersburg, MD) at 1:10,000 in TBST containing 5% skim milk 306 for 2 hr at room temperature and then washed three times for 10 min each with 307 TBST. Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (Jackson 308 ImmunoResearch Laboratories, Inc., West Grove, PA) was applied at 1:20,000 in 309 blocking buffer at room temperature for one hr. Membranes were washed three 310 times for 10 min each with 0.1% TBST and SuperSignal West Pico 311 chemiluminescent substrate (Thermo Scientific) was added to detect proteins 312 followed by exposure to Classic X-Ray Film (Research Products International 313 Corporation). Bands were quantified using ImageJ software. 314 315 Protein Immunoblot Blot for HysA 316 S. aureus strains AH3052, AH3134, and AH3207 were grown overnight in TSB at 317 37°C with shaking at 220 rpm. Strains were subcultured at a ratio of 1:100 into 318 fresh TSB and grown for 8 hours at 37°C with shaking at 220 rpm. Cultures were 319 normalized to an OD600 = 3.0 with TSB, spent media were isolated by filtration 320 using a 0.22 μm Millex-GS syringe filter (Millipore), concentrated using Amicon 321 Ultra 10,000 MWCO Centrifugal Filters (Millipore)and frozen at -20°C. The 10 µL 322


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

14

samples were brought to a total volume of 15 μL in SDS-loading buffer containing 323 1% β-mercaptoethanol and proteins were resolved by PAGE using Tricine/SDS 324 gels containing 9% polyacrylamide and 170 kV. Proteins were transferred (160 325 mAmps for 1 h) to nitrocellulose membranes and blocked overnight at 4°C in 326 blocking buffer (0.1% TBST containing 5% skim milk). A rabbit polyclonal 327 antibody was generated by Pacific Immunology to HysA that was purified as 328 described above. HysA was probed for used at a dilution of 1:40,000 with the 329 anti-HysA rabbit serum for 1 h at room temperature in blocking buffer. The 330 membrane was then washed three times for 10 min each in 0.1% TBST. 331 Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG was applied at 1:20,000 332 in blocking buffer at room temperature for 1 h. Membranes were washed three 333 times for 10 min each with 0.1% TBST and SuperSignal West Pico 334 chemiluminescent substrate was added to detect proteins followed by exposure 335 to Classic X-Ray Film. 336 337 Neutropenic murine pneumonia model 338 Female Balb/c mice were purchased from National Cancer Institute (Frederick, 339 MD). All animals were housed under specific pathogen-free conditions in filter-340 top cages at Walter Reed Army Institute of Research (WRAIR) Animal Facility 341 and provided sterile food and water ad libitum. Six to eight week old mice were 342 injected intraperitoneally with 150 mg/kg of cyclophosphamide (Baxter) four days 343 prior to infection and 100 mg/kg one day prior to infection as previously described 344 (34). Mice were anesthetized with isoflurane and infected intranasally with 1.0 x 345


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

15

107 CFU of S. aureus suspended in 25 µL of PBS. At 48 hours post-infection, 346 mice were euthanized and lungs were extracted, homogenized, and serial diluted 347 before lung suspensions were plated onto TSA. Colony-forming units were 348 enumerated to assess bacterial burden. For survival studies, infected mice were 349 monitored twice a day for signs of morbidity. Following sacrifice, paraffin-350 embedded lung samples from infected and uninfected mice were sectioned and 351 stained with hematoxylin and eosin (H&E). All procedures were performed in 352 accordance with a protocol approved by the WRAIR Institutional Animal Care 353 and Use Committee (protocol # IB02-10). 354 355 Immunohistochemistry 356 The lungs of PBS-treated and infected mice were harvested at 48 h post-357 infection, fixed in 4.0% paraformaldeyhyde and cut into 5 μm sections. As a 358 control, uninfected lung samples were pretreated with 100 Turbidity Reducing 359 Units (TRU) of Streptomyces hyalurolyticus hyaluronidase (Sigma) for 2 h at 360 60°C (35). Hyaluronic acid was labeled as previously described (36). Briefly, 361 samples were incubated in 0.2 % BSA for 2 h at 4 °C to block nonspecific 362 binding. Following incubation, samples were treated with 2 μg/mL of biotinylated 363 hyaluronic acid binding protein (EMD Biosciences) for 16 h at 4 °C. FITC-364 conjugated streptavidin (Invitrogen) was used to visualize hyaluronic acid. The 365 presence of hyaluronic acid in lung sections was quantified by measuring the 366 mean fluorescent intensity of 40 fields per section. Images were acquired with an 367 Olympus AX80 microscope and analyzed with Image Pro 7.0 software. 368


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

16

369 370 371 Statistical analysis 372 Statistical significance of all data was analyzed using the Student’s t-test with 373 Graphpad Prism 6 software (Graphpad, La Jolla, CA) except for survival studies. 374 Survival studies were analyzed by Mantel-Cox test (p = 0.0022). 375 376 377 378


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

17

RESULTS 379 The gene encoding hyaluronidase (hysA) is conserved across all S. 380 aureus clonal lineages (8), and only one hyaluronidase is encoded on the 381 genome of CA-MRSA USA300 (37). The hysA gene (SAUSA300_2161) is 382 located near a number of genes of unknown function, and is transcribed by itself 383 in the opposite direction of neighboring genes (Fig. 1A). To begin our studies on 384 hysA, we created a markerless deletion construct in the strain AH1263 (38), an 385 erythromycin-sensitive version of the USA300 isolate LAC (hereafter called LAC-386 WT). The ΔhysA knockout mutant was confirmed by PCR and lack of enzymatic 387 cleavage of HA as detected by an agar plate assay (Fig. 1B). We also verified 388 the absence of hyaluronidase activity in the knockout mutant using a quantitative, 389 spectrophotometric assay (Fig. 1C). The HysA activity was complemented to 390 LAC-WT levels by providing hysA on a plasmid (Fig. 1), demonstrating the 391 phenotype was due to the mutant construction and not secondary or polar 392 effects. 393 The regulation of hysA has received only limited attention, although there 394 are reports for the potential involvement of global regulators sarA and agr (28, 395 29). To identify genetic loci that contribute to hysA regulation, we screened 1,952 396 mutants from the Nebraska Transposon Mutant Library (NTML) (39) for 397 hyaluronidase activity using a HA plate assay. Screening of the NTML resulted in 398 the identification of 8 bursa aurealis transposon insertions that significantly 399 altered hyaluronidase activity. To determine the relative extent that each 400 mutation affected activity, five replicates of each mutant were spotted on HA 401


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

18

plates and zone size was enumerated with a caliper (Fig. 2A). NTML wild-type 402 (WT) strain JE2 resulted in an average zone size of 1.01 cm (±0.02), while a 403 mutation in hysA resulted in no detectable zone of clearing. Multiple strains with 404 insertions in the sigma-factor B operon (sigB, rsbU, and rsbW), and strains with 405 insertions in sarA, hslU, and codY resulted in elevated hyaluronidase activity. 406 Interestingly, insertion into the putative deaminase, SAUSA300_0543, gave a 407 reduced zone of clearing of HA (0.76 ± 0.03 cm) and was the only mutation in the 408 library besides hysA to have a smaller zone size when compared to WT zone 409 size. 410

To quantitatively measure the effect of the identified transposon insertions 411 on hyaluronidase activity, we performed a spectrophotometric specific activity 412 assay on spent media of 8-hour cultures (Fig. 2B). In support of the HA plate 413 assay, the codY transposon mutant was found to increase activity 12-fold 414 compared to WT. Additionally, multiple insertions in the sigB operon, as well as 415 one in hslU increased activity approximately 3-fold, and an insertion in sarA 416 resulted in a 10-fold increase. The transposon insertion in SAUSA300_0543 had 417 one third of the activity of WT (Fig. 2B), similar to the reduction in activity 418 observed in the HA plate assay. As expected, there was no activity observed in 419 this assay by the hysA transposon mutant. 420

Despite previous reports of agr quorum-sensing involvement in hysA 421 regulation (28), we did not find any insertions in the agr locus to significantly alter 422 hyaluronidase activity in our screen. We hypothesized that perhaps this was due 423 to the previous study using S. aureus strain 8325-4, which has a known mutation 424


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

19

in rsbU that results in a defect in SigB activity. As shown in Fig. 2, we found 425 multiple mutations in the sigB operon, including a mutation in rsbU, that increase 426 hyaluronidase activity. Thus a role for agr could be masked in the USA300 427 background that has an intact rsbU gene. To investigate this question, we shifted 428 our studies to the USA300 LAC (LAC-WT) background, and we quantified HysA 429 activity in LAC-WT as well as agr, sigB, and agr sigB double mutant strains. We 430 found that HysA activity was unchanged in an agr mutant and increased 431 significantly in a sigB mutant. Comparing the sigB agr double mutant to the sigB 432 mutant (Fig. 3A), there is a significant decrease in activity when agr is 433 deactivated. This observation is in agreement with published reports (28), and 434 we also made similar observations in the USA400 MW2 background (data not 435 shown), indicating this effect occurs across multiple S. aureus strain types. 436

CodY is reported to regulate the agr system (40, 41), and we 437 hypothesized that some hysA regulation might be occurring indirectly through the 438 known CodY - agr interactions. To address this question, we initially confirmed 439 the CodY effect was consistent in the LAC background by crossing the 440 transposon insertion into LAC-WT, and we observed that HysA activity increased 441 16-fold in the codY mutant over LAC-WT (data not shown). Next, we quantified 442 HysA activity in LAC-WT, as well as agr, codY, and agr codY double mutant 443 strains (Fig. 3B). As anticipated, HysA activity was unchanged in an agr mutant 444 and increased in a codY mutant. However, HysA activity was significantly 445 decreased in the agr codY double mutant when compared to the codY mutant 446 (Fig. 3B). We speculated that the unnaturally high levels of RNAIII in the codY 447


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

20

mutant could be distorting HysA production. To test this question, we 448 transformed USA300 WT with a plasmid that expresses RNAIII under the control 449 of a tetracycline inducible promoter. In the absence of inducer, there was 450 essentially no difference in HysA activity between this strain and an empty vector 451 control (Fig. 3C). However, HysA activity increased with induction of RNAIII 452 expression compared to the control (Fig. 3C). Collectively, this data led us to 453 suggest the model depicted in Figure 3D for CodY and agr-mediated regulation 454 of HysA. 455

In considering the regulatory model (Fig. 3D), it still remained possible that 456 CodY directly regulated hysA gene expression. The CodY regulon has been 457 previously investigated (40-42), and hysA was not identified as a target in any of 458 these studies. We inspected the sequence upstream of hysA for the presence of 459 the previously published CodY consensus binding box (40), and we found a well-460 conserved CodY binding box 202 base pairs upstream of the putative 461 translational start site (Fig. 4A), with one nucleic acid change from a cytosine to a 462 thymine in the region between the inverted repeat. The presence of this box lead 463 us to predict that CodY may interact with the hysA putative promoter region. To 464 confirm that we were not being misled by the hyaluronidase activity assays, we 465 tested to see if the HysA protein levels increased accordingly in a codY mutant. 466 We used an antibody developed to HysA and found enzyme levels were 467 increased in a codY mutant compared to the WT strain by immunoblot (Fig. 4B). 468 To eliminate background binding in the immunoblot, Protein A was inactivated in 469 each of these strains. The band corresponding to HysA was not detected in a 470


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

21

codY hysA double-mutant, demonstrating the antibody was specific and 471 suggesting the increase in hyaluronidase activity is due to elevated HysA levels. 472 Also of note, HysA was not stable in spent media and we frequently observed 473 lower molecular weight breakdown products by immunoblot (Fig. 4B) 474

To assess whether CodY was acting to directly regulate hysA, we 475 constructed plasmids with CodY binding box mutations in the hysA promoter 476 region (Fig. 4C). As our testing system, we used the LAC ΔhysA mutant with 477 plasmid pHysA, which complements to near WT levels of hyaluronidase activity 478 (Fig. 1C). Using pHysA as a backbone, we introduced 5-6 nucleotide 479 substitutions from the consensus into the CodY box, and these were based on 480 previous studies in Bacillus subtilis where this number of changes was sufficient 481 to disrupt CodY based repression (43). These constructs were tested by 482 transforming them into the LAC ΔhysA mutant or ΔhysA codY double mutant and 483 measuring HysA activity from plasmid expression. We first introduced “A-to-C” 484 and “T-to-C” changes into the first half-site of the box in constructs pCR04 and 485 pCR05 (Fig. 4C). In testing these constructs, the CodY-based repression of 486 HysA activity was reduced markedly to approximately 2-fold (Fig. 4D). We made 487 additional, independent nucleotide changes in the second box half-site in 488 construct pCR06 (Fig. 4C), and CodY based repression of HysA activity was 489 completely eliminated (Fig. 4D). These results provide strong support that CodY 490 directly regulates hysA expression through binding to the identified box in the 491 promoter region. 492


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

22

Finally, we took advantage of the CodY response to the availability of 493 branched chain amino acids (BCAA) to test the possibility that CodY represses 494 HysA production in response to environmental changes. CodY gains a high 495 affinity for target promoters when BCAA are available, leading to repression of its 496 targets. When BCAA are limiting, CodY loses this affinity, such as when cells are 497 in stationary phase or under starvation, resulting in relieved repression of CodY 498 targets (44, 45). We grew LAC-WT in chemically defined media (CDM) lacking 499 isoleucine, or in CDM with standard levels of BCAA, until the cells began to enter 500 stationary phase (Fig. 5A). If hysA is under CodY control, we would anticipate 501 increased HysA activity in the cells grown without isoleucine compared to those 502 grown in CDM with standard levels of BCAA. In support of this hypothesis, there 503 was more than a 2.5-fold increase in hyaluronidase activity when BCAA were 504 limiting, as compared to bacteria grown in CDM at both 4 and 5 hours (Fig. 5B). 505

We also tested the impact of high levels of BCAA on CodY repression. 506 The cells grown in media lacking isoleucine were switched to media that 507 contained excess BCAA. If hysA is under CodY control, we would anticipate the 508 excess BCAA would bind to CodY and repress expression. As predicted, when 509 BCAA were supplied in excess, HysA dropped over 5-fold compared to cells 510 grown in CDM (Fig. 5B). These activity changes were not due to differences in 511 growth (Fig. 5A). As a control, samples were taken from each time point and 512 immunoblots were performed for Panton-Valentine Leukocidin (PVL) (Fig. 5C & 513 D), which is known to be regulated by CodY in USA300 lineages (46). The 514


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

23

trends in PVL production mirrored those of HysA at all the conditions tested, 515 suggesting they are regulated in a similar manner. 516 To determine whether HysA is required for virulence, neutropenic Balb/c 517 mice were infected intranasally with 1 x 107 CFU of either LAC-WT or the ΔhysA 518 mutant. After 4 days of infection, ~80% of mice infected with LAC-WT 519 succumbed to infection, which is in striking contrast to only ~20% death in mice 520 infected with the ΔhysA mutant (Fig. 6A). A 4-log reduction in bacterial burden in 521 the lungs at 48 hours post-infection was observed with the ΔhysA mutant 522 compared to LAC-WT (Fig. 6B), suggesting the virulence defect was likely 523 caused by an inability of the mutant to replicate in the lungs of infected mice. 524

The hyaluronidase activity of multiple Gram-positive pathogens has been 525 shown to cause severe tissue damage in vivo (12, 13, 28). Therefore, we 526 investigated whether loss of virulence of the ΔhysA mutant strain was associated 527 with reduced tissue damage in the lung. Histological analysis showed that the 528 lungs of mice infected with the ΔhysA mutant exhibited less pathology and influx 529 of alveolar macrophages than LAC-WT infected mice (Fig. 6C). To determine 530 whether hyaluronidase activity contributed to virulence of S. aureus in vivo, HA 531 was fluorescently labeled and quantified in the lungs of infected mice. There was 532 a significant increase in HA (P<0.0001) present in the lungs of ΔhysA mutant-533 infected mice compared to LAC-WT infected mice (Fig. 7A & B). In fact, the level 534 of HA present in the lungs of wild-type infected mice is similar to that found in the 535 lungs of mice treated with purified hyaluronidase from Streptomyces 536


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

24

hyalurolyticus (Fig. 7C). Taken together, these findings show that hysA is an 537 important determinant for causing a S. aureus infection. 538 539 540 541


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

25

DISCUSSION 542 Hyaluronidases are thought to act as “spreading factors”, allowing for 543

dissemination of pathogens throughout mammalian tissue during infection (9). In 544 fact, the earliest studies on spreading factors described it as an agent that 545 increases lesion size when combined with various bacterial and viral pathogens 546 (17, 21). In this report, we investigated the regulation and in vivo function of 547 HysA during S. aureus infection using a CA-MRSA USA300 strain, and we found 548 that HysA is indeed an important factor for causing an infection. 549

Through our screen of the NTML, we identified 8 mutations that 550 significantly altered HysA activity, including sarA, multiple mutations in the sigB 551 operon, and an uncharacterized nucleoside deaminase encoded by gene 552 SAUSA300_0543. The deaminase was the only target identified that is required 553 for full expression of HysA. Surprisingly, we did not identify mutations in the agr 554 locus during the screen, although it was reported that that agr is required for 555 HysA production (28). Considering the previous studies were done with a strain 556 with a natural mutation in rsbU, which is known to mimic a sigB mutant and 557 elevate agr function (47), we investigated this question. When an agr deletion 558 was introduced into a sigB mutant, we observed a drop in HysA activity (Fig. 3A), 559 supporting the previous studies. Taken together, when the agr system is hyper-560 activated, HysA levels increase, and by removing the agr locus these levels drop, 561 which supports the previously identified agr-dependent regulation. We 562 speculated that this agr role only occurred at unnaturally high levels of RNAIII, 563 and we confirmed this by expressing RNAIII from a plasmid and boosting HysA 564


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

26

output. Thus, agr has a role in HysA production, but it only seems to be 565 important in situations where RNAIII is elevated beyond normal WT levels. 566

Interestingly, our screen of the NTML revealed that a mutation in the 567 global regulator CodY resulted in increased HysA activity. CodY responds to 568 intracellular concentrations of branched chain amino-acids in S. aureus to control 569 target gene expression (33, 40, 41, 44). We initially speculated that the CodY 570 regulation might be indirect through the agr system, and indeed the introduction 571 of an agr deletion reduced HysA production in a codY mutant (Fig. 3B). 572 However, we observed that the hysA promoter region had a near perfect CodY 573 binding box (Fig. 4A), and importantly nucleotide changes to the conserved 574 positions of the box eliminated CodY-based repression (Fig. 4C & D). Thus, 575 there are indirect and direct mechanisms of CodY-dependent regulation 576 occurring to coordinate HysA production in S. aureus. 577

CodY-dependent regulation suggests that HysA has a potential nutrient 578 scavenging function. HA is a major component of the viscous substance 579 produced by connective tissues, and it acts as a host defense mechanism by 580 creating a protective barrier that impedes penetration of bacteria and bacterial 581 products into deeper tissues (48). Sequestration of essential nutrients, such as 582 iron (49) and tryptophan (50), is another mechanism of bacterial infection 583 prevention that works through generation of nutrient-limited environments. 584 Bacterial pathogens can rapidly adapt to these hostile situations by regulating the 585 expression of genes important for virulence and metabolism (51), and our 586 findings suggest that S. aureus uses CodY to regulate HysA in this manner. HA 587


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

27

can be broken down by hyaluronidases produced by a variety of bacterial 588 pathogens, such as Streptococcus pyogenes, Streptococcus pneumoniae, and 589 Mycobacterium tuberculosis (9), and metabolized as a source of carbon (52-54). 590 At this time, it has not been clearly demonstrated that S. aureus can use HA as a 591 carbon source in vivo, or whether HysA is involved in this growth mechanism, 592 both questions are in need of further examination. However, it is possible that the 593 reduction in bacterial burden in a ΔhysA mutant during pulmonary (Fig. 6B) and 594 soft-tissue infections (28) can be explained by an inability of S. aureus to utilize 595 an alternative carbon source under nutrition-limited conditions in vivo. 596

This finding is consistent with previous work showing that CodY regulates 597 other virulence factors to act as a link between metabolism and virulence (33). 598 For example, the hemolysins (α and β), as well as the secreted proteases SspA 599 and SspB, have been shown to be regulated directly by CodY. HysA was 600 required for the breakdown of HA in vivo and this correlated with a loss in 601 structural integrity and enhanced necrosis of pulmonary tissues, allowing the 602 pathogen access to deeper tissues. In addition to HysA, S. aureus possesses 603 other mechanisms for penetrating the host. One example is a secreted cysteine 604 protease, Staphopain A, which is able to induce vascular leakage during a 605 guinea pig infection (55), and this effect can be augmented by the addition of 606 another secreted cysteine protease, Staphopain B. Additionally, lipases have 607 been observed to enhance S. aureus tissue penetration (56). Taken together 608 these results indicate that HysA is part of a class of S. aureus secreted proteins 609 that act in coordinated fashion as spreading factors by breaking down host 610


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

28

tissues to facilitate bacterial dissemination (22). Interestingly, the target for each 611 enzyme differs despite the functional redundancy of these proteins. Considering 612 the dynamic range of infections caused by S. aureus, these findings lead us to 613 speculate that these spreading factors may be a part of a fine-tuned virulence 614 mechanism utilized by this pathogen to non-specifically breakdown host barriers 615 and promote dissemination from any site of infection. 616

Our studies give new insights into the regulation and role of the S. aureus 617 virulence factor HysA. This work identified an important link between metabolism 618 and virulence by illustrating a relationship between the metabolic regulator CodY 619 and the virulence factor HysA. By therapeutic targeting of HysA and other 620 spreading factors, it might be possible to prevent localized infections from 621 evolving into more complicated, systemic disease. 622 623 624 on M

arch 27, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

29

ACKNOWLEDGEMENTS 625 We thank Heidi Crosby for assistance with strain construction. We would like to 626 acknowledge National Institutes of Health training grant 5T32GM008365-22 and 627 NIH/NIDCR Award T90 DE023520 for supporting C.B.R. during this work. The 628 Zurawski Lab is supported by multiple grants from the Military Infectious 629 Diseases Research Program (MIDRP) and the Defense Medical Research and 630 Development Program (DMRDP). All animal research was conducted in 631 compliance with the Animal Welfare Act and other federal statutes and 632 regulations relating to animals and experiments involving animals and adheres to 633 principles stated in the Guide for the Care and Use of Laboratory Animals, NRC 634 Publication, 2011 edition. The findings and opinions expressed herein belong to 635 the authors and do not necessarily reflect the official views of the WRAIR, the 636 U.S. Army, Department of Defense or the U.S Food and Drug Administration. 637 638 639


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

30

REFERENCES 640 1. Noskin, G. A., R. J. Rubin, J. J. Schentag, J. Kluytmans, E. C. 641

Hedblom, C. Jacobson, M. Smulders, E. Gemmen, and M. Bharmal. 642 2007. National trends in Staphylococcus aureus infection rates: impact on 643 economic burden and mortality over a 6-year period (1998-2003). Clin. 644 Infect. Dis. 45:1132-40. 645

2. Lowy, F. D. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 646 339:520-32. 647

3. Gordon, R. J., and F. D. Lowy. 2008. Pathogenesis of methicillin-648 resistant Staphylococcus aureus infection. Clin. Infect. Dis. 46 Suppl 649 5:S350-9. 650

4. David, M. Z., and R. S. Daum. 2010. Community-associated methicillin-651 resistant Staphylococcus aureus: epidemiology and clinical consequences 652 of an emerging epidemic. Clin. Microbiol. Rev. 23:616-87. 653

5. DeLeo, F. R., and H. F. Chambers. 2009. Reemergence of antibiotic-654 resistant Staphylococcus aureus in the genomics era. J. Clin. Invest. 655 119:2464-74. 656

6. Chambers, H. F., and F. R. Deleo. 2009. Waves of resistance: 657 Staphylococcus aureus in the antibiotic era. Nat. Rev. Microbiol. 7:629-41. 658

7. Li, M., B. A. Diep, A. E. Villaruz, K. R. Braughton, X. Jiang, F. R. 659 DeLeo, H. F. Chambers, Y. Lu, and M. Otto. 2009. Evolution of virulence 660 in epidemic community-associated methicillin-resistant Staphylococcus 661 aureus. Proc. Natl. Acad. Sci. USA 106:5883-8. 662

8. Hart, M. E., M. J. Hart, and A. J. Roop. 2009. Genotypic and Phenotypic 663 Assessment of Hyaluronidase among Type Strains of a Select Group of 664 Staphylococcal Species. Int. J. Microbiol. 2009:614371. 665

9. Hynes, W. L. W., S.L. 2000. Hyaluronidases of Gram-positive bacteria. 666 FEMS Microbiol. Lett. 183:201-207. 667

10. Laurent, T. C. F., J..R.E. 1992. Hyaluronan. FASEB J. 6:2397-2404. 668 11. Jiang, D. L., J.; Noble, P.W. 2011. Hyaluronan as an Immune Regulator 669

in Human Diseases. Physiol. Rev. 91. 670 12. Smith, L. D. 1979. Virulence Factors of Clostridium perfringens. Rev. 671

Infect. Dis. 1:254-262. 672 13. Starr, C. R., and N. C. Engleberg. 2006. Role of hyaluronidase in 673

subcutaneous spread and growth of group A Streptococcus. Infect. 674 Immun. 74:40-8. 675

14. Li, S., and M. J. Jedrzejas. 2001. Hyaluronan binding and degradation by 676 Streptococcus agalactiae hyaluronate lyase. J. Biol. Chem. 276:41407-16. 677

15. Li, S. K., S.J.; Lamani, E.; Ferraroni, M.; Jedrzejas, M.J. 2000. 678 Structural basis of hyaluronan degradation by Streptococcus pneumoniae 679 hyaluronate lyase. EMBO J. 19:1228-1240. 680

16. Zheng, M., H. Zhang, and D. Xu. 2012. Initial events in the degradation of 681 hyaluronan catalyzed by hyaluronate lyase from Spectrococcus 682 pneumoniae: QM/MM simulation. J Phys Chem B 116:11166-72. 683


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

31

17. Duran-Reynals, F. 1933. Studies on a Certain Spreading Factor Existing 684 in Bacteria and Its Signficance for Bacterial Invasiveness. J. Exp. Med. 58. 685

18. Chain, E. D., ES. 1940. Identity of Hyaluronidase and Spreading Factor. 686 British J. Exp. Path. 21:324-338. 687

19. Favilli, G. 1940. Mucolytic Effect of Natural and Artificial Spreading 688 Factors: Mucolytic Effect of Several Diffusing Agents and of a Dlazotized 689 Compound. Nature 145:866-867. 690

20. McClean, D. H., CW. 1940. Mucolytic Effect of Natural and Artificial 691 Spreading Factors: Mucinase and Tissue Permeability. Nature 145:867-692 868. 693

21. Duran-Reynals, F. 1942. Tissue Permeability and the Spreading Factors 694 in Infection: A Contribution to the Host:Parasite Problem. Bacteriol. Rev. 695 6:197-252. 696

22. Hobby, G. L. D., Martin H.; Meyer, Karl; Chaffee, Eleanor. 1941. The 697 Relationship Between Spreading Factor and Hyaluronidase. J. Exp. Med. 698 73:109-123. 699

23. Rogers, H. 1953. Variant populations within a hyaluroni-dase-producing 700 culture of Staphylococcus aureus. J. Path. Bacteriol. 66:545-551. 701

24. Rogers, H. 1954. The Rate of Formation of Hyaluronidase, Coagulase 702 and Total Extracellular Protein by Strains of Staphylococcus aureus. J. 703 Gen. Microbiol. 10:209-220. 704

25. Rogers, H. 1957. The Preferential Suppression of Hyaluronidase 705 Formation in Cultures of Staphylococcus aureus. J. Gen. Microbiol. 16:22-706 37. 707

26. Farrell, A. M. T., David; Holland, Keith T. 1995. Cloning, nucleotide 708 sequence determination and expression of the Staphylococcus aureus 709 hyaluronate lyase gene. FEMS Microbiology Letters 130:81-85. 710

27. Jones, R. C., J. Deck, R. D. Edmondson, and M. E. Hart. 2008. Relative 711 quantitative comparisons of the extracellular protein profiles of 712 Staphylococcus aureus UAMS-1 and its sarA, agr, and sarA agr regulatory 713 mutants using one-dimensional polyacrylamide gel electrophoresis and 714 nanocapillary liquid chromatography coupled with tandem mass 715 spectrometry. J. Bacteriol. 190:5265-78. 716

28. Makris, G., J. D. Wright, E. Ingham, and K. T. Holland. 2004. The 717 hyaluronate lyase of Staphylococcus aureus - a virulence factor? 718 Microbiology 150:2005-13. 719

29. Hart, M. E., L. H. Tsang, J. Deck, S. T. Daily, R. C. Jones, H. Liu, H. 720 Hu, M. J. Hart, and M. S. Smeltzer. 2013. Hyaluronidase expression and 721 biofilm involvement in Staphylococcus aureus UAMS-1 and its sarA, agr 722 and sarA agr regulatory mutants. Microbiology 159:782-91. 723

30. Schenk, S. L., R.A. 1992. Improved method for electroporation of 724 Staphylococcus aureus. FEMS Microbiol. Lett. 94:133-138. 725

31. Wormann, M. E., N. T. Reichmann, C. L. Malone, A. R. Horswill, and A. 726 Grundling. 2011. Proteolytic cleavage inactivates the Staphylococcus 727 aureus lipoteichoic acid synthase. J. Bacteriol. 193:5279-91. 728


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

32

32. Bose, J. L., P. D. Fey, and K. W. Bayles. 2013. Genetic tools to enhance 729 the study of gene function and regulation in Staphylococcus aureus. Appl. 730 Environ. Microbiol. 79:2218-24. 731

33. Pohl, K., P. Francois, L. Stenz, F. Schlink, T. Geiger, S. Herbert, C. 732 Goerke, J. Schrenzel, and C. Wolz. 2009. CodY in Staphylococcus 733 aureus: a regulatory link between metabolism and virulence gene 734 expression. J Bacteriol 191:2953-63. 735

34. Thompson, M. G., C. C. Black, R. L. Pavlicek, C. L. Honnold, M. C. 736 Wise, Y. A. Alamneh, J. K. Moon, J. L. Kessler, Y. Si, R. Williams, S. 737 Yildirim, B. C. Kirkup, Jr., R. K. Green, E. R. Hall, T. J. Palys, and D. V. 738 Zurawski. 2014. Validation of a Novel Murine Wound Model of 739 Acinetobacter baumannii Infection. Antimicrob. Agents Chemother. 740 58:1332-42. 741

35. El-Chemaly, S., D. Malide, E. Zudaire, Y. Ikeda, B. A. Weinberg, G. 742 Pacheco-Rodriguez, I. O. Rosas, M. Aparicio, P. Ren, S. D. 743 MacDonald, H. P. Wu, S. D. Nathan, F. Cuttitta, J. P. McCoy, B. R. 744 Gochuico, and J. Moss. 2009. Abnormal lymphangiogenesis in idiopathic 745 pulmonary fibrosis with insights into cellular and molecular mechanisms. 746 Proc. Natl. Acad. Sci. 106:3958-63. 747

36. Monzon, M. E., S. M. Casalino-Matsuda, and R. M. Forteza. 2006. 748 Identification of glycosaminoglycans in human airway secretions. Am. J. 749 Respir. Cell. Mol. Biol. 34:135-41. 750

37. Diep, B. A., S. R. Gill, R. F. Chang, T. H. Phan, J. H. Chen, M. G. 751 Davidson, F. Lin, J. Lin, H. A. Carleton, E. F. Mongodin, G. F. 752 Sensabaugh, and F. Perdreau-Remington. 2006. Complete genome 753 sequence of USA300, an epidemic clone of community-acquired meticillin-754 resistant Staphylococcus aureus. Lancet. 367:731-9. 755

38. Boles, B. R. T., Matthew; Roth, Aleeza J.; Horswill, Alexander R. 2010. 756 Identification of Genes Involved in Polysaccharide-Independent 757 Staphylococcus aureus Biofilm Formation. PLoS ONE 5. e10146. 758

39. Fey, P. D., J. L. Endres, V. K. Yajjala, T. J. Widhelm, R. J. Boissy, J. L. 759 Bose, and K. W. Bayles. 2013. A genetic resource for rapid and 760 comprehensive phenotype screening of nonessential Staphylococcus 761 aureus genes. MBio 4:e00537-12. 762

40. Majerczyk, C. D., P. M. Dunman, T. T. Luong, C. Y. Lee, M. R. 763 Sadykov, G. A. Somerville, K. Bodi, and A. L. Sonenshein. 2010. 764 Direct Targets of CodY in Staphylococcus aureus. J. Bacteriol. 192:2861-765 2877. 766

41. Majerczyk, C. D., M. R. Sadykov, T. T. Luong, C. Lee, G. A. Somerville, 767 and A. L. Sonenshein. 2007. Staphylococcus aureus CodY Negatively 768 Regulates Virulence Gene Expression. J. Bacteriol. 190:2257-2265. 769

42. Rivera, F. E., H. K. Miller, S. L. Kolar, S. M. Stevens, and L. N. Shaw. 770 2012. The impact of CodY on virulence determinant production in 771 community-associated methicillin-resistant Staphylococcus aureus. 772 Proteomics 12:263-268. 773


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

33

43. Belitsky, B. R., and A. L. Sonenshein. 2008. Genetic and biochemical 774 analysis of CodY-binding sites in Bacillus subtilis. J. Bacteriol. 190:1224-775 36. 776

44. Brinsmade, S. R., R. J. Kleijn, U. Sauer, and A. L. Sonenshein. 2010. 777 Regulation of CodY Activity through Modulation of Intracellular Branched-778 Chain Amino Acid Pools. J. Bacteriol. 192:6357-6368. 779

45. Stenz, L., P. Francois, K. Whiteson, C. Wolz, P. Linder, and J. 780 Schrenzel. 2011. The CodY pleiotropic repressor controls virulence in 781 gram-positive pathogens. FEMS Immunol. Med. Microbiol. 62:123-39. 782

46. Montgomery, C. P., S. Boyle-Vavra, A. Roux, K. Ebine, A. L. 783 Sonenshein, and R. S. Daum. 2012. CodY deletion enhances in vivo 784 virulence of community-associated methicillin-resistant Staphylococcus 785 aureus clone USA300. Infect. Immun. 80:2382-9. 786

47. Lauderdale, K. J., B. R. Boles, A. L. Cheung, and A. R. Horswill. 2009. 787 Interconnections between Sigma B, agr, and proteolytic activity in 788 Staphylococcus aureus biofilm maturation. Infect. Immun. 77:1623-35. 789

48. Fraser, J. R., T. C. Laurent, and U. B. Laurent. 1997. Hyaluronan: its 790 nature, distribution, functions and turnover. J. Internal Med. 242:27-33. 791

49. Skaar, E. P. 2010. The battle for iron between bacterial pathogens and 792 their vertebrate hosts. PLoS Pathog. 6:e1000949. 793

50. Jones, C. L., B. A. Napier, T. R. Sampson, A. C. Llewellyn, M. R. 794 Schroeder, and D. S. Weiss. 2012. Subversion of host recognition and 795 defense systems by Francisella spp. Microbiol. Mol. Biol. Rev. 76:383-796 404. 797

51. Somerville, G. A., and R. A. Proctor. 2009. At the crossroads of bacterial 798 metabolism and virulence factor synthesis in Staphylococci. Microbiol. 799 Mol. Biol. Rev. 73:233-48. 800

52. Costagliola, C. D. P., Antonio; Winkler, Neil R.; Carpineto, Paolo; 801 Ciancaglini, Marco; Piccolomini, Raffaele; Mastropasqua, Leonardo. 802 1996. The ability of bacteria to use Na-hyaluronate as a nutrient. Acta 803 Ophthalmologica Scandinavica 74:566-568. 804

53. Marion, C., J. M. Stewart, M. F. Tazi, A. M. Burnaugh, C. M. Linke, S. 805 A. Woodiga, and S. J. King. 2012. Streptococcus pneumoniae can utilize 806 multiple sources of hyaluronic acid for growth. Infect. Immun. 80:1390-8. 807

54. Hirayama, Y., M. Yoshimura, Y. Ozeki, I. Sugawara, T. Udagawa, S. 808 Mizuno, N. Itano, K. Kimata, A. Tamaru, H. Ogura, K. Kobayashi, and 809 S. Matsumoto. 2009. Mycobacteria exploit host hyaluronan for efficient 810 extracellular replication. PLoS Pathog. 5:e1000643. 811

55. Imamura, T., S. Tanase, G. Szmyd, A. Kozik, J. Travis, and J. 812 Potempa. 2005. Induction of vascular leakage through release of 813 bradykinin and a novel kinin by cysteine proteinases from Staphylococcus 814 aureus. J Exp Med 201:1669-76. 815

56. Stehr, F., M. Kretschmar, C. Kröger, B. Hube, and W. Schäfer. 2003. 816 Microbial lipases as virulence factors. J. Molecular Catalysis B: Enzymatic 817 22:347–355. 818


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

34

57. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of 819 chromosomal genes in Escherichia coli K-12 using PCR products. Proc. 820 Natl. Acad. Sci. 97:6640-5. 821

58. Nair, D., G. Memmi, D. Hernandez, J. Bard, M. Beaume, S. Gill, P. 822 Francois, and A. L. Cheung. 2011. Whole-genome sequencing of 823 Staphylococcus aureus strain RN4220, a key laboratory strain used in 824 virulence research, identifies mutations that affect not only virulence 825 factors but also the fitness of the strain. J. Bacteriol 193:2332-5. 826

59. Benson, M. A., S. Lilo, G. A. Wasserman, M. Thoendel, A. Smith, A. R. 827 Horswill, J. Fraser, R. P. Novick, B. Shopsin, and V. J. Torres. 2011. 828 Staphylococcus aureus regulates the expression and production of the 829 staphylococcal superantigen-like secreted proteins in a Rot-dependent 830 manner. Mol. Microbiol. 81:659-75. 831

60. Mootz, J. M., C. L. Malone, L. N. Shaw, and A. R. Horswill. 2013. 832 Staphopains modulate Staphylococcus aureus biofilm integrity. Infect 833 Immun 81:3227-38. 834

61. Kiedrowski, M. R., J. S. Kavanaugh, C. L. Malone, J. M. Mootz, J. M. 835 Voyich, M. S. Smeltzer, K. W. Bayles, and A. R. Horswill. 2011. 836 Nuclease modulates biofilm formation in community-associated methicillin-837 resistant Staphylococcus aureus. PLoS ONE 6:e26714. 838

62. Olson, M. E., J. M. King, T. L. Yahr, and A. R. Horswill. 2013. Sialic 839 Acid Catabolism in Staphylococcus aureus. J. Bacteriol. 195:1779-1788. 840

63. Bateman, B. T., N. P. Donegan, T. M. Jarry, M. Palma, and A. L. 841 Cheung. 2001. Evaluation of a tetracycline-inducible promoter in 842 Staphylococcus aureus in vitro and in vivo and its application in 843 demonstrating the role of sigB in microcolony formation. Infect. Immun. 844 69:7851-7. 845

846 847


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

35

Table 1. Oligonucleotides used in this study. 848 Oligo Sequence

CBR12 GTTGTTCCTGCAGGGATAAGCGATTCAATACTGACG

CBR13 GTTGTTCTCGAGTGTTGTTGTTACGCGTCATGTCTCCTTTTTGTGTTGCG

CBR14 GACGCGTAACAACAACACTCGAGGCAAGAAAATCTCGACACTATAC

CBR15 GTTGTTCCCGGGCAGTGCCGACAACAGATTGC

CBR29 GTTGTTGCTAGCGTATAGTGTCGAGATTTTCTTGC

CBR35 GTTGTTGGATCCCGATTCAATACTGACGCCTG

CBR41 GTTGTTGCTAGCGATACGAATGTTCAAACGCCAG

CBR42 GTTGTTCTCGAGGTGTCGAGATTTTCTTGCATT

CBR82 AGATTGATAATATTTCCCTCCCTGAAAATTATTTTAG

CBR83 CTAAAATAATTTTCAGGGAGGGAAATATTATCAATCT

CBR84 CTAAGATTGATAATATTTCATCCCCCGAAAATTATTTTAGT

CBR85 ACTAAAATAATTTTCGGGGGATGAAATAATATCAATCTTAG

CBR86 AATAATTAATTTTTTCCACCCCATTTTAGTTGCAATT

CBR87 AATTGCAACTAAAATGGGGTGGAAAAAATTAAATATT

spa_delA_EcoRI ATGGAATTCCAATCCACCATAAATACCCTCAA

spa_delB ACGCGTGGTACCGCTAGCCTTTTTCAAATTAATACCCCCTGTATG

spa_delC GCTAGCGGTACCACGCGTCGCGAACTATAAAAACAAACAATACAC

spa_delD SalI GATGTCGACGCTAAAGCGGGAGCAATTTTC

spa_upstream ATAGCGTGATTTTGCGGTTT

spa_downstream GCAACAAAAGATGTTGCTCGT

849 850 851 852


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

36

Table 2. Strains and plasmids. 853 Strain or Plasmid Description Source or

Reference Strains

E. coli

BW25141 Cloning strain (57) ER2566 Protein Expression strain New England

Biolabs DH5α Cloning/Protein Expression strain Gibco

AH2856 HysA Protein Expression strain; ER2566 containing pCR03

This work

S. aureus RN4220 Restriction-deficient 8325-4 (58)

AH1263 USA300 CA-MRSA Erms (LAC*) (38)

AH2525 AH1263 ΔhysA This work

AH2839 AH2525 containing pHysA This work

JE2 USA300 CA-MRSA ErmS, plasmid cured LAC derivative

(39)

AH2914 JE2 hysA::ΦΝΣ Ermr (39)

AH2936 JE2 sarA::ΦΝΣ Ermr (39)

AH2937 JE2 sigB::ΦΝΣ Ermr (39)

AH2938 JE2 rsbW::ΦΝΣ Ermr (39)

AH2939 JE2 rsbU::ΦΝΣ Ermr (39)

AH2942 JE2 SAUSA300_0543::ΦΝΣ Ermr (39)

AH2945 JE2 hslU::ΦΝΣ Ermr (39)

AH2946 JE2 codY::ΦΝΣ Ermr (39)

AH3052 AH1263 Δspa This work

AH3134 AH1263 Δspa codY::ΦΝΣ Ermr This work

AH3207 AH1263 Δspa codY::ΦΝΣ Tetr hysA::ΦΝΣ Ermr

This work

AH1292 AH1263 Δagr::tetM (59)

AH2032 AH1263 Δagr::tetM ΔsigB (59, 60)

AH1483 AH1263 ΔsigB (61)

AH3453 AH1263 Δagr::tetM codY:: ΦΝΣ Ermr This work

AH3172 AH1263 ΔhysA codY::ΦΝΣ Ermr This work

Plasmids

pET28a E. coli protein expression vector Novagen pJB38 S. aureus gene knockout vector, Camr (31)


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

37

pTet Antibiotic cassette replacement vetor, Camr, Ampr

(32)

pSKerm-MCS E. coli-S. aureus shuttle vector, Ermr Camr (62) pALC2073 E. coli-S. aureus shuttle vector, Camr (63) pALC2073-RNAIII

Tet inducible RNAIII expression, Camr (59)

pCR02 pJB38 hysA knockout vector, Camr This work pHysA (pCR01) hysA complementation plasmid, Camr Ermr This work pCR03 hysA 6X-His tagged E. coli protein expression

vector, Kanr This work

pCR04 pCR01 mutated CodY box, Camr, Ermr This work pCR05 pCR01 mutated CodY box, Camr, Ermr This work pCR06 pCR01 mutated CodY box, Camr, Ermr This work

854 855 856 857


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

38

Figure Legends 858 Figure 1. Generation and initial characterization of CA-MRSA USA300 859 ΔhysA mutant and complemented strains. A) Location of hysA on the CA-860 MRSA USA300 LAC chromosome, numbers indicate SAUSA300 locus numbers 861 (reference or source of loci). The hysA gene is surrounded by genes with 862 unknown function and is transcribed by itself on the chromosome. B) & C) 863 Hyaluronic acid (HA) plate and hyaluronidase specific activity assays of LAC 864 wild-type (WT), LACΔhysA, and complemented strains (pHysA), respectively. As 865 shown, HysA activity is abolished for the ΔhysA mutant and restored to WT 866 levels when complemented in both assays. 867 868 Figure 2. Transposon mutagenesis library screen for altered HysA activity. 869 A) Summary of results of screen for HysA activity on HA agarose plates. Values 870 reported as zone diameter (cm) clearings represent the mean ± standard 871 deviation of five technical replicates for each strain plated on HA agarose and 872 measured with a caliper. Pictures are representative images of each strain. B) 873 Hyaluronidase specific activity assay of strains containing mutations that 874 significantly altered HysA activity on HA agarose plates. The data are presented 875 as fold-changes as compared to the USA300 WT strain, JE2. Values represent 876 the mean and standard deviations of four technical replications for three 877 independent biological determinations. Statistical significance (****p<0.0001) was 878 determined by a Student’s T-test. 879 880


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

39

Figure 3. The role of the agr system in hysA gene regulation. Cultures of 881 various LAC strains were grown for 8 hr, spent media was prepared, and 882 hyaluronidase specific activity was measured in each sample. A) To assess the 883 agr and SigB interaction, activity was measured in WT, agr, sigB, and agr sigB 884 double mutant strains and plotted. B) To assess agr and CodY interaction, 885 activity was measured in WT, agr, codY and codY agr double mutant strains. 886 Statistical significance (****p< 0.0001) was determined by a Student’s T-Test. C) 887 Hyaluronidase specific activity for WT containing empty vector (black) or RNAIII 888 under a tetracycline inducible promoter (grey). A Student’s T-test was used to 889 determine statistical significance (**p< 0.01, ****p<0.001) D) Model for SigB and 890 CodY regulation of HysA through the agr system. 891 892 Figure 4. The CodY binding box is required for hysA regulation. A) 893 Location of the putative CodY binding box in the hysA promoter region. An 894 alignment of the consensus CodY binding box and the proposed hysA box is 895 shown B) Immunoblot for HysA performed in a LAC-WT strain. Spent media was 896 concentrated 20 or 50-fold from WT, codY, and codY hysA mutant strains as 897 indicated and immunoblotted for HysA. In each strain, a Δspa deletion was 898 engineered to remove background antibody binding. C) Mutations generated in 899 the CodY box in plasmids pCR04, pCR05, and pCR06 D) Hyaluronidase specific 900 activity assay at 8 hr for WT (LAC ΔhysA with plasmid) or codY (LAC ΔhysA 901 codY double mutant with plasmid) containing constructs pHysA, pCR04, pCR05, 902


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

40

or pCR06. Statistical analysis was performed using a Student’s T-Test 903 (***p<0.01). 904 905 Figure 5. The effect of nutrient availability on hysA regulation. A) Growth 906 curve of LAC-WT grown in CDM (black) or in CDM lacking isoleucine (orange) for 907 the first 5 h. Cells were harvested by centrifugation, washed 1X in PBS and 908 suspended either in fresh CDM (black) or CDM containing 5X BCAA (green). 909 Arrows indicate points where samples were taken, or where media was switched 910 as indicated. B) Hyaluronidase specific activity of samples taken at the 911 timepoints indicated in part A. Statistical analysis was performed using a 912 Student’s T-Test (****p< 0.0001) C) Immunoblot for the LukS subunit of PVL at 913 timepoints indicated in part A. D) Quantification of LukS Immunoblot using 914 ImageJ Software. “Post” indicates samples taken at timepoints after the media 915 switch. 916 917 Figure 6. HysA is required for USA300 virulence. Mice were intranasally 918 inoculated with 1.0 x 107 CFU of either LAC-WT strain, its ΔhysA mutant strain, 919 or PBS. A) Mice (n =27) were monitored daily for signs of morbidity and mortality 920 (Mantel-Cox test **p = 0.0022). B) Groups of mice (n=21) were euthanized after 921 48 hours and the bacterial burden in the lungs was quantified by CFU 922 enumeration. (**p=0.0095) C) Histopathology of the lungs from mice treated with 923 PBS or infected with either LAC-WT the ΔhysA mutant. Areas in the enlarged 924


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

41

boxes are indicated by the black arrow. Data are representative of three 925 independent experiments. 926 927 Figure 7. HysA is required for breakdown of hyaluronic acid in vivo. A & 928 B) Micrographs of immuno-fluorescently labeled HA of mouse lungs inoculated 929 with 1.0 x 107 CFU of either LAC-WT strain or its ΔhysA mutant strain. C) The 930 mean fluorescent intensity was quantified for each sample (40 fields per section). 931 A sample treated with hyaluronidase from Streptomyces hyalurolyticus is also 932 included as a control. (****p<0.0001) 933 934


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Downloaded from on March 3, 2020 by guest · svu aureus strains were grown in tryptic soy broth...

Documents

Transcript of Downloaded from on March 3, 2020 by guest · svu aureus strains were grown in tryptic soy broth...