Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated...
Transcript of Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated...
![Page 1: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/1.jpg)
1
IAI01205-09 Version3
Interactions of Encephalitozoon cuniculi Polar Tube Proteins
Boumediene Bouzahzah 1, FNU Nagajyothi 1, Kaya Ghosh 1, Peter M. Takvorian 1,2, Ann Cali 2,
Herbert B. Tanowitz1,2, Louis M. Weiss 1,3,#
1Department of Pathology, Division of Tropical Medicine and Parasitology, Albert Einstein
College of Medicine, 1300 Morris Park Avenue, Bronx, NY, 10461.
2Department of Biological Science 2, Rutgers University, 195 University Avenue, Boyden Hall,
Rutgers University, Newark, NJ 07102, USA
3Department of Medicine, Division of Infectious Diseases, Albert Einstein College of Medicine,
1300 Morris Park Avenue, Bronx, NY, 10461.
# Corresponding Author:
Louis M. Weiss MD MPH
Albert Einstein College of Medicine
1300 Morris Park Avenue
Room 504 Forchheimer Building
Bronx NY 10461
Tel: 1-718-430-2143
Fax: 1-718-4308543
email: [email protected]
Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.01205-09 IAI Accepts, published online ahead of print on 22 March 2010
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 2: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/2.jpg)
2
ABSTRACT
Microsporidia are eukaryotic, obligate intracellular organisms defined by their small spores
containing a single invasion organelle the polar tube which coils around the interior of the spore.
When the parasite infects host cells the polar tube is discharged from the anterior pole of the
spore where it can pierce the cell and transfer the sporoplasm into the cytoplasm of the host.
Three polar tube proteins (PTP1, PTP2 and PTP3) have been identified in this structure. The
interaction of these proteins in the assembly and function of the polar tube is not known. This
study was undertaken to examine the protein interactions of the Encephalitozoon cuniculi polar
tube proteins (EcPTPs). Immunofluorescence and immuno-electron microscopy confirmed the
co-localization of EcPTP1, EcPTP2 and EcPTP3 to the polar tube. Experiments using cross
linkers indicated that EcPTP1, EcPTP2 and EcPTP3 formed a complex in the polar tube, which
was confirmed by immunoprecipitation using EcPTP1 antiserum. Yeast two hybrid analysis
revealed that full length EcPTP1, EcPTP2 and EcPTP3 interact with each other in vivo. Both
the N- and C- termini of EcPTP1 were involved in these interactions, but not the central region
of this protein which contains a repetitive motif. Further studies of polar tube proteins and their
structural interactions may help elucidate the formation of the polar tube during the invasion
process.
Key Words: Polar tube protein, Encephalitozoon cuniculi, protein interactions, Yeast two hybrid
screening, invasion
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 3: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/3.jpg)
3
INTRODUCTION
The Microsporidia are obligate intracellular parasitic protists [28]. While historically they
have been considered “primitive” protozoa, molecular phylogenetic analysis has led to the
recognition that these organisms are not “primitive” but degenerate protists, and that they are
most closely related to the fungi and not to protozoa [18]. The Encephalitizoonidae have
genomes under 3.0 Mb, making them among the smallest eukaryotic nuclear genomes
identified [25]. Microsporidian genome data is available at EuPathdB (http://eupathdb.org/
eupathdb/). There is a high degree of gene conservation among the Microsporidia [2].
The Microsporidia are ubiquitous in the environment and infect almost all animal phyla
(invertebrate and vertebrate hosts), including other protists. They can produce a wide range of
clinical diseases. Diarrhea associated with microsporidiosis and HIV infection was first reported
in 1985 [7]. In addition to gastrointestinal tract involvement, it has been recognized that
Microsporidia can infect virtually any organ system; causing encephalitis, ocular infection,
sinusitis, myositis, and disseminated infections [28]. The phylum Microsporidia contains more
than 1200 species distributed into over 150 genera, of which species in the following genera
cause human infections: Nosema, Pleistophora, Encephalitozoon, Enterocytozoon, Septata
(reclassified as Encephalitozoon), Anncaliia, Trachipleistophora, Brachiola (reclassified as
Anncaliia), Vittaforma and Microsporidium [28].
Microsporidia form characteristic unicellular spores that are environmentally resistant
and characteristic of the phylum; however spore size and shape vary depending on the species.
The spore coat consists of an electron-dense, proteinaceous exospore, an electron-lucent
endospore composed of chitin and protein, and an inner membrane or plasmalemma [3, 24].
Spore coat proteins have adhesion domains that may facilitate the binding of spores to either
the cell surface or mucous of the gastrointestinal tract prior to germination [22]. A defining
characteristic of all Microsporidia is an extrusion apparatus that consists of a polar filament that
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 4: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/4.jpg)
4
coils around the sporoplasm and is attached to the inside of the anterior end of the spore by an
anchoring disk [23]. During germination, the polar filament forms a hollow tube that brings the
sporoplasm into intimate contact with the host cell providing a means of transfer of the
sporoplasm to the host cell without exposure to the extracellular environment [23]. The
mechanism by which the polar tube interacts with the host cell membrane is not known, but it
may require the participation of host cell proteins such as actin [9]. If a spore is phagocytosed
by a host cell germination can occur enabling the polar tube to pierce the phagocytic vacuole
delivering the sporoplasm into a host cell’s cytoplasm [10].
It is probable that the polar tube evolved prior to divergence of Microsporidia into
various genera, and is not the result of the convergence of independently-evolved polar tube
structures in different Microsporidia. The proteins comprising the polar tube are likely to be
members of a protein family that evolved from the same ancestral genes. The polar tube resists
dissociation in detergents, acids and chaotropic agents, but is soluble in reducing agents such
as 2-mercaptoethanol or dithiothreitol [13-18]. These solubility properties have facilitated the
development of a method for the purification of these proteins [18]. Proteomic and genetic
studies have defined some of the proteins of the polar tube and spore wall [31] as well as the
presence of O-mannosylatation on these proteins [30, 32]. Three distinct polar tube proteins
(PTPs) have been identified: PTP1, a proline-rich protein [6, 15]; PTP2, a lysine-rich protein [4],
and PTP3 a large protein over 135 kDa in size [20].
To understand the formation of the polar tube and the function of its various components
it is necessary to understand how PTP1, PTP2 and PTP3 interact with each other as well as
any other components of the polar tube. The preservation of cysteine residues in the various
PTP1s suggests that these residues may be involved in inter- and intra-protein linkages and
consequently, in the formation of the tube. As PTP1 is the major protein present in the polar
tube of the Microsporidia, we focused on studying possible interactions between this major
protein (EcPTP1) with itself and EcPTP2 and EcPTP3. In this paper, we demonstrate that
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 5: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/5.jpg)
5
Encephalitozoon cuniculi (Ec) PTP1, EcPTP2 and EcPTP3 interact with each other using a
yeast two hybrid system, a standard genetic method for exploring protein-protein interactions.
In addition, cross linking experiments confirm the existence of a protein complex containing
EcPTP1, EcPTP2 and EcPTP3.
MATERIAL AND METHODS
Culture and production of microsporidia spores. Encephalitozoon cuniculi were cultured at
37ºC in RK13 (Rabbit Kidney cells CCL37; American Type Culture Collection, Rockville. MD) as
previously described [17]. Infected RK13 cells were maintained in continuous culture in
minimum essential medium (MEM) supplemented with 7% fetal calf serum and 1% penicillin-
sptreptomycin-amphotericin B (Invitrogen, Carlsbad, Calif.). Cultures were subpassaged every 3
weeks. Supernatants from infected flasks containing microsporodian spores were collected
twice weekly and replaced with fresh medium. Spore concentrations were determined by
counting using a hemocytometer (Improved Neubauer).
Polar Tube Protein Isolation Protocol. Polar tube proteins were isolated from other proteins
as previously described [14]. Spores (3x107) in 1% SDS were disrupted with 0.5µm acid washed
glass beads (Sigma, St. Louis, MO) for 4 minutes on a Mini beadbeater (Biospec Products,
Bartlesville,OK). The disrupted spore suspension was separated from the glass beads and
washed 5 times with 1% SDS followed by a brief wash with 9M urea to remove sporoplasm
released from broken spores and soluble spore coat proteins. The pellet was then incubated
with 0.5 ml of 2% DTT in 1xPBS (pH 7.4), 10 µg/ml of aprotinin and leupeptin (Sigma, St. Louis,
MO) and 5 mM EGTA at room temperature for 2 hours to solubilize the polar tubes. Protein
concentration was determined using the Bio-Rad protein assay (Bio-Rad, Hercules, CA).
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 6: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/6.jpg)
6
Cloning and expression of EcPTP1, 2 and 3. DNA was prepared from E. cuniculi by
disrupting spores with 0.5µm acid washed glass beads (Sigma, St. Louis, MO) for 2 minutes on
a Mini beadbeater (Biospec Products, Bartlesville,OK) followed by routine phenol chloroform
extraction as previously published [15]. EcPTP1, without its signal sequence of 60 bases at the
5’-terminal, was amplified by PCR using the following primers (cloning and/or restriction sites
are underlined): EcPTP1 -Forward (GACGACGACAAGATGTAT TCAGCAACCGCA) and
EcPTP1 -reverse (GAGGAGAAGCCCGGTCTAGCAGCATTGG). EcPTP2 and EcPTP3
(truncated) genes were PCR amplified using primer pairs: EcPTP2-Forward-EcoR1
(GCTGAATTCGTTGTTCCACAGCCCGC), EcPTP2-Reverse- Xho1-
(CTCGAGTTACTCTAGACCCTCGCCG) and EcPTP3-Forward-EcoR1- (GGAATTCAAGC
CGCACAACC), EcPTP3-Reverse-Not1 (ATTTGCGGCCGCCTATTCCTTCTT) respectively.
PCR was performed using PCR supermix (Invitrogen, Carlsbad, CA) and the following
conditions: 40 cycles of 94 oC for 30s, 65 oC for 30s and 72 oC for 1.2 min. The amplified
EcPTP1 gene was cloned into a pET-41 Ek/LIC vector (Novagen, Gibbstown, NJ) at the ligation
independent cloning site, the EcPTP2 gene cloned into the EcoR1-Xho1 site of pGEX-4T1 and
EcPTP3 gene into the EcoR1-Not1 site of pGEX-4T1. All of the resultant vectors were
sequenced to confirm that the correct genes had been cloned and that no mutations had been
introduced by the PCR process. These vectors were transfected into BL21DE3 cells and
recombinant EcPTP1, EcPTP2 and EcPTP3 protein was expressed by overnight induction at
37°C using auto induction medium (Novagen San Diego, CA) for EcPTP1- pET-41 Ek/LIC and
1M IPTG for EcPTP2-pGEX-4T and EcPTP3-pGEX-4T.
Expressed recombinant proteins were purified by GST-affinity sepharose beads using
the manufacturer’s standard conditions following lysis of bacterial cells by sonication in lysis
reagent (50 mM tris Ph7.5, 0.1% NP40, 150 mM NaCl, 0.1 mM DTT and protease inhibitor
cocktail (Pierce Biotechnology, Rockford, IL)). The beads were then incubated with 2X gel
sample buffer in boiling water for 5 min and the eluted proteins run on a 10% SDS PAGE gel.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 7: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/7.jpg)
7
The gels were electrotransferred to an Immobilon-P membrane (Millipore, Bedford, Mass.) using
standard conditions. Immunoblot analysis was carried out using an anti-GST monoclonal
antibody (gift of Dr. Peter Davis, Albert Einstein College of Medicine) at a 1:1000 dilution, a
peroxidase conjugated anti-mouse secondary antibody at a 1:5000 dilution (Pierce
Biotechnology, Rockford, IL) and the ECL Western Blotting Detection Reagent (Amersham
International, Buckinghamshire, United Kingdom). This confirmed the expression of and
purification of recombinant (r) proteins of the expected size for rEcPTP1, rEcPTP2 and
rEcPTP3.
Polyclonal antibody production. BALB/c mice were used to produce antibodies using
rEcPTP1, rEcPTP2 and rEcPTP3. Expressed recombinant proteins were purified by GST-
affinity sepharose beads as described above. The beads were then incubated for 5 min in
boiling water with 2X gel sample buffer and the eluted proteins run on a 10% SDS PAGE gel
which was stained with Coomassie Blue. The band containing the expressed protein was cut
out of the SDS-PAGE gel, homogenized in PBS and the polymerized acrylamide removed by
passage of the homogenate through a 0.2 µm Nalgene filter. The average concentration of
protein obtained was 1 mg per ml with a yield of about 300 µl. Purified protein was emulsified
with Hunter's TiterMax Adjuvant (CytRx, Norcross, GA) and injected into groups of 3 mice for
each protein. Each mouse received about 100 µg of recombinant protein. Four weeks later,
animals received a second injection of purified protein. Sera from injected mice were collected
a week after the last injection, aliquoted into 25 µl samples and stored at -20ºC
Immunoblot Analysis. Lysates of E. cuniculi spores were placed in 2X gel sample buffer (100
mM Tris, pH 6.8, 2% SDS, 5% ß- mercaptoethanol, 15% glycerol, 0.01% bromophenol blue)
and then separated using 10% SDS-PAGE. Gels were electrotransferred to Immobilon-P
membranes (Millipore, Bedford, Mass.) using 25 mM Tris, 480 mM glycine and 20% (vol/vol)
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 8: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/8.jpg)
8
methanol buffer and then blocked with 5% non fat dry milk in PBS. Blots were incubated for 1
hour with antibody to rEcPTP1, rEcPTP2 or rEcPTP3 at a 1:1000 dilution, washed in PBS and
then incubated for 1 hour with alkaline phosphatase conjugated anti-mouse (Pierce
Biotechnology, Rockford, IL) at a 1:5000 dilution, washed in PBS and the reaction detected with
BCIP (bromochloroindolyl phosphate)/NBT (nitro blue tetrazolium) using standard protocols.
Electron Microscopy. E. cuniculi infected host cells were fixed for 20 min at room temperature
in 2% paraformaldehyde and 1% gluteraldehyde in PBS, rinsed 4 times in PBS. The samples
were dehydrated in 50, 70, and 85% ethanol, infiltrated with complete LR white resin, placed
into gelatin capsules with fresh LR white resin and polymerized with UV light at room
temperature for 24 hrs. The sections were collected onto formvar coated Ni grids.
For immunoelectron microscopy the sections were blocked in PBS containing 5% BSA,
5% normal goat serum, 0.001% tween-20 at 4°C overnight. Sections were then incubated in
primary antibody (anti-rEcPTP1, anti-rEcPTP2 or anti-rEcPTP3) at a 1:100 dilution in PBS
containing 5% BSA, 0.001% tween-20 at 37°C for 1 hour. The sections were then rinsed three
times in PBS, blot drying them between rinses and incubated with anti-mouse 6 nm gold
antibody (Jackson ImmunoResearch, West Grove, PA) in PBS containing 5% BSA, 0.001%
Tween-20 at 37°C for 1 hour. The sections were then rinsed three times in PBS, three times in
water and air dried overnight. All sections were then stained with 1% uranyl acetate for 30 min,
rinsed three times in water, air dried and examined using a Techni 12 electron microscope at
80-100KV. Images were recorded on Kodak 4489 film and then scanned into Adobe
Photoshop.
Immunofluorescent staining. A T25 flask of RK 13 cells infected with E. cuniculi were
harvested with Trypsin-EDTA and the cell suspension added to three Nunc two chamber sides.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 9: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/9.jpg)
9
The slides were incubated at 37ºC for 48 hrs until the cells were 50% confluent, the culture
medium was removed, the cells rinsed in PBS, and then fixed with 4% PBS buffered formalin for
15 min., and then rinsed in PBS. Following this the slides were blocked in 10% fetal bovine
serum (FBS) in PBS for 1hr at 37ºC. The cultures at this point contained spontaneously
germinated spores as well as intact extracellular spores, intracellular proliferative life stages and
mature spores. After blocking, 100 µL of anti-rEcPTP1 diluted (1:500) in (PBS-FBS) was added
to one chamber of slide one, and one chamber of slide two. Anti-rEcPTP2 was added to one
chamber of slide three. The second chamber of slides 1 through 3 were used as controls so no
primary antibody was added to these chambers, instead a 1% solution of BSA fraction V in PBS
diluted 1:500 in PBS-FBS was substituted for the antibody. All the slides were then incubated
for 1hr at 37ºC. The chambers were then rinsed three times with PBS and incubated with goat
anti-mouse antibody labeled with horse radish peroxidase (HRP)-labeled secondary antibody
(Nanoprobes Inc., Yanpank, NY) for 1hr at 37ºC then rinsed three times with PBS. The slides
were then incubated with tyramide signal amplification reagent (Molecular Probes, Eugene, OR)
as per manufacturers instructions. Slides one and two containing anti-rEcPTP1 and their
controls were conjugated with Alexa Fluor 488 (Molecular Probes, Eugene, OR) at a 1:100
dilution for 10 minutes. Slide 3 containing anti-rEcPTP2 and its control were conjugated with
Alexa Fluor 594 (Molecular Probes, Eugene, OR) at a 1:100 dilution for 10 minutes. All the
chambers were then rinsed several times with PBS. After this first antibody staining, all the
chambers were quenched with 1% hydrogen peroxide in PBS for 5 minutes, followed by three
rinses in PBS and then they were blocked as previously described. The same procedures,
dilutions, and incubations were followed for the second antibody incubation. Both chambers of
slide one were incubated with anti-rEcPTP2, and conjugated with Alexa Fluor 594 (Molecular
Probes, Eugene, OR) at a 1:100 dilution for 10 minutes. Slide two was incubated with anti-
rEcPTP3 then conjugated with Alexa Fluor 594 (Molecular Probes, Eugene, OR) at a 1:100
dilution for 10 minutes. Slide three was incubated with anti-rEcPTP3 conjugated with Alexa
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 10: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/10.jpg)
10
Fluor 488 (Molecular Probes). All the slides were rinsed several times with PBS, drained,
gaskets and chambers removed, and mounted in DABCO (Sigma, St. Louis, MO) and cover
slipped. After the various reactions and rinses were completed, the slides were examined on a
Zeiss Axiovert 200 using 10X, 20X, and 40X objectives in combination with bright field, phase,
and fluorescence illumination. Areas of interest were then identified on each slide and then
examined on a Zeiss LSM 510 scanning confocal microscope with a 40X high resolution
objective (Rutgers-Newark Imaging Center). Samples were illuminated with both 488 nm and
565 nm laser lines. Images were collected on a 12 bit photomultiplier tube. Pinhole settings
were 1 Airy unit for maximum resolution.
Immunoprecipitation. Protein samples were prepared by glass bead disruption of E. cuniculi
spores followed by extraction of polar tube proteins in a 2.5% SDS, 100 mM DTT solution
containing 10 µg/ml of aprotinin and leupeptin. Protein samples were diluted 50 fold in PBS
and then the diluted protein sample was incubated for 30 min on ice with 4 mM of 3,3´-Dithiobis
(sulfosuccinimidylpropionate) (DTSSP; Pierce), a water soluble homobifunctional, thiol-
cleavable and membrane impermeable cross linker. The reaction was quenched by the addition
of 1M Tris, pH 7.5 to a final concentration of 50 mM. Samples were centrifuged at 1000x g, for
30 min and were suspended in SDS sample buffer with or without 2-mercaptoethanol (25% v/v)
for analysis by SDS-PAGE or immunoblotting. As a control, the same reaction was performed
without the addition of DTSSP.
Crosslinked polar tube protein extracts prepared from E. cuniculi PTP lysates as
described above, were immunoprecipitated using anti-EcPTP1 antibody. To create the
immunoaffinity reagent, 10 µl of anti-EcPTP1 or mouse IgG was incubated overnight at 4ºC with
30 µl of protein A in 500 µl (final volume) of PBS, with agitation. The antibody-protein A affinity
reagent was then isolated by centrifugation, washed with PBS and then incubated overnight at
4ºC with 100 µg of E. cuniculi cross-linked protein lysate, with agitation. The antigen-antibody-
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 11: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/11.jpg)
11
protein A complexes were then centrifuged, washed three times with PBS, added to 2X gel
sample buffer in boiling water for 5 min and used for SDS-PAGE. Immuoblot analysis was then
performed using anti-rEcPTP1, anti-rEcPTP2 and anti-rEcPTP3 as described above.
Yeast Two-Hybrid Analysis. Coding regions for Ec-PTP1 full length were amplified from E.
cuniculi DNA using the following primers for each construct,
Ec-PTP1-Full length-Forward-EcoRI (GTCGAATTCTATTCAGCAACCGCACTGTG);
Ec-PTP1-Full length -Reverse-XhoI (CCGCTCGAGCTAGCAGCATTGGACAGC).
EcPTP1-N-terminus-Forward- EcoRI (CGGAATTCTCAGCAACCGCACTGTGCAG); Reverse-
EcPTP1-N-terminus-SalI (ACGCGTCGACTCCCTGACACAAAGTGGCT).
Ec-PTP1-C-Terminus- Forward -EcoRI (CGGAATTCCAGGCCATGCCTAGCACTC);
Ec-PTP1-C-Terminus- Reverse –SalI (ACGCGTCGACCTAGCAGCATTGGACAGCAGT).
EcPTP1-Central: Forward - EcoRI (CCGGAATTCGGAACATCCGGTATTCCTG);
EcPTP1-Central: Reverse -SalI (ACGCGTCGACCTGTCCCTGCTGTCCAG).
Coding regions for EcPTP2 and EcPTP3 were amplified using the following constructs
Ec-PTP2-Full length-Forward-EcoRI (GTCGAATTCGTTGTTCCACAGCCCGC);
Ec-PTP2-Full length-Reverse-XhoI (CCGCTCGAGTTACTCTAGACCCTCGCGG).
Ec-PTP3-Full length: Forward-EcoRI (GGAATTCTCAAGCTCGCATGCCGTC);
Ec-PTP2-Full length-Forward-EcoRI Reverse-SalI (GTCGACCTAACGGGCTACCTTTCC).
Following amplification, each PCR product was then digested with its corresponding enzymes
and inserted into the corresponding sites in the yeast two-hybrid vectors, pAD and pBD (BD
Biosciences Clontech, San Jose, CA). The identity of all clones was confirmed by sequencing
the completed constructs.
For interaction studies, YRG-2 yeast competent cells were transformed simultaneously
with bait and prey constructs and cultured under high stringency screen according to the
manufacturer’s protocol (Strategene, LaJolla, CA). Briefly, 100 µl of competent yeast cells, 100
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 12: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/12.jpg)
12
ug of Herring sperm DNA, 10µg of each pBD construct and pAD construct were added into a
microcentrifuge tube and gently mixed. Following this, 600 µl of TE–LiAc–PEG solution was
added, the solution was mixed by vortexing, the tube was incubated at 30ºC for 30 min with
shaking at 200 rpm, and then 70 µl of DMSO were added. The samples were then subjected to
heat-shock at 42ºC for 15 min and placed on ice for 10 min. Yeast cells were pelleted by
centrifugation at 3000 rpm for 10 seconds, resuspended in 0.5ml TE buffer and plated onto 150
mm SD-selective plates (250 µl each plate) that do not contain Leucine, Tryptophan and
Histidine. The plates were incubated at 30ºC for 2 to 4 days until colonies appeared. Constructs,
pADwt with pBDwt, were used as positive control and pADwt with pLaminC as negative control.
Several independent colonies from each interaction screen (i.e. EcPTP1:EcPTP2,
EcPTP1:EcPTP2, EcPTP2:EcPTP3 etc) were chosen and cultured on -Leu -Trp -His Ade- SD
plates at 30ºC fro 30 hours. Those colonies that grew up from Leu-, Trp-, His-, Ade- SD plates
were sequenced to confirm interacting vectors contained the genes of interest.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 13: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/13.jpg)
13
RESULTS
Protein expression and polyclonal antibody production
EcPTP1, EcPTP2 and EcPTP3 (truncated) were expressed as fusion proteins as noted
in the material and methods section (data not shown) and polyclonal murine antibodies were
prepared using these recombinant proteins. These antisera were able to detect bands
corresponding to EcPTP1, EcPTP2 and EcTPTP3 in E. cuniculi lysate (Figure 1 top panel). No
reactivity was seen in pre-immune sera (data not shown). All of these antisera, anti-EcPTP1,
anti-EcPTP2 and anti-EcPTP2, reacted with the E. cunciuli polar tube by immuno-electron
microscopy (Figure 1 bottom panel, polar tubes indicated by arrows). By IFA, anti-EcPTP1
(figure 2A, 2G), anti-EcPTP2 (figure 2D, 2H) and anti-EcPTP3 (figure 2B, 2E) reacted with
spontaneously extruded polar tubes from E. cuniculi. These sera also reacted with polar tubes
from E. cuniculi spores germinated by exposure to 1% H2O2. The IFA staining seen with anti-
rEcPTP1, anti-rEcPTP2 and anti-rEcPTP3 overlapped suggesting that these proteins were
found at similar locations on the polar tubes (Figure 2C, 2F, 2I). In extruded spores reactivity of
these sera could sometimes be demonstrated to also occur in the residual spores and
sporoplasms, which may represent cross reactive antigens or residual PTPs in these structures.
None of the sera had reactivity to the surface of intact non-germinated spores (data not shown).
PTP1, PTP2 and PTP3 interact to form a large protein complex
When polar tube extract was cross linked using DTSSP, a water soluble chemical cross-
linker, an aggregate was formed at the top of an SDS-PAGE gel which disappeared with β-
mercaptoethanol (25% v/v) treatment which breaks the S-S bond of the cross linker (Figure 3A).
Immunoblot analysis of cross-linked proteins, immunoprecipitated with anti-rEcPTP1
demonstrates that EcPTP1, EcPTP2 and EcPTP3 are detected (Figure 3B). These data
suggest that anti-EcPTP1 was able to pull down a cross linked protein complex that included
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 14: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/14.jpg)
14
EcPTP1, EcPTP2 and EcPTP3. We, therefore, sought to investigate which of these proteins
could associate with each other.
Yeast two hybrid studies of PTP interactions
The possibility of an interaction among the various PTPs (i.e. EcPTP1, EcPTP2 and
EcPTP3) was investigated using yeast two hybrid analysis. In these experiments, the EcPTPs
were analyzed in all possible pairwise combinations, fused to either the bait vector or prey
vector. EcPTP1, EcPTP2 and EcPTP3 full length (FL) genes were used as the bait and
EcPTP1-FL, EcPTP2-FL and EcPTP3-FL as the prey to determine if these proteins interacted in
vivo using a yeast two-hybrid system. These interactions were repeated by switching the prey
and the bait vectors. Figure 4 demonstrates that the full length EcPTP1 protein interacts, in
vivo, with full length EcPTP1, EcPTP2 and EcPTP3 and that full length EcPTP2 and EcPTP3
also interact with each other in all possible combinations. This is consistent with the hypothesis
that EcPTP1 can interact with itself in the formation of the polar tube as well as with other polar
tube proteins. It also suggests that PTP2 and PTP3 can also interact with themselves as well
as with other PTPs.
When EcPTP1 is compared to other microsporidian PTP1s including those of E. hellem
and E. intestinalis the areas of highest similarity are seen in the N-terminal and C-terminal
regions [31]. These N- and C- terminal regions contain multiple cysteines which are probably
involved in the ability of EcPTP1 to form the polar tube, as evidenced by the ability of reducing
agents, such as DTT, to solubilize this structure. The central region of the proteins which has a
repetitive motif is very different among these and the few other Microsporidia in which this gene
has been cloned. We, therefore, sought to determine if the observed interactions of EcPTP1
with itself occurs at the N- or C-terminal region of this protein. Figure 5 demonstrates that like
the full length EcPTP1, the truncated N- and C-terminal regions of EcPTP1 were able to
interact, in vivo, with each other in all possible combinations.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 15: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/15.jpg)
15
The central region of EcPTP1, amino acids 174 to 289, contains a region with a
repeated amino acid motif. Although a repetitive motif is present in E. cuniculi, E. intestinalis
and E. hellem, it is different in each of these closely related organisms. We have hypothesized
that this region may be involved in antigenic masking of the polar tube and would not be
involved in protein-protein interactions in this structure [30, 31]. Therefore, a construct was
produced expressing the EcPTP1 central gene sequence and this was studied for its ability to
interact with the full length, N-terminal and C-terminal region of Ec-PTP1. As demonstrated in
Figure 6, the protein encoded by the central region of EcPTP1 did not interact with any of the
other constructs used in this experiment (i.e. it did not interact with EcPTP1-FL, EcPTP1-Nterm,
EcPTP1-C term, EcPTP2-FL or EcPTP3-FL). These interactions were confirmed by switching
the prey and the bait vectors. In addition, EcPTP1-central did not react with itself (Supplemental
Figure 1).
While both N-terminal and C-terminal constructs of EcPTP1 were able to interact with
each other and with full length EcPTP1 we sought to determine if each of these constructs was
able to interact with full length EcPTP2 or EcPTP3 as we had already demonstrated for full
length EcPTP1 (figure 4). As shown in figure 6, neither the N-terminal or C-terminal EcPTP1
construct interacted with EcPTP2 or EcPTP3.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 16: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/16.jpg)
16
DISCUSSION
When it is within the spore the polar filament (tube) contains electron dense material, but
after germination it forms a hollow tube through which the sporoplasm and nucleus travels to
infect a host cell [12, 25]. It is not known if the formation of this tube is due to polymerization of
PTPs during germination at the growing tip of the polar tube or due to conformational changes
in PTPs as the polar tube unfolds at its growing tip. Understanding the formation of the polar
tube apparatus and the function of its components is essential for our understanding of spore
germination and cell invasion in the Microsporidia.
The major polar tube protein gene (ptp1) of E. cuniculi, E. hellem and E. intestinalis has
been cloned and the corresponding protein (PTP1) expressed in vitro [5-7,15]. Clones have
also been obtained for the ptp1 of several different isolates of E. hellem, G. americanus and
Anncaliia (B.) algerae [11, 19, 27, 29 and Weiss LM unpublished data]. E. hellem ptp1 is 1362
bp encoding a 453 amino acid protein with a predicted molecular mass of 43 kDa, the ptp1 of E.
cuniculi is 1188 bp encoding a 395 amino acid protein with a predicted molecular mass of 37
kDa [6, 15]; however, these proteins have post translational modifications which increase their
apparent molecular mass on electrophoresis. These two Microsporidia are in the same genus,
cannot be distinguished ultrastructurally, their polar tubes have functional identity and their
native PTP1s have similarities in overall amino acid composition, hydrophobicity, mass and
immunologic epitopes [26]; despite this their translated PTP1s have only limited identity in their
amino acid sequences. Further comparison does, however, reveal similarities. Both translated
proteins have a high number of proline and glycine residues, a similar percentage of cysteine,
and lack arginine, tryptophane and phenylalanine. The spatial distribution of both the cysteine
and proline residues is conserved in both proteins. This suggests that conservation of function
of these proteins may be provided by conservation of secondary structural motifs [26]. The N
and C-terminus of these proteins display conservation suggesting that these areas may have
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 17: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/17.jpg)
17
important structural or functional domains. In the Encephalitzoonidae PTP1s the C-terminus is
high in cysteine residues and the last amino acid is a cysteine, which may be important for
interaction between proteins. It has been hypothesized that the interactions of PTP1 with itself
were sufficient for formation of the polar tube during germination of the spore. The data
presented in the current paper demonstrate that EcPTP1 is capable of interacting with itself and
that both the N-terminal and C-terminal regions of EcPTP1 have domains capable of interacting
with full length and truncated versions of EcPTP1.
While PTP1 is the major component of the polar tube, several other putative PTPs have
been identified. For example, PTPs of 23, 27 and 34 kDa have been identified in G.
americanus using mAbs produced to the DTT solubilized polar tube [13] and by 2D
electrophoresis several proteins can be seen in DTT solubilized E. hellem polar tube
preparations [27]. Polyclonal and monoclonal antibodies that localized to the polar tube by IFA
and immune-electron microscopy have identified putative PTPs of 34, 75, and 170 kDa in G.
atherinae, 35, 52/55, and 150 kDa in E. cuniculi, 60 and 120 kDa in E. intestinalis and 46, 34, 21
and 15 kDa in Nosema grylli [1, 4, 8]. Of these the genes for, ptp2 [5], encoding a 35-kDa E.
cuniculi protein seen on SDS-PAGE, and ptp3 [20], encoding a ∼150 kDa protein seen on SDS-
PAGE have been cloned. The N-terminal sequence of EcPTP2 has a characteristic signal
peptide (for Golgi-ER processing similar to EcPTP1), the central region contains a lysine-rich
octapeptide motif (KPKKKKSK) and the C-terminal region of 27 residues is devoid of any basic
residues and possesses 4 aspartate and 5 glutamate residues forming an acidic tail. EcPTP2
has one putative N-glycosylation site and one RGD motif (possibly involved in a protein-protein
interaction). EcPTP3 is synthesized as a 1256-amino acid precursor with a cleavable signal
peptide and is encoded by a single transcription unit (3990 bp) located on the chromosome XI of
E. cuniculi [20]. Unlike EcPTP1 and EcPTP2, EcPTP3 can be solubilized in the presence of
SDS alone without the need for a reducing agent such as DTT [20]. It has been hypothesized
that PTP3 may act as scaffolding protein for polar tube formation during development.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 18: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/18.jpg)
18
In this paper we examined in detail the interactions of EcPTP1, EcPTP2 and EcPTP3
using yeast two hybrid analysis to verify if these polar tube proteins interact with each other and
to further define the complex of proteins present in the polar tube. As PTP1 is the major protein
present in the polar tube of the Microsporidia, we focused on studying possible interactions
between this major protein (EcPTP1) with itself and EcPTP2 and EcPTP3. Full length Ec-PTP1,
Ec-PTP2 and Ec-PTP3 were analyzed in all possible pair wise combinations, as bait or prey.
Results indicated that full length EcPTP1 interacts, in vivo, with other EcPTPs and with itself. In
addition, we demonstrated that in mature spores EcPTP1, EcPTP2 and EcPTP3 interact with
each other as demonstrated by co- immunoprecipitation. DTSSP, a chemical cross-linker,
creating disulfide linkage between proteins, was used to facilitate crosslinking. Data from SDS-
PAGE and immunoblotting (not shown) demonstrated that DTSSP caused the formation of large
protein aggregates in unreduced samples (which barely entered the gel). Once such cross
linked samples were reduced with 25% 2-mercaptoethanol separate bands were identified by
immunoblot analysis reacting with antiserum to rEcPTP1, rEcPTP2 and rEcPTP3. This
indicated the presence of all EcPTPs when the protein samples were pulled down using
antibody to EcPTP1. In addition, immunofluorescence techniques verified that EcPTP1,
EcPTP2 and EcPTP3 are located at similar positions on extruded polar tubes.
The N-terminus and C-terminus, as well as central region of PTP1 were tested in order
to determine if they might interact with full length PTP1 and with each other. The N and C-
terminus PTP1 appears to be more conserved among the various Microsporidia examined than
the central repeat region of this protein. It has been hypothesized that this indicates that the N-
and C-terminus may, therefore, contain interacting domains. Yeast 2 hybrid analyses confirmed
that both the N-and C-terminus contained domains that interacted with full length and the N- and
C terminal constructs of PTP1; however, neither the N- nor C- terminus constructs were
sufficient to allow PTP1 to interact with either PTP2 or PTP3. Full length PTP1 was able to
interact with both PTP2 and PTP3. This suggests that the interaction of the full length EcPTP1
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 19: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/19.jpg)
19
with these other polar tube proteins may require a motif found in both the N and C terminus of
EcPTP1 or that these interactions depend on a conformational epitope only seen when the full
length EcPTP1 is expressed.
All of the cloned microsporidian PTP1s have central amino acid repeat regions that are
predominantly hydrophilic. However, the repeats are different in composition and number
among the Microsporidia. It is possible that this region is not important for the assembly of the
polar tube and may function as an immunologic mask. Analysis of ptp1 from several isolates of
E. hellem supports this view as the number of repeats in the central region of their ptp1 is
variable [11, 19, 27, 29]. In the process of evolution a similar duplication of internal sequences
has been noted in malaria and other protozoan genes and this mechanism may be operative in
the Microsporidia ptp1 [21]. Consistent with this hypothesis we could not demonstrate any
interactions of the central region of EcPTP1 with EcPTP2, EcPTP3 or with the N- or C-terminal
constructs of EcPTP1.
This study presents the first detailed examination of the interaction of the three identified
polar tube proteins (PTP1, PTP2 and PTP3) from a Microsporidia. It provides the necessary
data for more detailed analysis of these interactions by mutagenesis or other studies.
Determination of the structure of these proteins would also prove useful in understanding how
these various polar tube proteins interact to produce the versatile invasion apparatus used by
this widely disseminated parasitic protist group. As direct genetic manipulation of these
organisms has not been developed, such biochemical approaches to the analysis of these
protein interactions and the structure of the polar tube are crucial for improving our
understanding of these important pathogens.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 20: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/20.jpg)
20
ACKNOWLEDGMENT
This work was supported by National Institutes of Health Grants AI31788 and 5R44GM064257
from the National Institute of Allergy and Infectious Diseases.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 21: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/21.jpg)
21
FIGURE LEGENDS
Figure 1: Analysis of rPTP antisera
Top Panel: Immunoblot analysis. Protein lysates were prepared from E. cuniculi run on 10%
SDS-PAGE, transferred to nitrocellulose and examined using anti-rPTP. Anti-rEcPTP1 (1:5000
dilution), anti-rEcPTP2 (1 :5000 dilution) and anti-rEcPTP3 (1:1000 dilution). Bands
corresponding to EcPTP1, EcPTP2 and EcPTP3 were seen in the corresponding immunoblots.
No bands were seen in pre-immune sera (data not shown).
Bottom Panel: Immunoelectron microscopy. E. cuniculi spores (see materials and methods
for fixation details). (A) anti-rEcPTP1 (1:100 dilution), (B) anti-rEcPTP2 (1:100 dilution), insert is
an enlarged section of the image, and (C) anti-rECPTP3 (1:100 dilution). All of the antisera
react with the polar tube (arrows). Bar length is 600 nm. Gold particles are 6 nm.
(D) Representative negative control (pre-immune serum at 1:100 dilution), No gold labeling is
seen, EN=endospore, Ex = Exospore, ANT = anterior portion of polar filament, R = ribosomes,
Polar tube (arrows). Bar length 500 nm.
Figure 2: Immunofluorescent analysis of rPTP antibodies.
Confocal images of extruded polar tubes of E. cuniculi that were initially incubated with one of
the three polar tube antibodies anti-rPTP1, anti-rEcPTP2, or anti-rEcPTP3. After their initial
incubation with their respective antibody and tyramide signal amplified fluorescent label the
polar tubes were dual labeled with a second polar tube antibody and a tyramide fluorescent
label (see materials and methods). Control pre-immune sera did not display any reactivity in
this assay.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 22: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/22.jpg)
22
Panel A, B, C. Merged image of an E. cuniculi polar tube incubated with anti-rEcPTP-1 (panel
A) labeled with Alexa Fluor 488 (green) and anti-rEcPTP3 (panel B) labeled with Alexa Fluor
594 (red). Panel C demonstrates the merged image. Note the presence of both red and green
signal along the polar tube and areas of yellow signal where they overlap. Bar length for the
group as shown in the first panel is 5µm.
Panel D, E, F. Merged image of an E. cuniculi polar tube incubated with anti-rEcPTP-2 (panel
D) labeled with Alexa Fluor 488 (green) and anti-rEcPTP3 (panel E) labeled with Alexa Fluor
594 (red). Panel F demonstrates the merged image. Note the presence of both red and green
signal along the polar tube and areas of yellow signal where they overlap. Bar length for the
group as shown in the first panel is 5µm.
Panel G, H, I. Merged image of an E. cuniculi polar tube incubated with anti-rEcPTP-1 (panel
G) labeled with Alexa Fluor 488 (green) and anti-rEcPTP2 (panel H) labeled with Alexa Fluor
594 (red). Panel I demonstrates the merged image. Note the presence of both red and green
signal along the polar tube and areas of yellow signal where they overlap. Bar length for the
group as shown in the first panel is 5µm.
Figure 3. EcPTP1, EcPTP2 and EcPTP3 form a protein complex.
Panel A: SDS PAGE analysis. Coomassie blue stained gel of protein samples made from E.
cuniculi spores, cross-linked with 4 mM DTSSP, without (-) or with (+) treatment with β-
mercaptoethanol (25% v/v). Protein markers are in kDA. A large complex (arrow) at the top of
the gel disappears with mercaptoethanol treatment.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 23: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/23.jpg)
23
Panel B Immunoprecipitation analysis. Protein samples were extracted from E. cuniculi,
cross-linked with DTSSP, then immunoprecipitated with a control anti-mouse IgG (lane 2) or
with anti-rEcPTP1 (lane 3). Lane 1 is the protein markers (kDa standards). Immunoprecipitates
were treated with gel sample buffer (containing reducing agents) and run on 12% SDS-PAGE,
transferred to nitrocellulose and probed with anti-rEcPTP1 (1:2000), anti-rEcPTP2 (1:2000) or
anti-rEcPTP3 (1:2000). Reactions were detected with an alkaline phosphatase conjugated anti-
mouse IgG (1:5000) and detected with BCIP/NBT. Anti-rEcPTP1 was able to precipitate a
complex which contained EcPTP1, EcPTP2 and EcPTP3. The control antiserum did not
precipitate this complex.
Figure 4: Yeast two hybrid analysis of PTP interactions. This demonstrates the interactions
of pAD and p BD (bait and prey) constructs containing full length EcPTP1, full length Ec-PTP2
and full length Ec-PTP3. The negative control pBDwt/pADplasminC and positive control
pBDwt/pADwt reactions are provided. This demonstrates that all three EcPTPs can interact
with themselves and each other, although the domains responsible for this interaction remain to
be determined.
Figure 5: Yeast two hybrid analysis of the interaction of EcPTP1 N-terminal and C-
terminal domains. This demonstrates the interactions of pAD and p BD (bait and prey)
constructs containing full length EcPTP1 (EcPTP-FL), N terminal Ec-PTP1 (EcPTP-NT) and C
terminal Ec-PTP1 (EcPTP-CT). The negative control pBDwt/pADplasminC and positive control
pBDwt/pADwt reactions are provided. This demonstrates that both the N- and C-terminal
regions of EcPTP1 can interact with each other and themselves.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 24: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/24.jpg)
24
Figure 6: Yeast two hybrid analysis of the interactions of the EcPTP1 N-terminal, C-
terminal and central repeat domains with EcPTP2 and EcPTP3.
Panel A. Interactions between EcPTP1-FL as a bait, and EcPTP1-FL (1), EcPTP1-NT (2),
EcPTP1-Cent (3), EcPTP1-CT (4) as a prey.
Panel B Interactions between EcPTP2-FL, as a bait and EcPTP1-FL (1), EcPTP1-NT (2),
EcPTP1-Cent (3), EcPTP1-CT (4) as a prey
Panel C. Interactions between EcPTP3-FL, as a bait and EcPTP1-FL (1), EcPTP1-NT (2),
EcPTP1-Cent (3), EcPTP1-CT (4) as a prey
A positive control (pBDwt/pADwt), (P) and a Negative control (pBDwt/pADplasminC) (N) are
shown in each group.
This demonstrates that the central region of EcPTP1 (EcPTP1-Cent) does not contain any
interacting domains. In addition, while EcPTP1FL can interact with either EcPTP3FL or
EcPTP2FL, neither the N-terminal or C-terminal domains are sufficient for this interaction to
occur.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 25: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/25.jpg)
26
REFERENCES
1. Beckers, P.J., Derks, G.J., Gool, T., Rietveld, F.J., and R. W. Sauerwein. 1996.
Encephalitozoon intestinalis-specific monoclonal antibodies for laboratory diagnosis of
microsporidiosis. J Clin Microbiol 34, 282-285.
2. Corradi, N., Akiyoshi, D.E., Morrison, H.G., Feng, X., Weiss, L.M., Tzipori, S., and
P.J. Keeling. 2007. Patterns of genome evolution among the microsporidian parasites
Encephalitozoon cuniculi, Antonospora locustae and Enterocytozoon bieneusi. PLoS
ONE. 2:e1277.
3. Cali, A., Weiss, L.M., and P.M. Takvorian. 2002. Bracheola algerae spore membrane
systems, their activity during extrusion, and a new structural entity, the multilayered
interlaced network, associated with the polar tube and the sporoplasm. J. Eukaryot.
Microbiol. 49, 164-174.
4. Delbac, F., Duffieux, F., David, D., Metenier, G., and C. P. Vivares. 1998.
Immunocytochemical identification of spore proteins in two microsporidia, with emphasis
on extrusion apparatus. J Eukaryot Microbiol 45, 224-231.
5. Delbac, F., Peuvel, I., Metenier, G., Peyretaillade, E.,and C. P. Vivares. 2001.
Microsporidian invasion apparatus: identification of a novel polar tube protein and
evidence for clustering of ptp1 and ptp2 genes in three Encephalitozoon species. Infect
Immun 69, 1016-1024.
6. Delbac, F., Peyret, P., Metenier, G., David, D., Danchin, A., and C.P. Vivares, C.P.
1998. On proteins of the microsporidian invasive apparatus: complete sequence of a
polar tube protein of Encephalitozoon cuniculi. Mol Microbiol 29, 825-834.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 26: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/26.jpg)
27
7. Desportes, I., Le Charpentier, Y., Galian, A., Bernard, F., Cochand-Priollet, B.,
Lavergne, A., Ravisse, P., and R. Modigliani. 1985. Occurrence of a new
microsporidian: Enterocytozoon bieneusi n. g., n. sp., in the enterocytes of a human
patient with AIDS. J Protozool 32:250-245.
8. Dolgikh, V.V. and P.B. Semenov, P.B., 2003. The spore wall and polar tube proteins of
the microsporidian Nosema grylli: the major spore wall protein is released before spore
extrusion. Tsitologiia 45, 324-329.
9. 34. Foucault, C., and M. Drancourt. 2000. Actin mediates Encephalitozoon intestinalis
entry into the human enterocyte-like cell line, Caco-2. Microb Pathog 28:51-58
10. .Franzen C. 2005. How do microsporidia invade cells? Folia Parasitol (Praha). 52:36-
40.
11. Haro, M., Del Aguila, C., Fenoy, S., and N. Henriques-Gil. 2003. Intraspecies
genotype variability of the microsporidian parasite Encephalitozoon hellem. J Clin
Microbiol 41, 4166-4171
12. Ishihara, R. 1968. Some observations on the fine structure of sporoplasm discharged
from spores of a microsporodia, Nosema bombycis. J. Invert. Pathol. 12; 245-258.
13. Keohane, E., Takvorian, P.M., Cali, A., Tanowitz, H.B., Wittner, M., and L. M. Weiss.
1994. The identification and characterization of a polar tube reactive monoclonal
antibody. J Eukaryot Microbiol 41, 48S.
14. Keohane, E.M., Takvorian, P.M., Cali, A., Tanowitz, H.B., Wittner, M., and L. M.
Weiss. 1996. Identification of a microsporidian polar tube protein reactive monoclonal
antibody. J Eukaryot Microbiol. 43:26-31.
15. Keohane, E.M., Orr, G.A., Zhang, H.S., Takvorian, P.M., Cali, A., Tanowitz, H.B.,
Wittner, M., and L. M. Weiss. 1998. The molecular characterization of the major polar
tube protein gene from Encephalitozoon hellem, a microsporidian parasite of humans.
Mol Biochem Parasitol 94, 227-236.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 27: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/27.jpg)
28
16. Keohane, E.M., and L. M. Weiss, L.M. 1998. Characterization and function of the
microsporidian polar tube: a review. Folia Parasitol 45, 117-127.
17. Keohane, E.M., Orr, G.A., Takvorian, P.M., Cali, A., Tanowitz, H.B., Wittner, M., and
L. M. Weiss. 1999. Polar tube proteins of microsporidia of the family
.Encephalitozoonidae. J Eukaryot Microbiol 46, 1-5.
18. Lee, S.C., Corradi, N., Byrnes, E.J. 3rd, Torres-Martinez, S., Dietrich, F.S., Keeling,
P.J., and J. Heitman. 2008. Microsporidia evolved from ancestral sexual fungi. Curr
Biol. 18:1675-9.
19. Peuvel, I., Delbac, F., Metenier, G., Peyret, P., and C. P. Vivares. 2000.
Polymorphism of the gene encoding a major polar tube protein PTP1 in two
microsporidia of the genus Encephalitozoon. Parasitology 121 Pt 6, 581-587.
20. Peuvel, I., Peyret, P., Metenier, G., Vivares, C.P., and F. Delbac. 2002. The
microsporidian polar tube: evidence for a third polar tube protein (PTP3) in
Encephalitozoon cuniculi. Mol Biochem Parasitol 122, 69-80.
21. Rich, S.M., and F. J. Ayala. 2000. Population structure and recent evolution of
Plasmodium falciparum. Proc Natl Acad Sci U S A 97, 6994-7001.
22. Takvorian, P., Weiss L.M., and A. Cali. 2005. The early events of Brachiola algerae
(Microsporidia) infection: spore germination, sporoplasm structure, and development
within host cells. Folia Parasitologica 52, 118-129.
23. Southern, T.R., Jolly, C.E., Lester, M.E., and J. R. Hayman. 2007. EnP1, a
microsporidian spore wall protein that enables spores to adhere to and infect host cells
in vitro.Eukaryot Cell. 6:1354-1362
24. Vavra J. 1976. Structure of the microsporidia. In: Bulla LA Jr, Cheng TC, eds.,
Comparative Pathobiology, v. 1. New York: Plenum Press; 1-85.
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 28: Downloaded from on July 14, 2020 by guest · 3/22/2010 · clinical diseases. Diarrhea associated with microsporidiosis a nd HIV infection was first reported in 1985 [7]. In addition](https://reader036.fdocuments.us/reader036/viewer/2022071218/604eca9e39c73d33d34dd212/html5/thumbnails/28.jpg)
29
25. Vivares, C.P., and G. Metenier. 2000. Towards the minimal eukaryotic parasitic
genome. Curr Opin Microbiol 3:463-467.
26. Weidner, E. 1972. Ultrastructural study of microsporidian invasion into cells. Z.
Parasitenkd. 40:227-242
27. Weiss, L.M., 2001. Microsporidia: emerging pathogenic protists. Acta Trop 78, 89-102.
28. Wittner, M., and L.M. Weiss. 1999. The microsporidia and microsporidiosis. ASM
Press, Washington, D.C. 1-553.
29. Xiao, L., Li, L., Visvesvara, G.S., Moura, H., Didier, E.S., and A. A. Lal. 2001.
Genotyping Encephalitozoon cuniculi by multilocus analyses of genes with repetitive
sequences. J Clin Microbiol 39, 2248-2253.
30. Xu, Y., Takvorian, P.M., Cali, A., Orr, G., and L. M. Weiss. 2004. Glycosylation of the
major polar tube protein of Encephalitozoon hellem, a microsporidian parasite that
infects humans.Infect Immun. 72:6341-6350
31. Xu, Y., and L. M. Weiss. 2005. The microsporidian polar tube: a highly specialised
invasion organelle. Int J Parasitol. 35:941-53.
32. Xu, Y., Takvorian, P., Cali, A., Wang, F., Zhang, H., Orr, G., and L. M. Weiss. 2006.
Identification of a new spore wall protein from Encephalitozoon cuniculi .Infect Immun.
74:239-247
on March 14, 2021 by guest
http://iai.asm.org/
Dow
nloaded from